Aptamer for specifically recognizing jasmonic acid methyl ester as well as screening method and application of aptamer

Abstract

The invention provides an aptamer for specific recognition of jasmonic acid methyl ester and a screening method and application thereof. Compared with the prior art, the screening method comprises the following steps: 1) screening of the aptamer: carrying out heating annealing treatment on an initial ssDNA library and a biotinylated capture probe, cooling to room temperature, incubating with streptavidin magnetic beads, adding target jasmonic acid methyl ester, incubating, and collecting the aptamer; carrying out magnetic separation and taking supernate as a template for PCR amplification; 2) carrying out PCR amplification; 3) preparing secondary ssDNA as an initial library of the next round; and 4) carrying out circulating screening to obtain the aptamer MeJA-52 capable of specifically recognizing the jasmonic acid methyl ester. According to the invention, methyl jasmonate is taken as a positive screening target, salicylic acid and indoleacetic acid are taken as negative screening targets to improve the specificity of the aptamer, the aptamer in high-specificity binding with methyl jasmonate is obtained through 15 rounds of screening, a new recognition element is provided for quantitative detection of methyl jasmonate in plants, and the application prospect is wide.

Description

Technical Field

[0001] The invention relates to the technical field of aptamers, and in particular to an aptamer capable of specifically recognizing methyl jasmonate and a screening method and application thereof, which are used for methyl jasmonate detection. Background Art

[0002] Methyl jasmonate (MeJA) is a methylated derivative of jasmonic acid (JA). As an important plant hormone, it regulates a series of physiological processes of plants together with other plant hormones. In particular, in response to various environmental stresses, MeJA significantly enhances the adaptability and resistance of plants to adversity. In addition to being a signal molecule in plants, MeJA can also volatilize into the air through stomata to achieve information transmission between plants and between plants and herbivores. MeJA can also be used as an effective antibacterial agent, food preservative, and antioxidant in agricultural production, storage, and transportation. Due to the important physiological effects of methyl jasmonate and its relatively low content in plants, the detection of methyl jasmonate has received increasing attention.

[0003] At present, quantitative detection methods for MeJA include enzyme-linked immunosorbent assay (ELISA), liquid chromatography-tandem mass spectrometry (LC-MS / MS), gas chromatography-mass spectrometry (GC-MS), fluorescence method (CE-LIF), high performance liquid chromatography (HPLC), etc. These methods require strict and cumbersome pretreatment, and have disadvantages such as complex operation, need for professional personnel to operate, and expensive instruments, which cannot be applied to large-scale popularization and efficient detection on site.

[0004] Aptamers refer to single-stranded DNA or RNA with high affinity and strong specificity obtained by screening from a random single-stranded library through the exponential enrichment ligand system (SELEX). Aptamers contain primer regions at both ends and random sequences in the middle, and most of them contain 15-100 oligonucleotides. They can be folded into different secondary and tertiary structures through interactions such as hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic interactions to bind to target molecules. Aptamers can be screened in vitro, are easy to chemically modify, and have good thermal stability. The sensing analysis method based on aptamers is expected to become an important means of detecting the content of methyl jasmonate.

[0005] There are currently no reports on aptamers for methyl jasmonate, and the methyl jasmonate content detection technology based on aptamer sensing analysis depends on the successful screening of methyl jasmonate aptamers. Therefore, it is necessary to screen out methyl jasmonate aptamers with high affinity and strong specificity. Summary of the invention

[0006] The present invention aims to provide an aptamer that specifically recognizes methyl jasmonate and a screening method thereof. Methyl jasmonate is used as a target, salicylic acid and indoleacetic acid are used as counter-screening molecules, and Capture-SELEX is used to screen aptamers of methyl jasmonate plant hormone to obtain an aptamer MeJA-52 with high affinity and strong specificity.

[0007] Another object of the present invention is to provide an application of an aptamer that specifically recognizes methyl jasmonate for rapid detection of methyl jasmonate.

[0008] The specific technical solutions of the present invention are as follows:

[0009] An aptamer that specifically recognizes methyl jasmonate is MeJA-52, and the sequence of the MeJA-52 is:

[0010] GGACGACGGCAGTTTGCGACTAGCGTATGACTGACGCTGTCGTCC; its sequence is shown in SEQ ID NO: 1.

