A gene for regulating peanut oil content and its application
By cloning and using the AhZF403 gene for molecular genetic improvement, the problem of difficulty in regulating the oil content of peanuts in the prior art has been solved, and the effect of significantly improving the oil content of peanuts is achieved.
Patent Information
- Application Number
- CN202510185367.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-20
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2045-02-20
AI Technical Summary
The prior art is difficult to effectively regulate the oil content of peanuts, resulting in a huge gap between the production and consumption of peanut oil.
By localizing and cloning the AhZF403 gene that regulates the oil content of peanuts from peanuts, and using this gene to improve the expression of AhZF403 gene in plants, in order to regulate the oil content of plants.
It is achieved by changing the expression of AhZF403 gene in peanuts to regulate the oil content of peanut seeds, which significantly increases the oil content of plants.
Smart Images
Figure CN119639770B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and relates to a gene for regulating peanut oil content and its application. Background Art
[0002] Peanut is an important oil crop and cash crop widely planted and utilized all over the world. It is an important source of edible vegetable oil for humans, and is also an important high-protein and high-fat crop in China that can be used for oil, food and feed. Among oil crops, the oil yield of peanut is much higher than that of other oil crops, with an oil yield as high as 45%-50%, while that of soybean is 14%-16%, and even for genetically modified soybeans, the oil yield is about 18%. China is the largest peanut producer and consumer in the world, with a large total output of peanuts, and about 55% of which is used for oil extraction.
[0003] However, there is still a huge gap between the production and consumption of peanut oil in China. In recent years, the export volume of peanuts and peanut oil has been decreasing year by year, while the import volume has been increasing year by year. Improving the oil content of peanut kernels is one of the important goals of peanut breeding work, and is of great significance for ensuring the supply of domestic edible vegetable oil.
[0004] One of the important factors affecting the peanut oil yield is the peanut variety, and the oil yields of different peanut varieties vary. Generally, it is considered that the oil content of peanut kernels is a complex quantitative trait controlled by multiple genes. However, recent genetic analysis and QTL mapping studies have shown that the effects of oil content genes are different, and some show the characteristics of major gene control. Summary of the Invention
[0005] The main purpose of the present invention is to provide a gene for regulating peanut oil content and its application, to locate and clone a gene for regulating peanut oil content from peanuts, and the gene can be used to perform molecular genetic improvement on peanuts and other plants to obtain peanuts or plants with high oil content. AhZF403 The present invention includes the following technical solutions:
[0006] Step 1, gene source
[0007] Extract total RNA from peanut leaves, reverse transcribe the peanut total RNA into cDNA, compare the cDNA sequence with the gene sequence of soybean regulating seed oil content, determine that their homology is relatively high, and name the cDNA
[0008] gene. GmZF351 gene. AhZF403 gene.
[0009] Step 2, full-length cloning of the gene
[0010] Design primers, and use AhZF403 gene as a template for PCR amplification to obtain the PCR product of this gene.
[0011] The primers are as follows:
[0012] Primer F1 (AhZF403-Nde1): CAACATATGAGTATCTGTTCCGATCAGCAGC;
[0013] Primer R1 (AhZF403-Sac1): CAAGAGCTCTACATCAGAAGATCATTCACCC.
[0014] Step 3, construction of expression vector
[0015] Purify the gene PCR product obtained in step 2 to obtain a purified gene PCR product; Use NdeⅠ endonuclease to digest the pUC19 vector at 37°C, and SacⅠ endonuclease to digest the PCR purified product at 37°C. Detect the correct digestion size of the digested pUC19 vector and gene fragment by agarose gel electrophoresis respectively; Perform gel recovery according to the instructions of the cloning kit (E.Z.N.A. Gel Extraction Kit); Take 6 μL of the digested gene fragment and 2 μL of the pUC19 vector and connect them with T4 ligase at room temperature for 30 min; Transform the ligation product into DH5α Escherichia coli competent cells to obtain monoclonal positive colonies. After shaking the bacteria, extract the plasmid according to the instructions of the plasmid extraction kit (E.Z.N.A. Plasmid DNA mini Kit I); Use PstⅠ endonuclease to digest the PZP211 vector at 37°C, and SacⅠ endonuclease to digest pUC19-AhZF403. Detect the size by gel electrophoresis and recover, ligate and transform to obtain the plasmid PZP-HA-AhZF403.
