E7 cell model construction method for expressing human papilloma viruses 16 and 18

Abstract

The invention relates to the technical field of biology. The invention provides a construction method of an E7 cell model for expressing human papilloma viruses 16 and 18, which comprises the following steps: transfecting exogenous plasmids into TC-1 cells in a culture medium inoculated with the TC-1 cells; the culture medium contains G418 genetics mycin; the exogenous plasmid can be used for stably transforming the HPV18E7. The TC-1-HPV18E7 cell model and the mouse model are successfully constructed, and it is proved that the recombinant strain vaccine LM-HPV18E7 shows a good treatment effect in a mouse model application test. According to the TC-1-HPV18E7 cell model, the application of the cell model based on TC-1 can be expanded, and a foundation is laid for subsequent research and development of bivalent and even multivalent therapeutic vaccines.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for constructing an E7 cell model expressing human papillomavirus types 16 and 18. Background Art

[0002] Cancer is the second leading cause of death in humans, and approximately 20% of cancers are caused by chronic infection, including breast cancer and cervical cancer caused by human papillomavirus (HPV). HPV is a common small double-stranded DNA virus that infects epithelial mucosal cells. Its survival in the human body depends on the host cell's mechanisms and environmental conditions, including host cell differentiation status, cytokine regulation, cell adhesion and other factors. Since it cannot be cultured in vitro, researchers usually use animal models, tissue models or molecular biology methods of virus samples to study HPV.

[0003] TC-1 cells are a model cell line for HPV16 tumor vaccine research constructed by a research team at Johns Hopkins University in 1996. They transfected plasmids carrying the E6 and E7 genes of the HPV16 virus into the lung epithelial cells of C57BL / 6 mice. After the E6 and E7 genes were integrated into the mouse lung epithelial cells to immortalize the cells, the cells were transplanted subcutaneously into the mice to successfully construct a tumor-bearing model. Since then, TC-1 has become a commonly used cell model for anti-HPV tumor research targeting HPV16 E6 and E7. Li Lili et al. constructed a TC-1 cell model carrying the HPV16 L1 gene by stable plasmid transfer, which was used to verify the anti-HPV tumor vaccine targeting HPV16 L1. However, there is currently no research based on the HPV18 E7 tumor cell model. Summary of the invention

[0004] In view of the defects of the prior art, the object of the present invention is to provide a method for constructing a tumor cell model that can stably express HPV16 and 18 subtype antigen protein E7.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] A method for constructing an E7 cell model expressing human papillomavirus types 16 and 18, the method comprising the following steps:

[0007] In a culture medium inoculated with TC-1 cells, an exogenous plasmid is transfected into TC-1 cells;

[0008] The culture medium contains G418 geneticin; the construction method of the exogenous plasmid is as follows:

[0009] Primers pSL372-upstream-Kpn I-fwd and pSL372-upstream-rev were designed on both sides of the EGFP gene to amplify the upstream homology arms; primers pSL372-downstream-fwd and pSL372-downstream-BamH I-rev were designed on both sides of the HPV18 E7 gene to amplify the downstream homology arms; then the upstream and downstream fragments were connected by Overlap PCR to obtain the target fragment, and the target fragment and the vector plasmid pCDNA3.1+FLAG were double-digested; then ligase was used for connection;

[0010] The sequence of pSL372-upstream-Kpn I-fwd is:

[0011] CGGGGTACCATGGTGAGCAAGGGCGAG;

[0012] The sequence of pSL372-upstream-rev is:

[0013] AGGTCCATGCATCTTGTACAGCTCGTCCATGCC;

[0014] The sequence of pSL372-downstream-fwd is:

[0015] GAGCTGTACAAGATGCATGGACCTAAGGCAACAT;

[0016] The sequence of pSL372-downstream-BamH I-rev is:

[0017] CGCGGATCCCTGCTGGGATGCACACCAC.

[0018] Furthermore, when inoculating TC-1 cells, the TC-1 cells were inoculated into a 6-well plate at a cell density of 70%-80%.

[0019] Furthermore, when performing the transfection, the exogenous plasmid is first added to the serum-free RPMI 1640 culture medium, and mixed by pipetting. Then, HighGene transfection reagent is added and mixed by pipetting. Then, the complex of the exogenous plasmid and HighGene transfection reagent is evenly added dropwise to the culture medium containing TC-1 cells.