[0011] The present invention provides a method for screening an aptamer that specifically recognizes methyl jasmonate, comprising the following steps:

[0012] 1) Screening of aptamers: The initial ssDNA library and the biotinylated capture probe were heated and annealed, cooled to room temperature, incubated with streptavidin magnetic beads, and the target methyl jasmonate was added for incubation. The supernatant was magnetically separated and used as a template for PCR amplification;

[0013] 2) PCR amplification;

[0014] 3) Prepare secondary ssDNA as the initial library for the next round;

[0015] 4) Perform cyclic screening to obtain an aptamer that specifically recognizes methyl jasmonate.

[0016] In step 1), the initial library used is a 72 nt single-stranded oligonucleotide, including upstream and downstream primers and 30 random nucleotide sequences in the middle.

[0017] In step 1), methyl jasmonate is used as the positive screening target, salicylic acid and indoleacetic acid are used as the counter-screening targets, and the ssDNA bound to the counter-screening targets is removed by magnetic separation to improve the specificity of the aptamer.

[0018] In step 2), the PCR amplification system is: forward primer: 2.5 μL (10 μM), biotinylated reverse primer: 2.5 μL (10 μM), 5 μL 10×PCR Buffer, 4 μL dNTP (each 2.5 mM), 0.25 μL TaKaRa Taq HS (5 U / μl), 30.75 μL sterile water, and 5 μL ssDNA.

[0019] The PCR program in step 2) was: 98°C, 30s, N cycles [98°C, 10s; 59°C, 15s; 72°C, 20s], 72°C, 2min; the cycle number N was verified by 10% PAGE gel electrophoresis.

[0020] In step 3), the secondary ssDNA was prepared by incubating the PCR product with streptavidin magnetic beads, dissociating the double-stranded DNA with NaOH solution, collecting the supernatant and neutralizing it with HCl as the initial library for the next round.

[0021] In step 4), the secondary library is put into the next round of screening, so that aptamers with high affinity are continuously enriched until the target aptamer is screened out.

[0022] The final round of PCR products were subjected to high-throughput sequencing, affinity analysis, and specificity verification to specifically identify the aptamer of methyl jasmonate.

[0023] The SGI fluorescence method was used to measure the fluorescence value with a multifunctional microplate reader to determine the dissociation constant of the screening sequence, thereby analyzing the affinity and specificity of the aptamer sequence. The conformational changes of the aptamer before and after binding to methyl jasmonate were analyzed by circular dichroism and molecular docking simulation to clarify its binding mechanism and main binding site.

[0024] The invention provides an application of an aptamer for specifically recognizing methyl jasmonate, which is used for detecting methyl jasmonate.

[0025] The detection method is as follows: the aptamer MeJA-52 labeled with FAM fluorescent dye is annealed at 95°C before use, and then the aptamer MeJA-52 is evenly mixed with MeJA solutions of different concentrations, incubated at 37°C in the dark for 60 minutes, and then Fe-MOF is added to the mixed solution and incubated in each reaction solution for 15 minutes; finally, the fluorescence intensity is measured using a fluorescence spectrophotometer, and each group of experiments is measured three times in parallel. The fluorescence intensity ratio F / F0 of the experimental group and the control group is calculated, and a standard curve is drawn with the fluorescence intensity ratio as the vertical axis and the MeJA concentration as the horizontal axis. The standard curve is used to detect methyl jasmonate.

[0026] The present invention provides a method for screening methyl jasmonate plant hormone aptamers by using Capture-SELEX, with methyl jasmonate as a target, salicylic acid and indoleacetic acid as counter-screening molecules, so as to obtain a high-affinity, highly specific aptamer MeJA-52. The screened aptamer is used as a novel recognition element to construct a biosensor, which can realize the synchronous detection of methyl jasmonate in plants. The method is simple to operate, does not require the use of expensive instruments, and can be applied to large-scale popularization and efficient detection on site. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of aptamer screening;

[0028] Figure 2 Optimize gel image for PCR cycle number;

[0029] Figure 3 The PCR products of the aptamer and the negative PCR gel images;

[0030] Figure 4 This is a monitoring diagram of the aptamer screening process;

[0031] Figure 5 is the secondary structure diagram of the aptamer;

[0032] Figure 6 To analyze the affinity of candidate aptamers based on SGI fluorescence method;