[0016] Step 4, genetic transformation and phenotype analysis
[0017] Transform the plasmid PZP-HA-AhZF403 obtained in step 3 into GV3101 Agrobacterium competent cells, and infect Arabidopsis thaliana by the floral dip method and screen to obtain homozygous transgenic Arabidopsis thaliana; Use the fatty acid hydrolysis method to detect the oil content of transgenic Arabidopsis thaliana and Columbia type (Col) Arabidopsis thaliana seeds, and find that the seed oil content of transgenic Arabidopsis thaliana increases.
[0018] Based on the above technical solutions:
[0019] The present invention provides a gene for regulating the oil content of peanuts, and the gene is AhZF403 , the AhZF403 gene is located on chromosome A08 of peanut, and the full-length genomic sequence is 1212 bp; the AhZF403
[0020] The present invention provides a specific use of the above gene, that is, the application of the gene in improving the oil content trait of genetically modified plants.
[0021] The present invention provides a primer for cloning the above gene. Specifically, primer F1: AhZF403-Nde1, the nucleotide sequence of which is shown in SEQ NO.2; primer R1: AhZF403-Sac1, the nucleotide sequence of which is shown in SEQ NO.3.
[0022] The present invention provides a method for regulating the oil content of plants (such as peanuts). The method is to regulate the oil content of plants (such as peanuts) by promoting the expression of the AhZF403 gene in plants.
[0023] The present invention provides a method for regulating the oil content of plants (such as peanuts). The method is to introduce the above AhZF403 gene into plants (such as peanuts), and regulate the oil content of plants (such as peanuts) through the expression of the AhZF403 gene in plants.
[0024] Further, the method includes the following steps: using the peanut AhZF403 gene as a template, performing PCR amplification with the primers provided above, constructing the amplification product into an expression vector to form a recombinant expression vector, transforming the recombinant expression vector into plants (such as peanuts), so that the plants (such as peanuts) carry the AhZF403 gene, and regulating the oil content of plants (such as peanuts) through the expression of the AhZF403 gene in plants (such as peanuts).
[0025] Furthermore, the expression vector in the method is Agrobacterium; specifically, Agrobacterium tumefaciens GV3101.
[0026] Furthermore, the transformation method in the method is to infect plants by the floral dip method to introduce the recombinant expression vector into plant cells or tissues.
[0027] Further, through the above method, plants (such as peanuts) with high oil content can be obtained.
[0028] The present invention has the following beneficial effects:
[0029] 1. The present invention first discloses the role of the AhZF403 gene in regulating the oil content of peanuts, and regulates the oil content of peanut seeds by changing the expression of this gene in peanuts.
[0030] 2. In the present invention, RNA is extracted from peanut leaves, and the AhZF403 gene that regulates the oil content of peanuts is obtained through transcriptional technology; the expression of this gene is verified by constructing an expression vector and transforming Arabidopsis thaliana. The results show that the oil content of transgenic Arabidopsis thaliana increases significantly, and the expression of the AhZF403 gene in Arabidopsis thaliana can significantly increase its oil content. Brief Description of the Drawings
[0031] Figure 1 : Comparison of oil contents of Arabidopsis thaliana seeds of the Columbia type (Col) and transgenic Arabidopsis thaliana (OE#15, OE#17) in Example 2. Detailed Implementation Modes
[0032] The present invention will be further illustrated below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. After reading the present invention, various equivalent modifications made by those skilled in the art to the present invention fall within the scope protected by the claims of this application.
[0033] Example 1
[0034] Peanut variety and source: The peanut seeds of Haihua No. 1 were provided by the Laboratory of Plant Molecular Genetics and Crop Gene Editing, Linyi University.
[0035]
[0036] This gene was aligned with the gene sequence of soybean that regulates seed oil content GmZF351 to determine a relatively high homology, and the cDNA was named AhZF403 gene;
[0037] Example 2
[0038] Step 1, Gene source
[0039] Select the above peanut leaves, extract the total RNA of peanut leaves according to the instruction manual of the SteadyPure Plant RNA Extraction Kit of Aikery Biotech Co., Ltd., measure the concentration and store it at -80 °C for later use. Refer to the Evo M-MLV Reverse Transcription Premix Kit of Aikery Biotech Co., Ltd. to reverse transcribe the total RNA of the leaves to synthesize the first-strand cDNA and store it for later use.