[0020] Furthermore, when performing the transfection, first take 4 μg of exogenous plasmid and add it to a centrifuge tube containing 200 μL of serum-free RPMI 1640 culture medium, and mix it by pipetting; then add 8 μL of HighGene transfection reagent and mix it by pipetting; and then evenly add 200 μL of the exogenous plasmid and HighGene transfection reagent complex to the culture medium containing TC-1 cells.

[0021] Furthermore, 4-6 hours after transfection, half of the medium was replaced with fresh complete medium; 24 hours after transfection, the successfully transfected cells were selected for continuous expansion culture.

[0022] Furthermore, the concentration of the G418 geneticin is 1100-1500 μg / mL.

[0023] Preferably, the concentration of G418 Geneticin is 1200 μg / mL.

[0024] Furthermore, the ligase is Ligation high Ver.2.

[0025] Furthermore, the vector plasmid is pCDNA3.1+FLAG.

[0026] Another object of the present invention is to provide a strain of E7 cells expressing human papillomavirus types 16 and 18, characterized in that the cell is named mouse lung epithelial cell TC18, the preservation number is CCTCC NO: C20246, and it is deposited in the China Center for Type Culture Collection, and the preservation time is June 24, 2024.

[0027] Beneficial effects of the present invention:

[0028] The present invention successfully constructed the TC-1-HPV18 E7 cell model and mouse model, and confirmed that the recombinant strain vaccine LM-HPV18 E7 showed good therapeutic effects in the mouse model application test. The TC-1-HPV18 E7 cell model will expand the use of TC-1-based cell models and lay the foundation for the subsequent development of bivalent or even multivalent therapeutic vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The experimental diagram of the construction of HPV18 E7 transfection plasmid; (a) is the construction strategy of HPV18 E7 transfection plasmid; (b) is the PCR verification of the plasmid insert, M is DL2000 Plus DNA Marker; 1 is pCDNA3.1+FLAG-EGFP+HPV18 E7; 2 is the negative control; 3 is pCDNA3.1+FLAG;

[0030] Figure 2This is a graph showing the results of the optimal G418 concentration determination experiment;

[0031] Figure 3 The figure shows the validation experiment results of the TC-1-HPV18 E7 cell model; (a) shows the results of the transfection plasmid fluorescence validation experiment; (b) shows the results of the transfection plasmid RT-PCR validation experiment: the primers are HPV16 E7 internal primers and HPV18 E7 internal primers; 1 and 2 are transiently transfected pCDNA3.1+FLAG-EGFP+HPV18 E7; 3 and 4 are transiently transfected pCDNA3.1+FLAG; 5 and 6 are positive control groups: TC-1; 7 is a negative control; (c) is the result of the fusion protein expression validation experiment;

[0032] Figure 4 The figure shows the results of the validation experiment of the tumor-bearing mouse model; (a) shows the weight measurement result of the tumor-bearing mouse; (b) shows the tumor volume measurement result; (c) shows the tumor weight measurement result; (d) shows the immunohistochemistry experiment result of TC-1 and TC-1-HPV18 E7 tumor-bearing tissues;

[0033] Figure 5 The experimental results show that the killing effect of spleen lymphocytes on tumor cells in immunized mice is measured;

[0034] Figure 6 The figures are the results of the experimental evaluation of the treatment of tumor-bearing mice with the recombinant strain vaccine; (a) is the measurement result of the tumor size and tumor weight of tumor-bearing mice; (b) is the continuous monitoring result of the tumor volume. DETAILED DESCRIPTION

[0035] The present invention is described in detail below through examples. It is necessary to point out that the following examples are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by technical personnel in this field based on the above invention content still fall within the scope of protection of the present invention.

[0036] Example 1

[0037] 1 Materials and methods

[0038] 1.1 Materials

[0039] 1.1.1 Strains and plasmids

[0040] The attenuated Listeria monocytogenes recombinant strain vaccine LM-HPV18 E7, competent Escherichia coli BL21, and plasmid pCDNA3.1+FLAG used in the present invention are stored in this laboratory. Listeria monocytogenes is cultured in BHI (Brain Heart Infusion) medium, and Escherichia coli is cultured in LB (Luria-Bertani) medium.