[0033] Figure 7 Circular dichroism analysis of aptamer and methyl jasmonate;

[0034] Figure 8 Molecular docking simulation analysis of aptamer and methyl jasmonate;

[0035] Fig. 9 Schematic diagram of the detection process of methyl jasmonate;

[0036] Fig.10 is the effect of Fe-MOF concentration on fluorescence intensity;

[0037] Fig.11 is the effect of the incubation time of aptamer and Fe-MOF on the fluorescence intensity;

[0038] Fig.12 is the effect of the incubation time of aptamer and MeJA on the fluorescence intensity;

[0039] Fig.13 It is the scanning electron microscope image (SEM) of Fe-MOF;

[0040] Fig.14 This is the transmission electron microscopy (TEM) image of Fe-MOF;

[0041] Fig.15 is the X-ray diffraction pattern (XRD) of Fe-MOF powder;

[0042] Fig.16 is the Fourier transform infrared spectrum (FT-IR) of Fe-MOF;

[0043] Fig.17 It is the UV-visible absorption spectrum of Fe-MOF;

[0044] Fig.18 is the fluorescence intensity of the detection of different concentrations of MeJA;

[0045] Fig.19 It is the detection curve of the present invention;

[0046] Fig. 20 This is a specific comparison of the present invention. DETAILED DESCRIPTION

[0047] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0048] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0049] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0050] The main reagents used in the present invention are shown in Table 1.

[0051] Table 1 Main reagents used in the present invention

[0052]

[0053] Example 1

[0054] A method for screening an aptamer that specifically recognizes methyl jasmonate comprises the following steps:

[0055] 1) The screening process of aptamers is as follows Figure 1As shown: First, 14.9 μL (100 μM) of random single-stranded DNA library (initial ssDNA library) and 22.35 μL of biotinylated capture probe were placed in 1×SELEX Buffer, heated at 95°C for 10 minutes, and cooled to room temperature for at least 20 minutes to allow the library to hybridize with the capture strand. Then, the mixture was mixed with streptavidin magnetic beads and incubated for 45 minutes to fix the library hybridization complex through the interaction between biotin and streptavidin, and washed 12 times with 1×SELEX Buffer to remove non-specific dissociation and unfixed DNA, and the last wash solution was taken as a PCR negative control. In the reverse screening step (rounds 8, 9, 10, 11, 12, and 13), the reverse screening target salicylic acid and indoleacetic acid were first added to alternately reverse screen and incubated with the magnetic beads of the fixed library hybridization complex, the supernatant was removed by magnetic separation, and then the buffer solution was added for washing. The operation was repeated 3 times to completely remove the non-specifically bound single-stranded DNA. After the reverse screening, methyl jasmonate was added for incubation for positive screening. The screening incubation time is shown in Table 3. The supernatant was taken by magnetic separation as a PCR template for amplification. Subsequently, the negative PCR products and the target PCR products of the supernatant were imaged and analyzed by 10% PAGE gel electrophoresis to monitor the screening process. The 1×SELEXBuffer buffer used: 500mM NaCl, 10mM MgCl2, 50mM HEPES, pH 7.5. The initial ssDNA library contained 72nt single-stranded oligonucleotides, including upstream and downstream primers and 30 random nucleotide sequences in the middle.

[0056] Library fixation, target incubation, PCR amplification, single-stranded secondary library preparation, repeat the above steps, as the screening progresses, ssDNA with high affinity to methyl jasmonate is continuously enriched. The counter-screening of the screening uses salicylic acid and indoleacetic acid as counter-screening targets, and incubates them with the library first to remove non-specific binding and improve the specificity of the aptamer

[0057] The sequences involved in the screening of aptamers are shown in Table 1.

[0058] Table 1 Sequences used in aptamer screening

[0059]

[0060] 2) PCR amplification: forward primer: 2.5μL (10μM), biotinylated reverse primer: 2.5μL (10μM), 5μL 10×PCR Buffer, 4μL dNTP (each 2.5mM), 0.25μL TaKaRa Taq HS (5U / μl), 30.75μL sterile water, 5μL ssDNA (10-100ng). Under the optimal cycle conditions, the following PCR program was performed: 98℃, 30s, N cycles [98℃, 10s; 59℃, 15s; 72℃, 20s], 72℃, 2min. The cycle number was verified by 10% PAGE gel electrophoresis.

