Method for detecting blending homogeneity of cigarette formula tobacco varieties

Abstract

The invention belongs to the technical field of tobacco processing and detection, and particularly relates to a method for detecting the blending homogeneity of cigarette formula tobacco varieties, which comprises the following steps: screening variety-specific gene segments based on genome sequencing comparison of different tobacco varieties, designing fluorescent quantitative PCR (Polymerase Chain Reaction) primers of specific varieties according to the gene segments, and detecting the blending homogeneity of the tobacco varieties according to the fluorescent quantitative PCR primers. The content and proportion of a specific variety in formula tobacco shreds are detected through fluorescent quantitative PCR, the achievement degree of the variety formula proportion is calculated, and the blending homogeneity of the tobacco variety of the cigarette leaf group formula is evaluated by comparing the achievement degree of the formula proportion. The invention provides a new method for evaluating the blending homogeneity of tobacco varieties in a tobacco processing leaf group formula, and the method has the technical advantages and positive effects of accuracy, stability, high standardization degree, rapidness, simplicity, convenience and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of tobacco processing detection, and in particular relates to a method for detecting the mixing homogeneity of tobacco varieties in cigarette formulas. Background Art

[0002] Leaf blend is the core of cigarette products, usually made of tobacco leaves of different varieties, origins, parts and grades mixed in specific proportions. However, there are many material mixing processes in the processing of cigarettes, such as leaf beating and re-baking, leaf blending, loosening and moisture recovery, and leaf shreds blending, which can easily cause fluctuations in the tobacco material mixing ratio and affect the quality of cigarette products. Whether the tobacco materials are mixed evenly is the key to the stability of the quality of cigarette products. Therefore, the degree of achievement of the actual variety ratio of the cigarette formula has become an important evaluation indicator in the cigarette processing process.

[0003] Multiple tobacco varieties are usually used in cigarette formulas. Different varieties of tobacco leaves have great differences in chemical composition, physical properties and sensory quality. The reasonable combination of different varieties of tobacco leaves gives cigarette products unique style and quality characteristics. In the cigarette processing process, different varieties of tobacco leaves are finally prepared into formula tobacco through many processes such as leaf beating, re-roasting, blending, and shredding. In order to ensure the quality of cigarettes, it is necessary to accurately test the actual proportion of the final formula tobacco varieties to ensure that it is consistent with the proportion required by the cigarette formula. However, due to the similar shapes of different varieties of tobacco leaves and tobacco, it is difficult to distinguish different varieties of tobacco in the formula tobacco.

[0004] Patent ZL 202010188464.5, a tobacco leaf specific primer and a method for identifying the variety of flue-cured tobacco leaves, mentions that the use of specific primers after PCR amplification can be used to detect Honghua Dajinyuan tobacco leaves, but this technology is mainly for qualitative detection of the authenticity of raw material varieties, and cannot achieve the actual proportion and uniform mixing of formula tobacco varieties. Li Meng mentioned in his paper "Quantitative Detection of Honghua Dajinyuan in Mixed Tobacco Leaves by Fluorescence Quantitative PCR" that by designing Honghua Dajinyuan variety-specific primers and TaqMan MGB probes, the specificity and sensitivity of the primers and probes were tested, the reaction conditions of fluorescence quantitative PCR were determined, and on this basis, a standard curve was established to quantitatively detect the single variety of Honghua Dajinyuan in mixed tobacco leaves, which can effectively distinguish tobacco leaf varieties, but the document also does not involve the actual proportion and uniform mixing of formula tobacco varieties. In his paper "Research on the Application of DNA Mass Concentration Determination in Tobacco Processing Homogenization", Wang Guangyao mentioned using tobacco DNA mass concentration as a detection indicator for tobacco processing homogenization. The basis for this is that the DNA mass concentration of different varieties varies significantly, but the document also does not mention specific detection methods. Summary of the invention

[0005] The purpose of the present invention is to provide a method for detecting the homogeneity of tobacco blends in cigarette formulas, to provide an evaluation index for the stability of cigarette processing quality, and to solve the problems existing in the above-mentioned background technology.

