Construction method and application of CircSamd4 gene knockout mouse model

Abstract

The invention discloses a construction method of a circSamd4 gene knockout mouse model and application of the circSamd4 gene knockout mouse model. The construction method of the circSamd4 gene knockout mouse animal model comprises the following steps: knocking out a circSamd4 gene of a mouse by utilizing sgRNA (small guide ribonucleic acid), so as to obtain a circSamd4 gene knockout mouse. According to the application disclosed by the invention, a mouse circRNA gene circSamd4 is knocked out by using a Crispr-cas9 gene knockout technology, and the obtained mouse shows obvious glaucoma phenotypes such as retinal thickness reduction, retinal ganglion cell (GCL) loss, visual function impairment and the like. A simple, reliable and economical animal model can be provided for research of glaucoma pathogenesis and screening of drugs and clinical treatment strategies.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease animal model construction methods, and specifically relates to a circSamd4 gene knockout mouse model construction method and application. Background Art

[0002] Glaucoma is the world's leading irreversible blinding eye disease. According to the latest statistics from the World Health Organization (WHO), there are currently about 80 million glaucoma patients worldwide, and it is estimated that by 2040, the number of glaucoma patients worldwide will exceed 111.8 million. Glaucoma not only brings great physical and mental pain to individuals, but has also become a major global public health issue. At present, the pathogenesis of glaucoma has not been fully elucidated, there is a lack of effective clinical treatment methods, and current research lacks a suitable animal model. Therefore, establishing an effective animal disease model is of great significance for the diagnosis and treatment of glaucoma.

[0003] Recent studies have also shown that glaucoma is a neurodegenerative disease regulated by multiple factors. With the increasing number of glaucoma patients, coupled with limited treatment options and poor prognosis for patients, glaucoma treatment has become a huge challenge for clinical ophthalmologists. Therefore, fully understanding the pathogenesis of glaucoma and seeking effective early diagnosis and treatment methods have always been hot topics and difficulties in the field of glaucoma research.

[0004] The gene knockout mice constructed in this patent all show obvious glaucoma phenotypes such as thinning of retinal thickness, loss of retinal ganglion cells (GCL), and visual function impairment. It can provide a simple, reliable and economical animal model for the study of the pathogenesis of glaucoma and the screening of drugs and clinical treatment strategies.

[0005] Currently, there are many open-angle glaucoma models, which are mainly divided into gene-induced and operational intervention models according to the construction method. The operational intervention model is usually induced by manipulation to induce high intraocular pressure. The success rate of modeling varies greatly, requires professional technical skills, and the consistency of the built models is not high. The various existing rodent glaucoma models have certain defects and cannot fully meet the current needs of glaucoma research. Therefore, it is very important to find a new modeling method. Summary of the invention

[0006] The present invention aims to overcome the deficiencies of the prior art and provides a circSamd4 gene knockout mouse animal model and a construction method and application thereof.

[0007] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0008] A method for constructing a circSamd4 gene knockout mouse animal model comprises the following steps: using sgRNA to knock out the circSamd4 gene of the mouse to obtain the circSamd4 gene knockout mouse.

[0009] In the present invention, sgRNA refers to a small guide RNA (single guide RNA, sgRNA), which is a single-stranded RNA molecule with a length of about 100-200 nucleotides. sgRNA is an important component of the CRISPR / Cas9 gene editing system, containing a target sequence (CrRNA) and a Cas9 nuclease recognition sequence (tracrRNA), which can guide the Cas9 protein to recognize and cut a specific DNA sequence, thereby achieving gene editing.

[0010] In some embodiments of the present invention, the sgRNA includes sgRNA1 and sgRNA2, the nucleotide sequence of the sgRNA1 is shown as SEQ ID No.1, and the nucleotide sequence of the sgRNA2 is shown as SEQ ID No.2.

[0011] In some embodiments of the present invention, the mass ratio of sgRNA1 to sgRNA2 is 1:1.

[0012] In some embodiments of the present invention, based on the circSamd4 gene sequence, partial intron 3 of chromosome 14 of the circSamd4 gene is knocked out, and the SINE element downstream of the circular RNA is knocked out, which is predicted to affect the expression of circular RNA without affecting the expression of linear genes.

[0013] In some embodiments of the present invention, Cas9 mRNA and constructed sgRNA1 and sgRNA2 are co-injected into the nucleus of mouse fertilized eggs to produce targeted knockout mice, i.e., F0 generation mice.

[0014] In some embodiments of the present invention, the nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No.3.

[0015] In the present invention, the role of the Cas9 mRNA is to translate the Cas9 protein in the fertilized egg, and then the Cas9 protein shears the genomic DNA molecule under the guidance of the sgRNA.