[0040] Step 2, Full-length cloning of the gene
[0041] Using the above cDNA as a template, perform AhZF403 PCR amplification of the gene with the primers in Table 1 below. The amplification program is shown in Table 2 below to obtain the full-length PCR product of the gene; the gel electrophoresis result shows that the band size is correct, which is 1212 bp;
[0042] Table 1 Primers for cloning the AhZF403 gene
[0043]
[0044] Table 2 PCR amplification program
[0045]
[0046] Step 3, Construction of the expression vector
[0047] Purify the gene PCR product obtained in step 2 using the reference BIOKIT PCR purification kit to obtain the purified gene PCR product; use NdeⅠ endonuclease to digest the pUC19 vector at 37°C, and SacⅠ endonuclease to digest the PCR purified product at 37°C. Detect the correct digestion size of the digested pUC19 vector and gene fragment by agarose gel electrophoresis respectively; perform gel recovery according to the instructions of the cloning kit (E.Z.N.A. Gel Extraction Kit); take 6 μL of the digested gene fragment and 2 μL of the pUC19 vector and use T4 ligase to ligate at room temperature for 30 min; transform the ligation product into DH5α Escherichia coli competent cells to obtain monoclonal positive colonies. After shaking the bacteria, extract the plasmid according to the instructions of the plasmid extraction kit (E.Z.N.A. Plasmid DNA mini Kit I); use PstⅠ endonuclease to digest the PZP211 vector at 37°C, and SacⅠ endonuclease to digest pUC19-AhZF403 at 37°C. Detect the size by gel electrophoresis and recover, ligate and transform to obtain the plasmid PZP-HA-AhZF403;
[0048] Step 4, genetic transformation and phenotypic analysis
[0049] Transform the plasmid PZP-HA-AhZF403 obtained in step 3 into GV3101 Agrobacterium competent cells, and infect Arabidopsis thaliana by the floral dip method and screen to obtain homozygous transgenic Arabidopsis thaliana; use the fatty acid hydrolysis method to detect the oil content of transgenic Arabidopsis thaliana and Columbia type (Col) Arabidopsis thaliana seeds, and find that the seed oil content of transgenic Arabidopsis thaliana increases.
[0050] Example 3
[0051] Using the method described in Example 2 above, AhZF403 Transform the gene into peanuts to obtain a high-oil peanut variety.
Claims
1. A AhZF403 The application of the gene in genetically improving the oil content trait of plants is characterized by: Said AhZF403 The gene is located on peanut chromosome A08, and the full-length genome sequence is 1212bp; AhZF40 The nucleotide sequence of the gene 3 is shown in SEQ NO.1; the method of genetically improving the oil content trait of plants is to AhZF403 Genes are transformed into plants, making them carry AhZF403 Gene, through AhZF403 The gene is expressed in plants and regulates the oil content of the plants.
2. A method for regulating the oil content of peanuts, characterized in that: The method is to AhZF403 Genes were introduced into peanuts through AhZF403 Gene overexpression in peanuts regulates peanut oil content; AhZF403 The gene is located on peanut chromosome A08, and the full-length genome sequence is 1212bp; AhZF40 The nucleotide sequence of 3 genes is shown in SEQ NO.
1.
3. The method according to claim 2, characterized in that The method comprises the following steps: AhZF403 The gene is used as a template, and PCR amplification is performed using primers. The amplified product is constructed into an expression vector to form a recombinant expression vector, and the recombinant expression vector is transformed into peanuts, so that the peanuts carry AhZF403 Gene, through AhZF403 The gene is overexpressed in peanuts to regulate the oil content of peanuts; the primers are F1: AhZF403-Nde1, the nucleotide sequence is shown in SEQ NO.2; R1: AhZF403-Sac1, the nucleotide sequence is shown in SEQ NO.
3.
4. The method according to claim 3, characterized in that In the method, the expression vector is Agrobacterium.
5. The method according to claim 4, characterized in that The Agrobacterium is GV3101 Agrobacterium.
6. The method according to claim 3, characterized in that In the method, the transformation method is to infect plants with the floral dip method to introduce the recombinant expression vector into peanut cells or tissues.