[0006] To achieve the above objectives, this application is implemented through the following technical solutions:

[0007] A method for detecting the homogeneity of tobacco blends of cigarette formulas, comprising the following steps:

[0008] S1. Specific gene fragments of specific tobacco varieties were screened by genome sequencing comparison of different tobacco varieties, and fluorescent quantitative PCR primers were designed based on the specific gene fragments;

[0009] S2, extracting genomic DNA from tobacco of a specific tobacco variety and tobacco of a tested formula, respectively, and detecting the concentration and purity of the extracted DNA;

[0010] S3, using the fluorescent quantitative PCR primers in step S1 to perform fluorescent quantitative PCR on the tobacco DNA of the specific tobacco variety diluted to different concentrations, to obtain the Ct values ​​of the tobacco DNA of the specific tobacco variety at different concentrations, and to establish a standard curve of the concentration and Ct value of the DNA of the specific tobacco variety by regression analysis;

[0011] S4, using the fluorescent quantitative PCR primers in step S1 to perform fluorescent quantitative PCR on the DNA of the tested formula tobacco sample to obtain the Ct value of the tested formula tobacco sample, calculating the concentration of the specific tobacco variety DNA in the formula tobacco sample DNA according to the standard curve in step S3, and calculating the actual proportion of the specific tobacco variety DNA = (specific tobacco variety DNA concentration / formula tobacco sample DNA concentration) × 100%;

[0012] S5. The degree of achievement of specific tobacco varieties in formula tobacco samples = (1-│actual proportion of DNA of specific tobacco varieties-formula design proportion of DNA of specific tobacco varieties│ / formula design proportion of DNA of specific tobacco varieties) × 100%.

[0013] Furthermore, the specific gene fragment of the specific tobacco variety is the specific gene fragment of Yunyan 87.

[0014] Furthermore, the fluorescent quantitative PCR primers are:

[0015] Csp F17: CCCTGGATTGGTCTGTCTTGG;

[0016] Csp R17:ACAGCAGTAACAGCAGGAACA.

[0017] Further, the primer specificity is determined by conventional PCR product electrophoresis and fluorescent quantitative PCR melting curve, and the specific steps are as follows:

[0018] In conventional PCR amplification, the 20 μL reaction system is:

[0019] DNA template, 50 ng / μL, 1-2 μL;

[0020] 2×PCR Buffer mix, 10 μL;

[0021] Upstream and downstream primers, 10 μmol / L, 0.3-0.5 μL each;

[0022] ddH2O, add to 20 μL;

[0023] For fluorescent PCR amplification, 0.4 µl of ROX Reference Dye (50x) should be added to 20 µL of reaction system, and the remaining components are the same as those for conventional PCR amplification;

[0024] The conventional PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 20 s, for 30 cycles; extension at 72°C for 5 min;

[0025] The fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 60°C for 20 s, 40 cycles; extension at 72°C for 5 min; melting curve analysis: 65°C for 15 s.

[0026] Furthermore, in step S2, the optimized CTAB method or kit is used to extract the genomic DNA of Yunyan 87 tobacco and tobacco of the test formula.

[0027] Furthermore, in step S2, the tobacco varieties to be tested include one or more of Yunyan 87, Honghua Dajinyuan, K326, Zhongyan 100 and Longjiang 911.

[0028] A kit comprising the fluorescent quantitative PCR primers.

[0029] Furthermore, the kit is used in detecting the homogeneity of blended tobacco varieties in a tobacco leaf group formula.