[0016] In some embodiments of the present invention, the concentration of the sgRNA is 100 pmol / μL.

[0017] In some embodiments of the present invention, the concentration of Cas9 protein after translation of the Cas9 mRNA is 250 ng / μL.

[0018] In some embodiments of the present invention, the mass ratio of Cas9 mRNA to sgRNA1 is (1-2):1.

[0019] In some embodiments of the present invention, the mass ratio of Cas9 mRNA to sgRNA2 is (1-2):1.

[0020] The present invention has no particular limitation on the source of mice, and for example, C57BL / 6J mice used for conventional gene knockout may be used.

[0021] In a preferred embodiment of the present invention, the method for constructing the circSamd4 gene knockout mouse animal model comprises the following steps:

[0022] (1) constructing sgRNA targeting circSamd4 gene; the nucleotide sequence of sgRNA1 is shown in SEQ ID No.1, and the nucleotide sequence of sgRNA2 is shown in SEQ ID No.2;

[0023] (2) Introducing Cas9 mRNA and sgRNA1 and sgRNA2 into the nucleus of mouse fertilized eggs to obtain circSamd4 gene knockout mice, i.e., F0 generation mice. The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3. The present invention has no special limitation on the source of mice, and C57BL / 6J used for conventional gene knockout can be used;

[0024] (3) Extract tail DNA from F0 mice, and use PCR amplification and sequence analysis to identify whether it is a chimera;

[0025] (4) F0 mice were mated with WT mice to obtain F1 mice, and homozygous mice were identified by PCR as mouse animal models.

[0026] Among them, SEQ ID NO.1: CTTCCTTCAGTCTTCGTTCACGG

[0027] SEQ ID NO.2: TGTAGGACCTAGGTTGCTCCAGGSEQ ID NO.3:

[0028]

[0029]

[0030]

[0031] The present invention also provides an sgRNA for constructing a circSamd4 gene knockout mouse model based on CRISPR / Cas9 gene knockout technology, including sgRNA1 and sgRNA1, wherein the sgRNA1 is shown in SEQ ID NO:1, and the sgRNA2 is shown in SEQ ID NO:2.

[0032] The present invention also provides a circSamd4 gene targeting vector, which is a sgRNA expression vector based on the CRISPR / Cas9 system, and the sequence of the action site of the sgRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0033] The present invention also provides a use of the aforementioned sgRNA in constructing a glaucoma-related gene knockout mouse animal model.

[0034] The present invention also provides an application of a circSamd4 gene knockout mouse animal model constructed by the above construction method in studying the disease mechanism of glaucoma.

[0035] The present invention also proposes an application of a circSamd4 gene knockout mouse animal model constructed by the above construction method in screening drugs for targeted treatment of glaucoma.

[0036] The reagents and raw materials used in the present invention are commercially available.

[0037] The beneficial effects of the present invention are:

[0038] The present invention uses Crispr-cas9 gene knockout technology to knock out the mouse circRNA gene circSamd4. The obtained mice all showed obvious glaucoma phenotypes such as thinning of retinal thickness, loss of retinal ganglion cells (GCL), and visual function damage. It can provide a simple, reliable and economical animal model for the study of the pathogenesis of glaucoma and the screening of drugs and clinical treatment strategies.

[0039] The gene knockout mice obtained by the present invention naturally show glaucoma-related phenotypes soon after birth (within 6-8 weeks), the modeling time is short, no special reagents, surgery and physical methods are required, the method is simple and easy to implement. The mice can mate freely, produce viable homozygous offspring, and are inexpensive. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematic diagram of gene knockout of circSamd4 gene knockout mice;

[0041] Figure 2 This is the genotype identification result of F1 generation mice;

[0042] Figure 3 This is the sequencing result of PCR products of F1 generation mice;

[0043] Figure 4 HE staining showed that the retinal thickness of circSamd4 knockout mice was thinner;

[0044] Figure 5 Retinal flat mount RBPMS immunofluorescence showed that circSamd4 knockout mice had a reduction in retinal ganglion cells;

[0045] Figure 6 Immunofluorescence analysis of RBPMS in retinal cryosections showed that retinal ganglion cells were reduced in circSamd4 knockout mice;

[0046] Figure 7 The visual evoked potential (VEP) experiment showed that the amplitude of visual evoked potential was reduced in circSamd4 gene knockout mice. DETAILED DESCRIPTION

[0047] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0048] The present invention provides a method for constructing a circSamd4 gene knockout mouse, wherein the circSamd4 gene of the mouse is knocked out using sgRNA1 and sgRNA9 to obtain the circSamd4 gene knockout mouse; the nucleotide sequence of the sgRNA1 is shown as SEQ ID No.1, and the nucleotide sequence of the sgRNA2 is shown as SEQ ID No.2; in the present invention, the mass ratio of the sgRNA1 to the sgRNA is preferably 1:1.

