Construction method and application of African swine fever virus protein eukaryotic expression vector with immunosuppressive effect

Abstract

The invention discloses a construction method and application of an African swine fever virus protein eukaryotic expression vector with an immunosuppressive effect, and relates to the technical field of virus coding protein expression and function research biology. According to the eukaryotic expression vector, an African swine fever virus genome is taken as a template, a specific primer is adopted for PCR (Polymerase Chain Reaction) amplification, a PCR fragment is recovered and then is connected with a pcDNA3.1 vector to obtain a positive recombinant plasmid, namely the eukaryotic expression vector with the function of inhibiting stimulated immune response of cells to Poly (dT: dT), Poly (I: C) and exogenous IFN-beta. The construction method is simple and reasonable, after transfecting cell expression, the eukaryotic expression vector can be applied to inhibition of Poly (dT: dT), Poly (I: C) and exogenous IFN-beta stimulated cellular immune response, and establishment of an ASFV detection method and participation in vaccine development as a candidate target are facilitated.

Description

Technical Field

[0001] The present invention relates to the biotechnology field of virus-encoded protein expression and function research, and specifically to a method for constructing and applying an African swine fever virus protein eukaryotic expression vector capable of inhibiting cell immune response to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation. Background Art

[0002] African swine fever is caused by the African swine fever virus (ASFV), which is the only member of the Asfrisian swine fever virus family. The ASFV virus poisons multiple tissues and organs, causing extensive bleeding, edema and necrosis, with the lymph nodes and spleen being the most damaged. In addition, some people have neurological symptoms such as convulsions and neurological paralysis. As the world's largest pig producer, ASFV has greatly affected my country's agricultural food safety and caused huge economic losses.

[0003] The ASFV virus particle is a spherical symmetrical structure with a diameter of 260-300nm and a regular icosahedral structure. It consists of five parts: nucleoid, nucleocapsid, inner envelope, capsid and outer envelope. The viral genome is a 170-190kb long linear double-stranded DNA molecule with a structure similar to that of poxviruses. It can be divided into 151-167 closely arranged open reading frames with covalently closed ends.

[0004] ASFV encodes 150-200 viral proteins including 68 structural proteins and more than 100 nonstructural proteins, encoding genes necessary for viral replication, viral assembly and egress, and responsible for immune interactions with the host. ASFV has a unique feature that avoids recognition and cytotoxic response by CD8+ cells. Neutralizing antibodies are not produced as in the case of many other viral pathogens in pigs.

[0005] The B119L gene protein of African swine fever virus belongs to the Erv1p / Alrp family of sulfhydryl oxidases. It is highly conserved at the nucleotide and amino acid levels in all ASFV field isolates. It is a late non-structural protein required for the correct assembly of ASFV. It is involved in the maturation of viral particles and the growth of the virus in macrophages in vitro, and has been shown to affect the virulence of the virus in pigs. At present, most of the research on B119L is to construct a strain with a deletion of the B119L gene. Through in vitro experiments, it was found that it was highly attenuated in pigs and could not provide protection against parental virus challenges. Research on the biological function of the B119L protein is relatively basic and rarely reported.

[0006] In general, there are few reports on the biological functions of African swine fever virus B119L protein and its immunosuppressive mechanism at home and abroad. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a method for constructing and using a eukaryotic expression vector having the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C) and exogenous IFN-β.

[0008] The present invention is achieved through the following technical solutions:

[0009] A pair of specific primers were designed based on the conserved region of the B119L gene sequence published by NCBI, restriction sites were inserted into the upstream and downstream primers, and a Flag tag sequence was added. The primers were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The primer sequences are as follows:

[0010] F:CG GAATTC ATGTTGCATTGGGGACCTAAATACTG;

[0011] R:CC CTCGAG TTACTTATCGTCGTCATCCTTGTAATCTAGAGATGACC AGGCTCCAATAAAGT;

[0012] The African swine fever virus genome was used as the template for amplification, and the target fragment was amplified by PCR using specific primers. After the PCR fragment was recovered, the pcDNA3.1 vector was digested and connected, and after transformation, the plasmid was extracted by shaking bacteria and digested to obtain a positive recombinant plasmid, that is, a eukaryotic expression vector with the function of inhibiting cell Poly (dT: dT), Poly (I: C), and exogenous IFN-β stimulating immune response was obtained.