[0030] The beneficial effects of the present invention are:

[0031] This application takes the main tobacco varieties of specific cigarette formulas as an example, designs variety-specific primers, uses fluorescent quantitative PCR to detect the proportion of specific tobacco varieties in a specific brand of finished tobacco, calculates the degree of achievement of the formula ratio, and thus quantitatively evaluates the blending of cigarette varieties, providing a new evaluation index for the uniformity of tobacco blending in cigarette formulas, which is of great significance for maintaining the style and quality stability of cigarettes. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the electrophoresis diagram of the amplification results of the Yunyan 87 variety-specific primers; where: M is the standard molecular weight DNA Marker, and lanes 1-5 are Yunyan 87, Zhongyan 100, K326, Cuibi No. 1 and Longjiang 911, respectively.

[0033] Figure 2 This is the melting curve of Yunyan 87 detected by the present invention.

[0034] Figure 3 This is the Ct value of the Yunyan 87 DNA concentration standard sample detected by the present invention.

[0035] Figure 4 This is the standard curve of Yunyan 87 DNA concentration detected by the present invention. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is described in detail below through examples. The following examples are merely exemplary and can only be used to explain and illustrate the technical solution of the present invention, but cannot be construed as limiting the technical solution of the present invention.

[0037] Example 1, Construction of Yunyan 87 DNA concentration detection standard curve:

[0038] Materials: Yunyan 87, Zhongyan 100, K326, Cuibi No. 1 and Longjiang 911 single-variety tobacco were provided by Henan Zhongyan Industrial Co., Ltd. They were all harvested, conditioned, redried and cut individually in the base unit, and the variety identification was reliable; the relevant primers were synthesized and provided by Shenggong Bioengineering (Shanghai) Co., Ltd.

[0039] 1. Extraction of tobacco genomic DNA:

[0040] (1) Weigh 10-20 g of tobacco sample, grind it into powder, and pass it through a 100-mesh sieve.

[0041] (2) Accurately weigh 0.1 g of tobacco powder into a 2 mL centrifuge tube, add 800 µL of CTAB extraction solution, and lyse in a 70°C water bath for 40 min, shaking the tube upside down every 10 min.

[0042] (3) Add 800 µL of -20°C precooled chloroform and centrifuge at 10,000 rpm for 10 minutes.

[0043] (4) Aspirate the supernatant, add the same volume of CTAB and chloroform, and centrifuge again at 10,000 r / min for 10 minutes.

[0044] (5) Aspirate the supernatant, add 2 times the volume of the supernatant with CTAB precipitation solution and 1 times the volume of the supernatant with isopropanol, and let it stand at -20°C for 1 hour.

[0045] (6) After standing, the sample was centrifuged at 12,000 r / min for 10 min, the supernatant was discarded, and 500 µL 1.2 mol / L NaCl was added and allowed to stand for 10 min.

[0046] (7) Add 600 µL of -20°C precooled isopropanol and let stand for 40 min.

[0047] (8) Centrifuge at 12,000 r / min for 10 min, discard the liquid, add 500 µL of -20°C precooled 70% ethanol, wash twice, and open the lid to evaporate for 2-5 minutes.

[0048] (9) Add 50 µL dd H2O to dissolve the DNA and store at -20°C.

[0049] 2. Design and verification of Yunyan 87 variety-specific primers:

[0050] The Yunyan 87 variety-specific gene fragment was obtained by sequencing and comparing the genomes of different tobacco varieties, and multiple pairs of Yunyan 87 variety-specific primers were designed based on the gene fragment.

[0051] For conventional PCR amplification, the 20 μL reaction system is designed as follows:

[0052] DNA template, 50 ng / μL, 1-2 μL;

[0053] 2×PCR Buffer mix, 10 μL;

[0054] Upstream and downstream primers, 10 μmol / L, 0.3-0.5 μL each;

[0055] ddH2O, add to 20 μL;

[0056] For fluorescent PCR amplification, 0.4 µl of ROX Reference Dye (50x) should be added to 20 µL of reaction system. The remaining components are the same as those for conventional PCR amplification.

[0057] The conventional PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 20 s, for 30 cycles; and extension at 72°C for 5 min.