[0041] 1.1.2 Reagents

[0042] Active Recombinant Mouse IL-2 protein, HighGene transfection reagent, antibody Mouse antiFLAG-Tag mAb, GAPDH Mouse mAb and HRP Goat Anti-Mouse IgG (H+L) were purchased from Wuhan ABclonal Biotechnology Co., Ltd.; polyclonal antibody Anti-HPV18 E7 was homemade by the laboratory; FastPure Cell / Tissue Total RNA Isolation Kit V2 and HiScript III All-in-one RT SuperMixPerfect for qPCR kit were purchased from Nanjing Novozymes Biotechnology Co., Ltd.; G418 geneticin, cell lysis buffer, protease inhibitors and red blood cell lysis buffer were purchased from Shanghai Bio-Tech Biotechnology Co., Ltd.; FBS (Fetal Bovine Serum) and RPMI 1640 culture medium were purchased from Thermo Fisher Scientific (USA).

[0043] 1.1.3 Mice and cell sources

[0044] The mouse cervical cancer cell line TC-1 (abbreviated as TC-1 or TC-1 cells) was purchased from the Tumor Cell Center of the Chinese Academy of Medical Sciences (Beijing), and TC-1 cells were cultured in a CO2 incubator at 37°C and 5%. TC-1 culture medium is 10% fetal bovine serum (FBS) and RPMI 1640 culture medium. 6-8 week old C57BL / 6 female mice were purchased from Zhejiang Academy of Medical Sciences and kept in the experimental animal room of Zhejiang Agricultural and Forestry University. The experiments were in compliance with the relevant requirements for experimental animal operations and animal welfare in the "Regulations on the Administration of Laboratory Animal Affairs" of the People's Republic of China, and were strictly carried out in accordance with the "Regulations on the Administration of Laboratory Animals" approved by the Laboratory Animal Management Office of the Zhejiang Provincial Department of Science and Technology (Animal Experiment Approval No. SYXK-2023-0015).

[0045] 1.2 Plasmid construction

[0046] Using EGFP gene and HPV18 E7 gene as templates, Snapgene software was used to design primers pSL372-upstream-Kpn I-fwd / pSL372-upstream-rev on both sides of the EGFP gene to amplify the upstream homology arm; primers pSL372-downstream-fwd / pSL372-downstream-BamH I-rev were designed on both sides of the HPV18 E7 gene to amplify the downstream homology arm. The upstream and downstream fragments were connected by Overlap PCR to obtain the target fragment, and the target fragment and the vector plasmid pCDNA3.1+FLAG were double-digested, and then the two parts were connected using ligase Ligation highVer.2 (TOYOBO). The ligation product was heat-transferred to Escherichia coli BL21 competent cells at 37℃ and PCR verification was performed. After successful verification, the plasmid was extracted using the plasmid kit of Huiling Biotechnology Co., Ltd. and stored at -20℃. The laboratory plasmid was named pSL372.

[0047] Table 1 Primers used in this example

[0048]

[0049] 1.3 Screening of optimal G418 concentration

[0050] Take 1g of G418 geneticin and dissolve it in 1mL of 1mol / L HEPES solution, add distilled water to 10mL, filter and sterilize, and store at 4℃. Take the cultured cells TC-1 to be tested, prepare a cell suspension, inoculate it into a 24-well culture plate in equal amounts, and start adding drugs after culturing for about 6 hours; determine several gradients within the range of 100-1500μg / mL, and dilute G418 with culture medium according to the gradient concentration to prepare a screening medium; according to the color of the culture medium and the growth of cells, replace the screening medium every 2-3 days; the minimum G418 concentration that can kill all cells within 15 days is the optimal screening concentration.

[0051] 1.4 Stable plasmid transfection

[0052] After determining the optimal screening concentration of G418, TC-1 cells were inoculated into a 6-well plate, and the cell density was controlled at 70%-80%; on the next day, 4 μg of plasmid was added to a centrifuge tube containing 200 μL of serum-free RPMI 1640 medium, pipetted to mix, and then 8 μL of HighGene transfection reagent was added and pipetted to mix; 200 μL of plasmid / HighGene transfection reagent complex was evenly added dropwise to the wells of the 6-well cell culture plate, and the cell culture plate was gently shaken to make it evenly distributed; 4-6 hours after cell transfection, half of the medium was replaced with fresh complete medium; 24 hours after cell transfection, the position of the successfully transfected cell line was observed and marked under a fluorescent inverted microscope, and multiple cell lines were selected to add the optimal screening concentration of the drug (G418) and continue to expand the culture to obtain a stable cell line TC-1-HPV18 E7.

