Gene for regulating and controlling oil content of peanuts and application thereof

Abstract

The invention relates to a gene for regulating and controlling the oil content of peanuts and application thereof, and belongs to the technical field of gene engineering. The nucleotide sequence of the peanut AhZF403 gene is shown as SEQ NO.1, and the gene can improve the oil content of peanuts. When the AhZF403 gene provided by the invention is used for constructing an expression vector and transforming a plant, the oil content of the plant can be increased.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to a gene for regulating the oil content of peanuts and application thereof. Background Art

[0002] Peanuts are important oil crops and cash crops that are widely planted and used throughout the world. They are an important source of vegetable oils for human consumption, and are also an important high-protein, high-fat crop that can be used as oil, food, and feed in my country. Among oil crops, the oil yield of peanuts is much higher than that of other oil crops, reaching 45%-50%, while that of soybeans is 14%-16%. Even for genetically modified soybeans, the oil yield is about 18%. my country is the world's largest producer and consumer of peanuts, with a large total output of peanuts, of which about 55% is used for oil extraction.

[0003] However, there is still a huge gap between the production and consumption of peanut oil in my country. In recent years, the export volume of peanuts and peanut oil has been declining year by year, while the import volume has been increasing year by year. Improving the oil content of peanut kernels is one of the important goals of peanut breeding, which is of great significance for ensuring the supply of domestic edible vegetable oil.

[0004] One of the important factors affecting the oil yield of peanuts is the peanut variety, and the oil yield of different peanut varieties varies. It is generally believed that the oil content of peanut kernels is a complex quantitative trait controlled by multiple genes, but genetic analysis and QTL positioning studies in recent years have shown that the effects of oil content genes are different, and some show characteristics of being controlled by major genes. Summary of the invention

[0005] The main purpose of the present invention is to provide a gene for regulating the oil content of peanuts and its application, locate and clone the gene for regulating the oil content of peanuts AhZF403 Gene, which can be used to carry out molecular genetic improvement of plants such as peanuts to obtain peanuts or plants with high oil content.

[0006] The present invention includes the following technical solutions: Step 1, Gene source Total RNA was extracted from peanut leaves, reverse transcribed into cDNA, and the cDNA sequence was compared with the soybean seed oil regulation GmZF351 The gene sequences were compared to determine their high homology, and the cDNA was named AhZF403 Gene.

[0007] Step 2, full-length cloning of the gene Design primers to AhZF403 The gene is used as a template for PCR amplification to obtain the PCR product of the gene.

[0008] The primers are: Primer F1 (AhZF403-Nde1): CAACATATGAGTATCTGTTCCGATCAGCAGC; Primer R1 (AhZF403-Sac1): CAAGAGCTCTACATCAGAAGATCATTCACCC.

[0009] Step 3, expression vector construction The gene PCR product obtained in step 2 was purified to obtain the gene PCR purified product; the pUC19 vector was digested with NdeⅠ endonuclease at 37℃, and the PCR purified product was digested with SacⅠ endonuclease at 37℃. The digested pUC19 vector and gene fragment were respectively detected by agarose gel electrophoresis to confirm the correct size of the digestion; gel recovery was performed according to the instructions of the cloning kit (EZNA Gel Extraction Kit); 6μL of the digested gene fragment and 2μL of the pUC19 vector were connected with T4 ligase at room temperature for 30min; the ligation product was transformed into DH5α Escherichia coli competent cells to obtain monoclonal positive colonies, and after shaking, the plasmid was extracted according to the instructions of the plasmid extraction kit (EZNA Plasmid DNA mini Kit I kit) instructions; PZP211 vector was digested with PstⅠ endonuclease at 37℃, and pUC19-AhZF403 was digested with SacⅠ endonuclease at 37℃. The size was detected by gel electrophoresis and recovered for ligation and transformation to obtain plasmid PZP-HA-AhZF403.