[0061] 3) Electrophoresis analysis: Mix the PCR product with the Loading Buffer, run electrophoresis in a 10% PAEG gel at 110V for 70 minutes, and then stain with EB dye for 10 minutes for imaging analysis.

[0062] Figure 2 It can be seen that the optimal PCR cycle number is 15, the band is at 72bp, the band is the brightest, and the miscellaneous bands are the least. Figure 3 It is a gel image of PCR products and negative products. By quantifying the gray value of the gel image, it can be determined whether the DNA in the screening process is enriched. The specific results of the numerical value correspond to Figure 4 .

[0063] 4) Preparation of single-stranded secondary library: Incubate the PCR amplification product with streptavidin magnetic beads for 45 minutes, wash 5 times with chain separation buffer solution, and magnetically separate to remove nonspecific dissociation and unfixed DNA. Add 100 μL, 0.2M NaOH for 5 minutes to release single-stranded DNA, collect the supernatant by magnetic separation, add 1M HCL to adjust the pH of the supernatant to 7.5 as the initial library for the next round. The chain separation buffer solution used: 250mM NaCl, 50mM HEPES (4-hydroxyethylpiperazineethanesulfonic acid), pH = 7.5.

[0064] Table 3 shows the aptamer screening conditions.

[0065]

[0066]

[0067] 5) Screening process monitoring diagram Figure 4As shown in the figure, due to the high content of the random library, there were few DNAs with affinity that were bound to the target and dissociated in the first three rounds, so they were not monitored. As the screening progressed, the concentration ratio of PCR products to negative PCR products gradually increased from the 4th to the 7th rounds, indicating that DNA with affinity to methyl jasmonate could be enriched. When indoleacetic acid was added to the 8th to the 10th rounds and salicylic acid was added to the counter-screening target from the 11th to the 13th rounds, the concentration ratio decreased because the DNA bound to the counter-screening target was removed to improve the specificity of the aptamer. From the 14th to the 15th rounds, the recovery rate tended to be stable, indicating that the screening was enriched, the DNA that could bind to methyl jasmonate tended to be saturated, and the screening stopped.

[0068] 6) Sequencing: The 15th round of PCR products were sent to Bioengineering for high-throughput sequencing;

[0069] The MeJA-52 sequence is: GGACGACGGCAGTTTGCGACTAGCGTATGACTGACGCTGTCGTCC, as shown in SEQ ID NO:1.

[0070] 7) Sequence analysis: DNAMAN software was used to predict the secondary structure and free energy of the obtained sequence.

[0071] The specific steps of the SGI fluorescent dye method are as follows: the candidate aptamer is heated and annealed in 1×SELEX Buffer, a series of aptamer solutions of the same volume are mixed with SGI dye and incubated for 5 minutes, and then incubated with different concentrations of methyl jasmonate solution for 20 minutes. The control group is incubated for 20 minutes with the same volume of 1×SELEX Buffer. The final concentration of methyl jasmonate is 0, 0.5, 1, 2, 3, 4, 5, 10, 15 μM, SGI is 1×, and the aptamer is 500nM. All experiments are done three times in parallel. The relative fluorescence intensity of the sample characterizes the size of the affinity, and the dissociation constant of the aptamer is calculated by fitting using SigmaPlot14.0 software.

[0072] Affinity analysis Figure 6 As shown, the affinity of the aptamer to methyl jasmonate was determined using the SGI fluorescent dye method, and the methyl jasmonate aptamer MeJA-52 was successfully obtained with a dissociation constant of 2.13±0.34μM.

[0073] Analysis of conserved sequences of methyl jasmonate aptamers and circular dichroism spectrometry Figure 7As shown in the figure, the conformational changes of methyl jasmonate binding to aptamers were studied by circular dichroism. The experimental steps are as follows: First, a 2μM aptamer solution was heated at 95°C for 10min, cooled to room temperature for at least 20min, and stored at 4°C. Then, 200μL of the aptamer solution was mixed with a 200μM methyl jasmonate solution (solvent was 1×SELEX Buffer) in equal volumes to make the final concentrations of 1μM and 20μM, respectively, and incubated at room temperature for 2h so that methyl jasmonate could be fully mixed with the aptamer. The control group used a buffer solution as a blank control, and then the circular dichroism spectrometer was used to measure each group of solutions. The instrument background and buffer solution background data were collected separately, and then the data of the target, aptamer, and aptamer-target complex were measured. The measurement range of the spectrum was 230nm-320nm, the step was 1nm, and the sample data was collected three times and the average value was taken for processing. The single MeJA-52 sequence showed the largest negative and positive peaks near 250nm and 280nm, respectively, indicating that the sequence was in a right-handed B-type double-stranded structure. After the addition of methyl jasmonate, the characteristic negative peak was enhanced and the characteristic positive peak was weakened, indicating that the interaction between methyl jasmonate and MeJA-52 led to the weakening of base stacking, the enhancement of the helical shape of DNA, and the change of the original conformation of DNA.