[0049] According to the circSamd4 gene sequence, the present invention knocks out Partialintron3 on chromosome 14 of the circSamd4 gene and knocks out the SINE element downstream of the circular RNA, and predicts that the circular RNA expression can be affected without affecting the linear gene expression.

[0050] In the present invention, the role of the Cas9 mRNA is to translate the Cas9 protein in the fertilized egg, and then the Cas9 protein shears the genomic DNA molecule under the guidance of the sgRNA. The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3. The preferred mass ratio of the Cas9 mRNA to each sgRNA is (1-2): 1, preferably, the mass ratio of Cas9 mRNA to sgRNA1 is 2: 1, and the mass ratio of Cas9 mRNA to sgRNA2 is 2: 1.

[0051] Example 1: Mouse genotype identification

[0052] 1. Construction scheme of circSamd4 gene knockout mice, as shown in the schematic diagram Figure 1 As shown;

[0053] (1) Construction of specific target sgRNA1 and sgRNA2 for the circSamd4 gene

[0054] sgRNA targeting the circSamd4 gene was constructed, and the circSamd4 gene of the mouse was knocked out using sgRNA1 and sgRNA2 to obtain circSamd4 gene knockout mice; the nucleotide sequence of sgRNA1 is shown in SEQ ID No.1, and the nucleotide sequence of sgRNA2 is shown in SEQ ID No.2; the mass ratio of sgRNA1 and sgRNA is 1:1.

[0055] (2) The purified sgRNA1 and sgRNA2 described in step (1) are transcribed in vitro with Cas9 nuclease mRNA, and microinjected into fertilized eggs. The fertilized eggs that survive the injection are transplanted into the uterus of surrogate mother mice, and the mice born are F0 generation mice. The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No. 3. The present invention has no special limitation on the source of mice, and C57BL / 6J used for conventional gene knockout can be used.

[0056] (3) The tails of F0 mice were cut and DNA was extracted for PCR amplification and Sanger sequencing was used to identify the positive F0 mice. The circSamd4 gene of the obtained F0 positive mice had 963 bp deleted. Figure 2 As shown, the deletion sequence is as SEQ ID NO.7;

[0057] SEQ ID NO.7:

[0058]

[0059]

[0060] (4) The F0 positive mice obtained in step (3) above are mated with C57BL / 6j wild-type mice to obtain F1 heterozygous mice with positive genotypes.

[0061] (5) F2 hybrid mice were mated with each other to breed pure circSamd4 knockout mice, and then the next functional study was carried out. All mice were raised under specific pathogen-free (SPF) conditions and were raised in strict accordance with the standards of the Animal Welfare Ethics Committee.

[0062] 2. PCR identification method and results of positive F1 generation mice:

[0063] (1) The genotype of the extracted mouse DNA was identified by PCR amplification. The F1R1 primer and the F1R2 primer were used to amplify the genotype of the mouse. The 417 bp single band was amplified by the homozygote, the 417 bp, 464 bp and 1380 bp three bands were amplified by the heterozygote, and the 464 bp and 1380 bp double bands were amplified by the wild type.

[0064] Note: Two pairs of primers need to be used for PCR separately.

[0065] The specific primer sequences for PCR amplification and identification are as follows:

[0066] Forwardprimer(F1):5'-CGGGTTATGAATGTTTGGAATGGA-3'(SEQ ID No.4)

[0067] Reverse primer(R1):5'-CAAAATCTCAATGAGGCCTGCTC-3'(SEQ ID No.5)

[0068] Forwardprimer(F1):5'-CGGGTTATGAATGTTTGGAATGGA-3'(SEQ ID No.4)

[0069] Reverse primer(R2):5'-GGCTGTGTCAGGTTACTTTGTTATC-3'(SEQ ID No.6)

[0070] (2) Genotype identification The PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0071] Table 1 PCR reaction system

[0072] Element Dosage <![CDATA[ddH2O]]> 9.0μL Forward primer 1.0μL Reverse primer 1.0μL Premix Taq 12.5μL DNA 1.5μL Total 25μL

[0073] Table 2 PCR reaction procedure

[0074]

[0075] (3) Electrophoresis test of amplified products: Take 5 μL of amplified products and run them on 2% agarose gel electrophoresis at 120V for 40 minutes. Take a photo of the gel. The results are as follows: Figure 2

[0076] (4) Identification report of F0 generation mice: PCR detection was performed on the F0 generation using primers F1+R1 and F1+R3. The results are shown in the electrophoresis diagram: Figure 2 ,Depend on Figure 2 It can be seen that heterozygous mice will have bands at 417bp, 464bp and 1380bp, wild-type mice will have bands at 464bp and 1380bp, and homozygous mice will only have a band at 417bp. Therefore, mice No. 1, No. 2, No. 5, No. 6, No. 8, No. 11, and No. 12 are homozygous.