[0058] The fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 60°C for 20 s, 40 cycles; extension at 72°C for 5 min; melting curve analysis: 65°C for 15 s.

[0059] Using DNA from tobacco of different varieties as templates, PCR amplification was performed using the designed Yunyan 87 variety-specific primers. The results of PCR product electrophoresis showed that the primer pair Csp F17 (CCCTGGATTGGTCTGTCTTGG) and Csp R17 (ACAGCAGTAACAGCAGGAACA) were specifically amplified only in Yunyan 87, showing variety specificity ( Figure 1 ).

[0060] The results of fluorescence quantitative PCR showed that the melting curves of the amplified products of Csp F17 and Csp R17 were single peaks, indicating that the band was a single amplified product with high primer specificity and could be used for fluorescence quantitative PCR detection ( Figure 2 ).

[0061] 3. Establishment of Yunyan 87 DNA concentration standard curve:

[0062] Sample preparation: Determine the concentration of Yunyan 87 tobacco DNA, add ddH2O to a final concentration of 10 ng / μL, add 0.4, 0.5, 1, 2, 4, 5, 8, 10 μL DNA, respectively, supplement other fluorescent quantitative components to a final volume of 20 μL, and obtain a standard solution gradient with a Yunyan 87 DNA concentration of 0.2, 0.25, 0.5, 1, 2, 2.5, 4, 5 ng / μL. Perform fluorescent quantitative PCR according to the set program. The amplification results are shown in Figure 3 As shown in the figure, it can be seen that there is a linear relationship between DNA concentration and Ct value.

[0063] With DNA concentration as the x-axis and the average of two Ct values ​​as the y-axis, regression analysis was performed to obtain a standard curve between Ct value and DNA concentration: y = -1.206 ln (x) + 21.839 ( Figure 4 The correlation coefficient of the obtained standard curve is R 2 It is 0.989, indicating that there is a good regression relationship between the Ct value and the concentration of Yunyan 87 DNA in the reaction system, and it can be used to detect the concentration of Yunyan 87 DNA.

[0064] Example 2: Detection of homogeneity of cigarette formula 1:

[0065] Cigarette formula 1 consists of three varieties: Yunyan 87, Zhongyan 100 and K326, with the formula proportions of 50%, 25% and 25% respectively. The single variety and mixed variety finished tobacco are provided by Henan China Tobacco Industrial Co., Ltd.

[0066] 1. Sample preparation:

[0067] 50g of Yunyan 87, 25g of Zhongyan 100 and 25g of K326 tobacco were respectively mixed thoroughly to prepare standard formula tobacco S1; finished mixed tobacco A1 and A2 with a designed proportion of Yunyan 87 of 50% and an unknown actual content were taken as test samples.

[0068] 2. Sample DNA extraction:

[0069] The extraction method was as described in Example 1, and the final concentration of the sample DNA was adjusted to 50 ng / μL.

[0070] 3. Variety mixing uniformity detection:

[0071] The standard curve and sample fluorescence quantitative PCR are as shown in Example 1. The obtained standard curve is y = -1.253ln (x) + 23.721 (R 2 is 0.987), and the test results are shown in Table 1. It can be seen from the results that the standard sample Yunyan 87 variety blending achievement is 99.6%, which is basically consistent with the design value, indicating that this method can accurately detect the proportion of Yunyan 87 in the mixed tobacco, and the variety blending achievement can be used as an evaluation indicator to judge the uniformity of the blending of formula tobacco varieties. The proportion of Yunyan 87 in sample A1 is higher than the design value, and the variety blending achievement is 80.4%; while the proportion of Yunyan 87 DNA in A2 is lower than the design value, and the variety blending achievement is 87.2%. Consistent with the smoking evaluation results, the sensory quality of samples A1, A2 and standard samples is significantly different.