[0013] Preferably, the PCR amplification conditions of the present invention are: pre-denaturation at 95°C for 3 min, then 95°C for 15 s, 60°C for 15 s, 72°C for 30 s, 30 cycles, 72°C for 5 min, and 4°C cycles.

[0014] Preferably, the eukaryotic expression vector constructed by the present invention having the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation is transfected into cells for expression and then used in inhibiting the immune response of cells stimulated by Poly(dT:dT).

[0015] Preferably, the eukaryotic expression vector constructed by the present invention having the function of inhibiting the immune response stimulated by Poly(dT:dT), Poly(I:C), and exogenous IFN-β in cells is transfected into cells for expression and then used in inhibiting the cellular immune response stimulated by Poly(I:C).

[0016] Preferably, the eukaryotic expression vector constructed by the present invention having the function of inhibiting the immune response stimulated by cellular Poly(dT:dT), Poly(I:C), and exogenous IFN-β is transfected into cells for expression and then used in inhibiting the cellular immune response stimulated by exogenous IFN-β.

[0017] The significance of the above three applications lies mainly in determining that the African swine fever virus B119L protein has immunosuppressive function, and laying the foundation for the study of the biological function of the African swine fever virus B119L protein, which will help to establish ASFV detection methods and participate in vaccine development as a candidate target.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention discovered that the African swine fever virus B119L protein has the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation, and confirmed the immunosuppressive function of the B119L protein in in vitro cells;

[0020] The present invention uses the African swine fever virus genome as a template, and the construction method is simple, reasonable and easy to operate; the significance of the application of the present invention mainly lies in determining that the African swine fever virus B119L protein has an immunosuppressive function, and lays the foundation for the study of the biological function of the African swine fever virus B119L protein, which will be helpful in the establishment of ASFV detection methods and participate in the development of vaccines as a candidate target. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The figure is a comparison of the inhibition of IFN-β expression in cells stimulated by Poly(dT:dT) by various plasmid DNAs (36h).

[0022] Figure 2 The figure is a comparison of the inhibition of IFN-β expression in cells stimulated by Poly(dT:dT) by various plasmid DNAs (48h).

[0023] Figure 3 The figure is a comparison of the inhibition of IFN-β expression in cells stimulated by Poly(I:C) by various plasmid DNAs (36h).

[0024] Figure 4 The figure is a comparison of the inhibition of IFN-β expression in cells stimulated by Poly(I:C) by various plasmid DNAs (48h).

[0025] Figure 5 This is a comparison chart of the inhibition of exogenous IFN-β-stimulated cell ISG54 expression by various plasmid DNAs. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0027] Construction and identification of eukaryotic expression vector: The PCR purified product and the pcDNA3.1 empty vector were double-digested with EcoRI and XhoI, and connected after gel recovery. The positive clone plasmids with correct enzyme digestion identification were sent to Beijing Liuhe BGI Gene Technology Co., Ltd. for sequencing, which showed that after the above double enzyme digestion, the target gene fragment of about 360bp and the pcDNA3.1 vector fragment were obtained.

[0028] Construction of pcDNA3.1-B119L plasmid: The purified B119L product and the pcDNA3.1 empty vector were double-digested with EcoRI and XhoI, the B119L fragment was recovered and connected with the pcDNA3.1 vector to construct the recombinant expression plasmid pcDNA3.1-B119L, which was sequenced and identified.

[0029] The specific steps of cell transfection are as follows: add 200μl of Opti-MEM and 12μl of PEI40K to a 1.5ml centrifuge tube, add 200μl of Opti-MEM and 4ug of plasmid to another 1.5ml centrifuge tube, flick the two centrifuge tubes to mix well and let stand for 25 minutes. After washing the cells with Opti-MEM, add the above mixture, incubate at 37℃ for 6h, aspirate the mixture, replace it with 1% growth medium, incubate at 37℃ for 36h and 48h, and collect the cells. At the same time of transfection, set up empty vector transfection control and blank control.