[0077] To determine the specific knockout fragment, the mice identified as positive in the F0 generation were sequenced, and the results showed that a 963 bp deletion was formed ( Figure 3 ).

[0078] The sequencing primer sequences of the PCR products are as follows:

[0079] Sequence primer(R1):5'-CAAAATCTCAATGAGGCCTGCTC-3'(SEQ ID No.5)

[0080] Example 2

[0081] In order to explore whether circSamd4 knockout mice would have glaucoma-related phenotypes, under normal feeding conditions, HE staining of paraffin sections of eyeballs, immunofluorescence staining of frozen sections of eyeballs, immunofluorescence staining of retinal flat mounts, and flash visual evoked potential examinations were performed on WT mice and circSamd4 knockout mice.

[0082] like Figure 4 As shown, the thickness of the whole retina and the retinal ganglion cell complex (GCC) were measured by retinal histology HE centered on the optic nerve head in WT mice and circSamd4 knockout mice. The results showed that the thickness of the whole retina and the thickness of the GCC were reduced in circSamd4 knockout mice compared with WT mice.

[0083] like Figure 5As shown in the figure, the relative number of retinal ganglion cells (GCL) in the peripheral retina was calculated by retinal flat mount and immunofluorescence staining in WT mice and circSamd4 knockout mice. The results showed that circSamd4 mice showed obvious GCL cell loss in the peripheral retina compared with WT mice.

[0084] like Figure 6 As shown in the figure, the relative number of retinal ganglion cells (GCL) in the peripheral retina was calculated by immunofluorescence staining of frozen sections of retinal tissue centered on the optic nerve head in WT mice and circSamd4 knockout mice. The results showed that circSamd4 mice showed obvious GCL cell loss in the peripheral retina compared with WT mice.

[0085] like Figure 7 As shown, the optic nerve function of mice was evaluated by performing flash visual evoked potential (fVEP) examination on WT mice and circSamd4 gene knockout mice. The results showed that the N1-P1 wave amplitude of circSamd4 gene knockout mice was significantly reduced compared with WT mice, indicating a decrease in optic nerve function.

[0086] The above description is only a preferred embodiment of the present invention and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention are included in the protection scope of the present invention.

Claims

1. A method for constructing a circSamd4 gene knockout mouse animal model, characterized in that: It includes the following steps: The circSamd4 gene of mice was knocked out using sgRNA to obtain circSamd4 gene knockout mice.

2. The construction method according to claim 1, characterized in that: The sgRNA includes sgRNA1 and sgRNA2, the nucleotide sequence of the sgRNA1 is shown as SEQ ID No.1, and the nucleotide sequence of the sgRNA2 is shown as SEQ ID No.

2.

3. The construction method according to claim 2, characterized in that: The mass ratio of sgRNA1 and sgRNA2 is 1:

1.

4. The construction method according to claim 1, characterized in that: Partial intron 3 of the circSamd4 gene on chromosome 14 was knocked out, knocking out the SINE element downstream of the circular RNA.

5. The construction method according to claim 2, characterized in that: The Cas9 mRNA and the constructed sgRNA1 and sgRNA2 were co-injected into the nucleus of mouse fertilized eggs to produce targeted knockout mice, i.e., F0 generation mice; The nucleotide sequence of the Cas9 mRNA is shown in SEQ ID No.

3.

6. The construction method according to claim 5, characterized in that: The sgRNA concentration is 100 pmol / μL; And / or, the concentration of Cas9 protein after translation of the Cas9 mRNA is 250 ng / μL.

7. The construction method according to claim 5, characterized in that: The mass ratio of the Cas9 mRNA to sgRNA1 is (1-2):1; and / or the mass ratio of the Cas9 mRNA to sgRNA2 is (1-2):

1.

8. Application of a circSamd4 gene knockout mouse animal model constructed by the construction method described in any one of claims 1 to 7 in studying the disease mechanism of glaucoma.

9. Use of a circSamd4 gene knockout mouse animal model constructed by the construction method described in any one of claims 1 to 7 in screening drugs for targeted treatment of glaucoma.

Images