[0074] Molecular docking simulation Figure 8 As shown, the operation steps are as follows: the secondary structure of MeJA-52 can be obtained through the Mfold online server, and then it is converted into a pdb grid file through the 3dRNA website. The Zinc website provides the mol2 file of methyl jasmonate. Subsequently, OPenBabel-2.4.1 is used to continue processing and transfer it to a pdbqt file. Then it is imported into AutodockTools 1.5.6 respectively. Next, it is pre-treated by dehydration, hydrogenation, etc., and then the grid energy calculation file is constructed and run using AutoGrid software. Next, the specific operating parameters of molecular docking are set, in which the number of GA docking runs is set to 100, and the others are set to the default values. A dpf format file is created based on the Lamarck genetic algorithm. Then, the molecular docking is performed using the AutoDock software to obtain a pdbqt format file containing the molecular docking results. And it is converted into a pdb format file through OPenBabel-2.4.1. The docking results are processed using Pymol, revealing the tertiary structure, potential binding sites and potential key bases of the aptamer and candidate.

[0075] Circular dichroism and molecular docking techniques were used to study the conformational changes and binding sites of MeJA-52 and analyze the recognition mechanism of the aptamer and methyl jasmonate. The key region recognized by MeJA-52 is GAC; it can stably bind to methyl jasmonate through hydrogen bonds, electrostatic salt bridges, van der Waals forces, etc., and can achieve the detection of methyl jasmonate.

[0076] Example 2

[0077] An application of an aptamer that specifically recognizes methyl jasmonate is used for rapid detection of methyl jasmonate. The specific method is:

[0078] The specific steps for the synthesis of Fe-MOF are as follows: First, 0.115g of terephthalic acid (H2BDC) and 0.187g of FeCl3·6H2O were dissolved in 15mL of DMF, the two were quickly mixed, and 197μL of pure acetic acid was added under ultrasound. After thorough mixing, they were transferred to a 100mL Teflon-lined stainless steel autoclave, placed in an oven and reacted at 120°C for 4h. After the mixture in the reactor was cooled to room temperature, it was washed with DMF and ethanol. The washed material was dried in an oven at 60°C, and the solid product was stored in a refrigerator at 4°C until use.

[0079] Characterization of Fe-MOF:

[0080] Different methods were used to characterize and confirm the successful synthesis of Fe-MOF. First, it was characterized by scanning electron microscopy (SEM) and transmission electron microscopy (TEM), such as Fig.13 and 14 As shown in Figure 2, Fe-MOF has a uniform regular octahedral morphology with an average diameter of about 500 nm, indicating that it has a large particle size and specific surface area and has a large potential adsorption capacity. Fig.15 As shown, powder X-ray diffraction (XRD) found six diffraction peaks at 8.98, 10.50, 13.16, 16.70, 19.02, and 21.20 of the (002), (101), (102), (103), (200), and (201) planes, respectively, to verify the crystal structure of the synthesized Fe-MOF. Fourier transform infrared spectroscopy (FT-IR) was used to characterize the groups and valence bonds, as shown in Figure 2 . Fig.16 As shown, it is shown at 3415cm -1 The broadband of OH bond at 1593 and 1391 cm -1 The significant peak at 749 cm-1 is attributed to the carboxyl group in the terephthalic acid ligand. -1 The strong peak at is the CH vibration of the benzene ring. The optical properties of Fe-MOF were investigated by UV-visible absorption spectroscopy, such as Fig.17 As shown, a broadband was observed in the UV-visible absorption spectrum, indicating that Fe-MOF is a potential broad-spectrum fluorescence quencher, which is consistent with previous reports. The above characterization results show that Fe-MOF with an octahedral crystal structure containing Fe, N, O and C was successfully prepared.