[0030] ASFV-B119L expression inhibits the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation: 293T cell transfection, the steps are as follows: a monolayer of 293T cells is inoculated in a 12-well cell plate 12-16 hours ago and set aside. The cell density should be controlled at 70%-90% during transfection.

[0031] 1. Poly (I: C) stimulation: Add 200 μl of Opti-MEM and 12 μl of PEI 40K to a 1.5 ml centrifuge tube, add 200 μl of Opti-MEM and 4 ug of pcDNA3.1-B119L plasmid and Poly (I: C) stimulator to another 1.5 ml centrifuge tube, flick the two centrifuge tubes to mix and let stand for 25 minutes. After washing the cells with Opti-MEM, add the above mixture, incubate at 37°C for 6 hours, aspirate the mixture, replace with 1% maintenance solution, incubate at 37°C for 36 hours and 48 hours, and then collect the cells. During the transfection, set up an empty vector transfection control and a blank control.

[0032] 2. Poly (dT: dT) stimulation: Add 200μl of Opti-MEM and 12μl of PEI 40K to a 1.5ml centrifuge tube, add 200μl of Opti-MEM and 4ug of pcDNA3.1-B119L plasmid and Poly (dT: dT) stimulator to another 1.5ml centrifuge tube, flick the two centrifuge tubes to mix and let stand for 25 minutes. After washing the cells with Opti-MEM, add the above mixture, incubate at 37℃ for 6h, aspirate the mixture, replace with 1% maintenance solution, incubate at 37℃ for 36h and 48h, and collect the cells. During the transfection, set up an empty vector transfection control and a blank control.

[0033] 3. Exogenous IFN-β stimulation: Add 200μl of Opti-MEM and 12μl of PEI 40K to a 1.5ml centrifuge tube, add 200μl of Opti-MEM and 4ug of pcDNA3.1-B119L plasmid to another 1.5ml centrifuge tube, flick the two centrifuge tubes to mix well and let stand for 25 minutes. After washing the cells with Opti-MEM, add the above mixture, incubate at 37℃ for 6h, aspirate the mixture, replace with 1% maintenance solution, incubate at 37℃ for 34h, add exogenous IFN-β stimulator, and collect the cells after another 2h. During the transfection, set up empty vector transfection control and blank control.

[0034] 36 and 48 hours after 293T cell transfection, the cells were lysed, RNA was extracted, and reverse transcribed into cDNA template. Real-time PCR was used to detect changes in immune-related cytokines caused by Poly(dT:dT), Poly(I:C), and exogenous IFN-β.

[0035] All real-time PCR experimental data were analyzed using Graph Pad Prism 9.0 statistical software. One-way ANOVA was used to compare the means of multiple samples. P < 0.05 was considered to be significantly different, indicated by an asterisk *.

[0036] Figure 1 Comparison of the inhibition of IFN-β expression in cells stimulated by Poly(dT:dT) by various plasmid DNAs (36h). Figure 2 Comparison of the inhibition of IFN-β expression in cells stimulated by Poly(dT:dT) by various plasmid DNAs (48h). Figure 3 This is a comparison chart of the inhibition of IFN-β expression in cells stimulated by Poly(I:CPoly(dT:dT), Poly(I:C), and exogenous IFN-β) by various plasmid DNAs (36h). Figure 4 The figure is a comparison of the inhibition of IFN-β expression in cells stimulated by Poly(I:C) by various plasmid DNAs (48h). Figure 5 This is a comparison chart of the inhibition of exogenous IFN-β-stimulated cell ISG54 expression by various plasmid DNAs.

[0037] Figure 1 , 2 , 3, the representatives are:

[0038] 36hNC represents: cell control without transfection treatment at 36h;

[0039] 48hNC represents: cell control without transfection treatment for 48h;

[0040] 36hPoly(I:C) represents: cells were transfected with Poly(I:C) plasmid for 36h;

[0041] 48hPoly(I:C) represents: cells were transfected with Poly(I:C) plasmid for 48h;

[0042] 36hPoly(dT:dT) represents cells transfected with Poly(dT:dT) plasmid for 36 h;

[0043] 48hPoly(dT:dT) represents cells transfected with Poly(dT:dT) plasmid for 48h;