[0053] 1.5 RNA extraction and reverse transcription

[0054] In this example, the FastPure Cell / Tissue Total RNA Isolation Kit V2 was used for RNA extraction. RNA-free pipette tips were used throughout the process and the operation was performed in a clean bench. RNA from the cell line was collected. The collected RNA was quantified, and lμg of RNA was reverse transcribed into cDNA using the HiScript III All-in-one RT SuperMix Perfect for qPCR reverse transcription kit. The cDNA product generated by reverse transcription was verified by RT-PCR gel running.

[0055] 1.6 Analysis of fusion protein expression

[0056] For the stable cell lines that are expanded and cultured, the culture medium is removed and the cell lysis solution is added at a ratio of 200 μL per well of a 6-well plate (at the same time, 2 μL of protease inhibitor is added to each well). Use a pipette to blow several times to make the lysis solution and cells fully contact to prepare a protein sample. The protein sample and 4× protein loading buffer are mixed at a ratio of 3:1, and after boiling in a water bath for 10 minutes, SDS-PAGE gel electrophoresis is performed, and the protein is transferred to the membrane after the electrophoresis. The PVDF membrane containing the protein band is blocked with 5% skim milk at room temperature for 1 hour, and the membrane is washed 3 times with TBST. Incubate the primary antibody: place the PVDF membrane in a mouse polyclonal antibody with a dilution ratio of 1:1000, incubate for 50 minutes, and wash the membrane 5 times. Incubate the secondary antibody: Add HRP-labeled goat anti-mouse secondary antibody with a dilution ratio of 1:10000, incubate for 50 minutes, and wash the membrane 5 times. Add the color developing solution and take pictures with a colorimeter.

[0057] 1.7 Construction of mouse tumor model

[0058] The mouse cervical cancer cell lines TC-1 and TC-1-HPV18 E7 were revived and cultured with RPMI 1640 medium containing 10% FBS. After culturing to a sufficient number, the cells with good growth status were collected, blown away and placed in a 15mL centrifuge tube, and mixed by continuous blowing and suction. 10μL was taken out and counted with a cell counting plate, and the cell density was adjusted to about 4×106CFU / mL with RPMI 1640 medium. The C57BL / 6 female mice were subcutaneously injected in the abdomen, and the injection dose for each mouse was 50μL. The weight of the mice and the state of tumor growth were measured and recorded every 3 days.

[0059] 1.8 Immunohistochemical analysis of tumor tissue

[0060] The tumor-bearing mice were killed by cervical dislocation, and the tumor tissues were dissected out and placed in tissue preservation solution, and polyclonal antibody Anti-HPV18 E7 was provided and handed over to Wuhan Sewell Biotechnology Co., Ltd. for tissue paraffin embedding, paraffin sectioning, immunohistochemistry, and photography (white light).

[0061] 1.9 In vitro killing of tumor cells by spleen lymphocytes of immune mice

[0062] Five days in advance, mice were injected intravenously with 1×10 8 The mice were killed by cervical dislocation. Splenic lymphocytes were collected and cell counts were completed; cells were diluted and IL-2 protein was added to ensure the activity of mouse splenic lymphocytes. Splenic lymphocytes and TC-1 / TC-1-HPV18 E7 cells were mixed in equal proportions and placed in a 96-well plate for co-culture overnight. CyQUANT TM LDH Cytotoxicity Assay Kit was used to measure cytotoxicity. After 12 hours of co-culture, 50 μL of cell supernatant was collected, and three parallels were added to each group. 50 μL of detection working solution was added, and the reaction was shaken at 300 rpm for 30 minutes. 50 μL of stop solution was added to terminate the reaction and the OD was measured. 490nm , cytotoxicity was calculated to detect the killing effect in vitro.