[0081] The experiment explored the effects of Fe-MOF concentration, incubation time of aptamer and Fe-MOF, and incubation time of aptamer and MeJA on fluorescence intensity. The specific process is as follows: the aptamer was annealed at 95℃ for 10min before use to form a certain secondary structure. First, 20μL 1μM MeJA-52 solution (solvent is 1×SELEX Buffer) was mixed with 20μL MeJA solution of different concentrations (solvent is 1×SELEX Buffer) to obtain the final concentration of MeJA of 0, 80, 160, 320, 480, 720, 880, 960, 1140, 1460, 1780, 2180ng / mL, respectively. The mixture was incubated at 37℃ in the dark for a period of time, and then 20μL Fe-MOF was added to each reaction solution and incubated for a period of time. Finally, the fluorescence intensity was measured using a fluorescence spectrophotometer. Each group of experiments was measured in parallel three times.

[0082] The results are as follows Fig.10 , 11 As shown in Figures 1 and 12, the concentrations of Fe-MOF were 0, 5, 10, 15, 20, 22, 40, and 60 μg / mL, the incubation time of the aptamer with Fe-MOF was 0, 5, 10, 15, 20, and 25 min, and the incubation time of the aptamer with MeJA was 0, 20, 40, 60, 80, and 100 min. Each group was measured three times in parallel, and the fluorescence was measured and recorded.

[0083] Under the above optimal experimental conditions, different concentrations of MeJA were tested and a working curve was established. Fig. 9 As shown, the operation steps are as follows: the aptamer is annealed at 95°C for 10 min before use to form a certain secondary structure. First, 20 μL of 1 μM MeJA-52 solution (solvent is 1×SELEX Buffer) and 20 μL of MeJA solution of different concentrations (solvent is 1×SELEX Buffer) are mixed evenly, and the final concentrations of MeJA are 0, 80, 160, 320, 480, 720, 880, 960, 1140, 1460, 1780, 2180 ng / mL, respectively. Incubate at 37°C in the dark for 60 min, then add 20 μL of 220 μg / mL Fe-MOF to each reaction solution and incubate for 15 min. Finally, the fluorescence intensity is measured using a fluorescence spectrophotometer. Each group of experiments is measured in parallel three times, and the fluorescence intensity ratio F / F0 of the experimental group and the control group is calculated. A standard curve was drawn with the fluorescence intensity ratio as the ordinate and the MeJA concentration as the abscissa, wherein the control group refers to the target solution replaced with SELEXBuffer, while the others remain unchanged.

[0084] In the absence of MeJA, the FAM-labeled (DNA synthesized by Bio-Label at the 5' end) aptamer is adsorbed on Fe-MOF, resulting in quenched fluorescence and very low fluorescence intensity. Due to the recognition and binding of the aptamer with MeJA, the adsorption of the aptamer on Fe-MOF is reduced, resulting in a continuous increase in fluorescence intensity with the increase in the amount of MeJA. Fig.18 As shown in the figure, with the increase of MeJA amount, the fluorescence intensity gradually increased, and when the concentration was 2180 ng / mL, the fluorescence intensity tended to equilibrium. Fig.19 As shown in Figure 2, the fluorescence intensity ratio has a good linear relationship with the MeJA concentration in the range of 80-960 ng / mL, and its linear regression equation is y=7.45091×10 -4 x+1.12825(R 2 =0.997), y is the fluorescence intensity ratio F / F0, x is the MeJA concentration, the unit is ng / mL; the detection limit is 64.4 ng / mL (signal-to-noise ratio is 3).

[0085] Specificity experiments:

[0086] Add 20 μL 1 μM MeJA-52 and 20 μL MeJA, indoleacetic acid IAA, salicylic acid SA, trans-zeatin Trans-Zeatin, abscisic acid ABA, and gibberellin GA to the centrifuge tube, mix well, and incubate at 37 ° C in the dark for 60 minutes. Then add 20 μL 220 μg / mL Fe-MOF and 160 μL Tris buffer to each reaction solution and incubate for 15 minutes. Finally, the fluorescence intensity was measured using a fluorescence spectrophotometer. Each group of experiments was measured three times in parallel, and the fluorescence intensity ratio F / F0 of the experimental group and the control group was calculated. The results are shown in Fig. 20 As shown, it is illustrated that the present invention has strong specificity in detecting MeJA.