[0044] 36hPoly(I:C)+pcDNA3.1 represents: cells were transfected with Poly(I:C) and pcDNA3.1 plasmids for 36h;

[0045] 48hPoly(I:C)+pcDNA3.1 represents: cells were transfected with Poly(I:C) and pcDNA3.1 plasmids for 48h;

[0046] 36hPoly(dT:dT)+pcDNA3.1 represents: cells were transfected with Poly(dT:dT) and pcDNA3.1 plasmids for 36h;

[0047] 48hPoly(dT:dT)+pcDNA3.1 represents: cells were transfected with Poly(dT:dT) and pcDNA3.1 plasmids for 48h;

[0048] 36hPoly(I:C)+pcDNA3.1-B119L represents: cells were transfected with Poly(I:C) and pcDNA3.1-B119L plasmids for 36h;

[0049] 48hPoly(I:C)+pcDNA3.1-B119L represents: cells were transfected with Poly(I:C) and pcDNA3.1-B119L plasmids for 48h;

[0050] 36hPoly(dT:dT)+pcDNA3.1-B119L represents: cells were transfected with Poly(dT:dT) and pcDNA3.1-B119L plasmids for 36h;

[0051] 48hPoly(dT:dT)+pcDNA3.1-B119L represents: cells were transfected with Poly(dT:dT) and pcDNA3.1-B119L plasmids for 48h;

[0052] 36hpcDNA3.1 represents: cells were transfected with pcDNA3.1 plasmid for 36h;

[0053] 48hpcDNA3.1-B119L represents: cells were transfected with pcDNA3.1-B119L plasmid for 48h;

[0054] Depend on Figure 1 , 2 3 It can be seen that transfection and expression of pcDNA3.1-B119L can significantly inhibit the expression of IFN-β in cells stimulated by Poly(dT:dT) ( Figure 1 , 2 ). pcDNA3.1-B119L can significantly inhibit the expression of IFN-β in cells stimulated by Poly(I:C) ( Figure 3 , 4 pcDNA3.1-B119L can significantly inhibit the expression of ISG54 in cells stimulated by exogenous IFN-β ( Figure 5 ). The experimental results show that the African swine fever virus B119L protein has an immunosuppressive function.

[0055] In summary, the above are only preferred embodiments of the present invention and are not intended to limit the scope of implementation of the present invention. All equivalent changes and modifications to the shapes, structures, features and spirits described in the claims of the present invention should be included in the scope of the claims of the present invention.

Claims

1. A method for constructing a eukaryotic expression vector of African swine fever virus protein that has the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation, characterized in that: Using the African swine fever virus genome as a template, PCR amplification was performed using the following specific primers: F:CG GAATTC ATGTTGCATTGGGGACCTAAATACTG; R:CC CTCGAG TTACTTATCGTCGTCATCCTTGTAATCTAGAGATGACC AGGCTCCAATAAAGT; The double-enzyme-digested PCR fragment was recovered and connected to the pcDNA3.1 vector. After transformation, the plasmid was extracted by shaking and identified by enzyme digestion to obtain a positive recombinant plasmid, that is, a eukaryotic expression vector with the function of inhibiting the cell's immune response to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation.

2. The method for constructing the African swine fever virus protein eukaryotic expression vector having the function of inhibiting the cell immune response to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation according to claim 1, characterized in that: The PCR conditions are: pre-denaturation at 95°C for 5 min, followed by 94°C for 1 min, 52°C for 30 s, 72°C for 1 min, 35 cycles, and 72°C for 7 min and 4°C cycles.

3. Use of the eukaryotic expression vector constructed according to the method of claim 1 and having the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation, after being transfected into cells for expression, in inhibiting the immune response of cells stimulated by Poly(dT:dT).

4. Use of the eukaryotic expression vector constructed according to the method of claim 1 and having the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation, after being transfected into cells for expression, in inhibiting the immune response of cells stimulated by Poly(I:C).

5. Use of the eukaryotic expression vector constructed according to the method of claim 1 and having the function of inhibiting the immune response of cells to Poly(dT:dT), Poly(I:C), and exogenous IFN-β stimulation, after being transfected into cells for expression, in inhibiting the cellular immune response stimulated by exogenous IFN-β.

Images