[0010] Step 4, genetic transformation and phenotypic analysis The plasmid PZP-HA-AhZF403 obtained in step 3 was transformed into GV3101 Agrobacterium competent cells, and Arabidopsis was infected by the floral dip method and pure transgenic Arabidopsis was screened; the oil content of transgenic Arabidopsis and Columbia type (Col) Arabidopsis seeds was detected by fat-acid hydrolysis method, and it was found that the oil content of transgenic Arabidopsis seeds was increased.

[0011] Based on the above technical solutions: The present invention provides a gene for regulating the oil content of peanuts, wherein the gene is AhZF403 , AhZF403 The gene is located on peanut chromosome A08, and the full-length genome sequence is 1212bp; AhZF403

[0012] The present invention provides a specific use of the gene, namely, the use of the gene in genetically improving the oil content trait of plants.

[0013] The present invention provides a primer for cloning the above gene, specifically, primer F1: AhZF403-Nde1, the nucleotide sequence of which is shown in SEQ NO.2; primer R1: AhZF403-Sac1, the nucleotide sequence of which is shown in SEQ NO.3.

[0014] The present invention provides a method for regulating the oil content of plants (such as peanuts). The method is to regulate the oil content of plants (such as peanuts) by promoting the expression of AhZF403 gene in the plants.

[0015] The present invention provides a method for regulating the oil content of plants (such as peanuts). The method comprises introducing the above-mentioned AhZF403 gene into the plants (such as peanuts), and regulating the oil content of the plants (such as peanuts) by expressing the AhZF403 gene in the plants.

[0016] Furthermore, the method comprises the following steps: using the peanut AhZF403 gene as a template, performing PCR amplification using the primers provided above, constructing the amplified product into an expression vector to form a recombinant expression vector, transforming the recombinant expression vector into a plant (such as peanut) so that the plant (such as peanut) carries the AhZF403 gene, and regulating the oil content of the plant (such as peanut) by expressing the AhZF403 gene in the plant (such as peanut).

[0017] Furthermore, in the method, the expression vector is Agrobacterium; specifically, GV3101 Agrobacterium.

[0018] Furthermore, in the method, the transformation method is to infect plants by floral dipping to introduce the recombinant expression vector into plant cells or tissues.

[0019] Furthermore, plants with high oil content (such as peanuts) can be obtained through the above method.

[0020] The present invention has the following beneficial effects: 1. The present invention discloses for the first time the role of AhZF403 gene in regulating the oil content of peanuts, and regulates the oil content of peanut seeds by changing the expression of this gene in peanuts.

[0021] 2. In the present invention, RNA is extracted from peanut leaves, and the AhZF403 gene that regulates the oil content of peanuts is obtained by transcription technology; the expression of the gene is verified by constructing an expression vector to transform Arabidopsis thaliana, and the results show that the oil content of transgenic Arabidopsis thaliana is significantly increased, and the expression of the AhZF403 gene in Arabidopsis thaliana can significantly increase its oil content. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Comparison of oil content between Columbia-type (Col) Arabidopsis seeds and transgenic Arabidopsis (OE#15, OE#17) in Example 2. DETAILED DESCRIPTION

[0023] The present invention is further explained below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent modifications to the present invention by those skilled in the art all fall within the scope of protection of the claims of this application.

[0024] Example 1 Peanut variety and source: Haihua No. 1 peanut seeds were provided by the Plant Molecular Genetics and Crop Gene Editing Laboratory of Linyi University.

[0025]

[0026] The gene regulating seed oil content in soybean GmZF351 The gene sequences were compared to determine their high homology, and the cDNA was named AhZF403 Gene; Example 2 Step 1, Gene source The above peanut leaves were selected, and total RNA from the peanut leaves was extracted according to the instructions of the SteadyPure Plant RNA Extraction Kit of Acry Biotech, and the concentration was measured and stored at -80°C for later use. The total RNA from the leaves was reverse transcribed into the first-strand cDNA according to the Evo M-MLV reverse transcription premixed kit of Acry Biotech, and stored for later use.