[0063] 1.10 Evaluation of therapeutic effects of recombinant strain vaccines

[0064] After the mouse cervical cancer model was successfully established, when the tumor diameter was about 2 mm, the LM-HPV18 E7 recombinant strain was taken out from the bacterial strain library, and a single colony was picked after streaking to prepare a diluted bacterial solution. The mixed bacterial solution was aspirated with a 1 mL syringe and immunized into mice. The immunization route was tail vein injection, and the immunization dose was 100 μL / mouse (i.e., the injection volume of bacteria was 10 8CFU / mouse); the mice were divided into two groups (8 mice in each group): TC-1 group and TC-1-HPV18E7 group; immunization was carried out in the following manner: LADS-HPV18 E7 bacterial solution was injected into the tail vein of mice on the 8th and 15th days after tumor cell inoculation. The tumor size was measured every 2-3 days, and the tumor was dissected on the 21st-23rd day (depending on the size of the tumor, the maximum tumor length and width should not exceed 2cm, and the mouse could be killed if the maximum tumor was close to 2cm), the tumor weight was measured and the tumor was photographed.

[0065] 1.11 Statistical analysis

[0066] Data were statistically analyzed using Prism GraphPad software using one-way ANOVA, in which P values ​​greater than 0.05 were considered not statistically significant, while P values ​​less than 0.001 were considered statistically significant.

[0067] 2 Results and analysis

[0068] 2.1 Stable HPV18 E7 plasmid was successfully constructed

[0069] According to the plasmid construction strategy, primers pCDNA3.1-fwd / pCDNA3.1-rev were used as flanking primers for PCR verification ( Figure 1 ), the band reached the expected size and was sequenced successfully, and the HPV18 E7 transfection plasmid was successfully constructed for subsequent experiments

[0070] 2.2 Determining the optimal antibiotic G418 concentration

[0071] Different concentrations (the concentration range was determined to be between 1100-1500 μg / mL after preliminary experiments) of G418 were added to TC-1. Figure 2 ), it was observed that when the concentration of G418 was 1200μg / mL, TC-1 cells died in a large area and fell off at the bottom of the 6-well plate. By the 15th day, all TC-1 cells at this concentration had died, while a small number of TC-1 cells at a concentration of 1100μg / mL survived, so the optimal antibiotic G418 concentration was determined to be 1200μg / mL.

[0072] 2.3TC-1-HPV18 E7 cell model was successfully constructed

[0073] The transfected plasmid was transiently transferred into TC-1 cells, fixed in a 6-well cell plate, and observed under a fluorescent inverted microscope. Figure 3(a), compared with the control group, TC-1 / pCDNA3.1+FLAG-EGFP+HPV18 E7 cells can clearly find luminescent cells. RNA was extracted from transiently transfected cells and reversely transcribed into cDNA. HPV16E7 and HPV18 E7 internal primers were used for verification ( Figure 3 The band size was consistent with the prediction, and the PCR product sequencing results were consistent with the gene sequence. The luminescent cells were marked, and after trypsin digestion, they were stably cultured in a 96-well plate under the optimal G418 screening concentration pressure. Two cell lines with better expansion and culture conditions (named D2 and G9) were selected, and the cells were lysed for Western Blot test ( Figure 3 Part c), demonstrating that the fusion protein in the cell model was successfully expressed.

[0074] 2.4 Successful construction of tumor-bearing mouse model

[0075] The mouse tumor-bearing test was carried out using D2 and G9 as TC-1-HPV18 E7 cell models. The results showed that ( Figure 4 There was no difference in the weight of the three groups of mice. When the tumor size reached the level where the bulge could be felt (the tumor diameter reached 2-3mm) and gradually increased over time, there was no difference in the size and weight of the generated tumor, indicating that the stably transferred TC-1-HPV18 E7 cells had no effect on the tumor-bearing mice and could be used for subsequent experiments. After the mice were tumor-bearing, the tumor tissue was dissected and sent to Wuhan Sewell Biotechnology Co., Ltd. for immunohistochemical verification. The results of immunohistochemical tissue paraffin sections showed ( Figure 4 (Part d), compared with the control group, multiple yellowish antibody markers appeared in the TC-1-HPV18 E7 tumor-bearing tissue, proving that the mouse tumor-bearing model was successfully established.

[0076] 2.5 Spleen lymphocytes from immunized mice have good in vitro tumor cell killing effect

[0077] The present invention uses mouse spleen lymphocytes immunized with the recombinant strain vaccine LM-HPV18 E7 to conduct an in vitro killing test on TC-1 cells and TC-1-HPV18 E7 cells (select D2 cells). The results show that ( Figure 5 ), although mouse spleen lymphocytes also had a high killing effect on TC-1, compared with TC-1 cells, mouse spleen lymphocytes had a more significant killing effect on TC-1-HPV18 E7 cells, indicating that the TC-1-HPV18 E7 cell model was more sensitive to the LM-HPV18 E7 vaccine targeting HPV18 type E7 in the in vitro killing test.