[0087] Testing of actual samples:

[0088] Grape samples were purchased from a local supermarket and processed before use. The samples were chopped, mixed and ground to obtain a homogeneous mixture. Then, 10 g of the homogeneous sample was transferred to a 50 mL centrifuge tube. After adding 25 mL of 80% ice methanol to the tube, the sample was sonicated in an ultrasonic bath for 10 minutes and extracted overnight at 4 ° C in a refrigerator. The next day, the upper extract was taken by centrifugation at 12000 rpm for 20 minutes. The mixture was then filtered through a Millipore membrane filter with an average pore size of 0.22 μm before analysis. For the recovery experiment, MeJA was added to the homogeneous mixture of the sample at three levels of 80, 160, and 480 ng / mL, followed by a post-extraction treatment and a fluorescence test using the above-mentioned analytical procedure, and the results are shown in Table 4. ELISA enzyme-linked immunosorbent assay was used as a comparison.

[0089] Table 4 Actual sample test results of the present invention

[0090]

[0091] The description of the above embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. An aptamer that specifically recognizes methyl jasmonate, characterized in that: The aptamer that specifically recognizes methyl jasmonate is MeJA-52, and the sequence of MeJA-52 is shown in SEQ ID NO:

1.

2. A method for screening an aptamer that specifically recognizes methyl jasmonate according to claim 1, characterized in that: The screening method comprises the following steps: 1) Screening of aptamers: The initial ssDNA library and the biotinylated capture probe were heated and annealed, cooled to room temperature, incubated with streptavidin magnetic beads, and the target methyl jasmonate was added for incubation. The supernatant was magnetically separated and used as a template for PCR amplification; 2) PCR amplification; 3) Prepare secondary ssDNA as the initial library for the next round; 4) Perform cyclic screening to obtain an aptamer that specifically recognizes methyl jasmonate.

3. The screening method according to claim 2, characterized in that In step 1), the initial library used is a 72 nt single-stranded oligonucleotide, including upstream and downstream primers and 30 random nucleotide sequences in the middle.

4. The screening method according to claim 2 or 3, characterized in that In step 1), methyl jasmonate is used as the positive screening target, and salicylic acid and indoleacetic acid are used as the reverse screening targets.

5. The screening method according to claim 2 or 3, characterized in that In step 2), the PCR amplification system is: forward primer: 2.5 μL (10 μM), biotinylated reverse primer: 2.5 μL (10 μM), 5 μL 10×PCR Buffer, 4 μL dNTP (each 2.5 mM), 0.25 μL TaKaRa Taq HS (5 U / μl), 30.75 μL sterile water, and 5 μL ssDNA.

6. The screening method according to claim 2 or 3, characterized in that The PCR program in step 2) was: 98°C, 30s, N cycles [98°C, 10s; 59°C, 15s; 72°C, 20s], 72°C, 2min; the cycle number N was verified by 10% PAGE gel electrophoresis.

7. The screening method according to claim 2 or 3, characterized in that In step 3), the secondary ssDNA was prepared by incubating the PCR product with streptavidin magnetic beads, dissociating the double-stranded DNA with NaOH solution, collecting the supernatant and neutralizing it with HCl as the initial library for the next round.

8. Use of the aptamer for specific recognition of methyl jasmonate according to claim 1, characterized in that: Used for the detection of methyl jasmonate.

9. The use according to claim 8, characterized in that: The detection method is as follows: the aptamer MeJA-52 labeled with FAM fluorescent dye is annealed at 95°C before use, and then the aptamer MeJA-52 is evenly mixed with MeJA solutions of different concentrations, incubated at 37°C in the dark for 60 minutes, and then Fe-MOF is added to the mixed solution and incubated in each reaction solution for 15 minutes; finally, the fluorescence intensity is measured using a fluorescence spectrophotometer, and each group of experiments is measured three times in parallel. The fluorescence intensity ratio F / F0 of the experimental group and the control group is calculated, and a standard curve is drawn with the fluorescence intensity ratio as the vertical axis and the MeJA concentration as the horizontal axis. The standard curve is used to detect methyl jasmonate.

Images