[0027] Step 2, full-length cloning of the gene Using the above cDNA as template, the primers in Table 1 were used AhZF403 Gene PCR amplification, the amplification procedure is shown in Table 2 below, and the PCR full-length product of the gene is obtained; the gel electrophoresis results show that the band size is correct, which is 1212 bp; Table 1 AhZF403 gene cloning primers

[0028] Table 2 PCR amplification program

[0029] Step 3, expression vector construction Purify the gene PCR product obtained in step 2 with reference to the BIOKIT PCR cleaning kit to obtain the gene PCR purified product; digest the pUC19 vector with NdeⅠ endonuclease at 37℃, and digest the PCR purified product with SacⅠ endonuclease at 37℃. Use agarose gel electrophoresis to check the digested pUC19 vector and gene fragment for correct digestion size; perform gel recovery according to the instructions of the cloning kit (EZNAGel Extraction Kit); take 6μL of the digested gene fragment and 2μL of the pUC19 vector and connect them with T4 ligase at room temperature for 30min; transform the ligation product into DH5α Escherichia coli competent cells to obtain monoclonal positive colonies, shake the bacteria, and extract the clones according to the plasmid extraction kit (EZNAPlasmid DNAmini Kit I kit) instructions to extract plasmid; PZP211 vector was digested with PstⅠ endonuclease at 37℃, and pUC19-AhZF403 was digested with SacⅠ endonuclease at 37℃. The size was detected by gel electrophoresis and recovered for ligation and transformation to obtain plasmid PZP-HA-AhZF403; Step 4, genetic transformation and phenotypic analysis The plasmid PZP-HA-AhZF403 obtained in step 3 was transformed into GV3101 Agrobacterium competent cells, and Arabidopsis was infected by the floral dip method and pure transgenic Arabidopsis was screened; the oil content of transgenic Arabidopsis and Columbia type (Col) Arabidopsis seeds was detected by fat-acid hydrolysis method, and it was found that the oil content of transgenic Arabidopsis seeds was increased.

[0030] Example 3 Using the method described in Example 2 above, AhZF403 The gene was transformed into peanuts to obtain a high-oil peanut variety.

Claims

1. A gene for regulating the oil content of peanuts, characterized in that: The gene is AhZF403 , AhZF403 The gene is located on peanut chromosome A08, and the full-length genome sequence is 1212bp; AhZF40 The nucleotide sequence of 3 genes is shown in SEQ NO.

1.

2. The gene according to claim 1, characterized in that Said AhZF403 The direct source of the gene is peanut.

3. Use of the gene as claimed in claim 1 or 2 in genetically improving the oil content trait of plants.

4. A primer for cloning the gene according to claim 1 or 2, characterized in that: The primers are F1: AhZF403-Nde1, the nucleotide sequence of which is shown in SEQ NO.2; and R1: AhZF403-Sac1, the nucleotide sequence of which is shown in SEQ NO.

3.

5. A method for regulating the oil content of peanuts, characterized in that: The method is to promote AhZF403 Gene expression regulates peanut oil content.

6. A method for regulating the oil content of peanuts, characterized in that: The method is to treat the AhZF403 Genes were introduced into peanuts through AhZF403 Gene expression in peanut regulates peanut oil content.

7. The method according to claim 6, characterized in that The method comprises the following steps: AhZF403 The gene is used as a template, and PCR amplification is performed using primers. The amplified product is constructed into an expression vector to form a recombinant expression vector, and the recombinant expression vector is transformed into peanuts, so that the peanuts carry AhZF403 Gene, through AhZF403 The gene is expressed in peanuts to regulate the oil content of peanuts; wherein the primer is F1: AhZF403-Nde1, the nucleotide sequence is shown in SEQ NO.2; R1: AhZF403-Sac1, the nucleotide sequence is shown in SEQ NO.

3.

8. The method according to claim 7, characterized in that In the method, the expression vector is Agrobacterium.

9. The method according to claim 8, characterized in that The Agrobacterium is GV3101 Agrobacterium.

10. The method according to claim 7, characterized in that In the method, the transformation method is to infect plants with the floral dip method to introduce the recombinant expression vector into peanut cells or tissues.

Images