[0078] 2.6 Therapeutic vaccines have a significant inhibitory effect on tumor growth in mouse models

[0079] According to the mouse immunization strategy, the therapeutic effect of the recombinant strain vaccine LM-HPV18 E7 was evaluated in TC-1 and TC-1-HPV18 E7 tumor-bearing mouse models (D2 cells were selected for tumor bearing). The results of tumor size and tumor weight showed ( Figure 6 ), compared with TC-1 tumor-bearing mice, the recombinant strain vaccine LM-HPV18 E7 had a significant inhibitory effect on the tumors generated by TC-1-HPV18 E7 tumor-bearing mice. From the measurement of tumor volume, after the 20th day of overall treatment, the tumor volume generated by TC-1-HPV18 E7 tumor-bearing mice no longer increased, proving that the recombinant attenuated Listeria monocytogenes vaccine has a good inhibitory effect on established tumors.

Claims

1. A method for constructing an E7 cell model expressing human papillomavirus types 16 and 18, characterized in that: The construction method comprises the following steps: In a culture medium inoculated with TC-1 cells, an exogenous plasmid is transfected into TC-1 cells; The culture medium contains G418 geneticin; the construction method of the exogenous plasmid is as follows: Primers pSL372-upstream-Kpn I-fwd and pSL372-upstream-rev were designed on both sides of the EGFP gene to amplify the upstream homology arms; primers pSL372-downstream-fwd and pSL372-downstream-BamH I-rev were designed on both sides of the HPV18 E7 gene to amplify the downstream homology arms; then the upstream and downstream fragments were connected by Overlap PCR to obtain the target fragment, and the target fragment and the vector plasmid pCDNA3.1+FLAG were double-digested; then ligase was used for connection; The sequence of pSL372-upstream-Kpn I-fwd is: CGGGGTACCATGGTGAGCAAGGGCGAG; The sequence of pSL372-upstream-rev is: AGGTCCATGCATCTTGTACAGCTCGTCCATGCC; The sequence of pSL372-downstream-fwd is: GAGCTGTACAAGATGCATGGACCTAAGGCAACAT; The sequence of pSL372-downstream-BamH I-rev is: CGCGGATCCCTGCTGGGATGCACACCAC.

2. The construction method according to claim 1, characterized in that: When inoculating TC-1 cells, the TC-1 cells are inoculated into a 6-well plate at a cell density of 70%-80%.

3. The construction method according to claim 1 or 2, characterized in that: When performing the transfection, first take the exogenous plasmid and add it to the serum-free RPMI 1640 culture medium, pipette and mix, then add HighGene transfection reagent and pipette and mix; then evenly add the exogenous plasmid and HighGene transfection reagent complex to the culture medium containing TC-1 cells.

4. The construction method according to claim 3, characterized in that: When performing the transfection, first take 4 μg of exogenous plasmid and add it to a centrifuge tube containing 200 μL of serum-free RPMI 1640 culture medium, and mix it by pipetting; then add 8 μL of HighGene transfection reagent and mix it by pipetting; and then evenly add 200 μL of the exogenous plasmid and HighGene transfection reagent complex to the culture medium containing TC-1 cells.

5. The construction method according to claim 4, characterized in that: 4-6 hours after transfection, half of the medium was replaced with fresh complete medium; 24 hours after transfection, the successfully transfected cells were selected for continued expansion culture.

6. The construction method according to claim 1, 2, 4 or 5, characterized in that: The concentration of the G418 geneticin is 1100-1500 μg / mL.

7. The construction method according to claim 6, characterized in that: The concentration of the G418 geneticin is 1200 μg / mL.

8. The construction method according to claim 7, characterized in that: The ligase is Ligation high Ver.

2.

9. The construction method according to claim 8, characterized in that: The vector plasmid is pCDNA3.1+FLAG.

10. A strain of E7 cells expressing human papillomavirus types 16 and 18, characterized in that: The name of the cell is mouse lung epithelial cell TC18, the preservation number is CCTCC NO: C20246, and it is preserved in the China Center for Type Culture Collection, and the preservation time is June 24, 2024.

Images