[0072] Table 1 Result of homogeneity test of cigarette formula 1 variety

[0073]

[0074] Example 3: Detection of homogeneity of two cigarette formulas:

[0075] Cigarette formula 2 consists of four varieties: Yunyan 87, Zhongyan 100, K326 and Honghua Dajinyuan, with formula proportions of 40%, 20%, 30% and 10% respectively. The single variety and mixed variety finished tobacco are provided by Henan China Tobacco Industrial Co., Ltd.

[0076] 1. Sample preparation:

[0077] 40g of Yunyan 87, 20g of Zhongyan 100, 30g of K326 and 10g of Honghua Dajinyuan shredded tobacco were respectively mixed thoroughly to prepare standard formula shredded tobacco S2; finished mixed shredded tobacco B1 and B2 with a designed proportion of Yunyan 87 of 40% and an unknown actual content were taken as test samples.

[0078] 2. Sample DNA extraction:

[0079] The extraction method was as described in Example 1, and the final concentration of the sample DNA was adjusted to 50 ng / μL.

[0080] 3. Variety mixing uniformity detection:

[0081] The standard curve and sample fluorescence quantitative PCR are shown in Example 1. The obtained standard curve is y = -1.123ln (x) + 24.163 (R 2 The test results are shown in Table 2. The results show that the standard sample Yunyan 87 has a variety mixing degree of 99.5%, which is basically consistent with the design value. The proportion of Yunyan 87 in sample B1 is lower than the design value, and the variety mixing degree is 85%; the proportion of Yunyan 87 DNA in B2 is higher than the design value, and the variety mixing degree is 94%, which is closer to the design value. The above results are consistent with the evaluation results.

[0082] Table 2 Test results of homogeneity of two cigarette formulas

[0083]

[0084] Example 4: Detection of homogeneity of three cigarette formulas:

[0085] Cigarette formula 3 is composed of Yunyan 87, Zhongyan 100, K326, Honghua Dajinyuan and Longjiang 911, with the formula proportions of 30%, 30%, 25%, 10% and 5% respectively. The single variety and mixed variety finished tobacco are provided by Henan China Tobacco Industrial Co., Ltd.

[0086] 1. Sample preparation:

[0087] 30g of Yunyan 87, 30g of Zhongyan 100, 25g of K326, 10g of Honghua Dajinyuan and 5g of Longjiang tobacco were respectively mixed thoroughly to prepare standard formula tobacco S3; finished mixed tobacco C1 and C2 with a designed proportion of Yunyan 87 of 30% and an unknown actual content were taken as test samples.

[0088] 2. Sample DNA extraction:

[0089] The extraction method was as described in Example 1, and the final concentration of the sample DNA was adjusted to 50 ng / μL.

[0090] 3. Yunyan 87 concentration detection:

[0091] The standard curve and sample fluorescence quantitative PCR are shown in Example 1. The obtained standard curve is y = -1.217ln (x) + 24.201 (R 2 The test results are shown in Table 3. The results show that the standard sample Yunyan 87 has a variety mixing degree of 99.8%, which is basically consistent with the design value. The proportion of Yunyan 87 in samples C1 and C2 is slightly higher than the design value, and the variety mixing degree is 92.7% and 98% respectively.

[0092] Table 3 3. Test results of homogeneity of three cigarette formulas

[0093]

[0094] This application uses Yunyan 87 variety-specific primers and fluorescent quantitative PCR to detect the degree of variety blending in formula tobacco, achieving quantitative detection of the homogeneity of cigarette formula variety blending, and providing a new evaluation index for cigarette processing quality control. Compared with the existing rough qualitative judgment through sensory evaluation, the method and process of this application is highly standardized, and the test results are more objective and accurate, which can be promoted and applied in cigarette production enterprises.

[0095] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. A method for detecting the homogeneity of tobacco blends in cigarette formulas, characterized in that: The following steps are involved: S1. Specific gene fragments of specific tobacco varieties were screened by genome sequencing comparison of different tobacco varieties, and fluorescent quantitative PCR primers were designed based on the specific gene fragments; S2, extracting genomic DNA from tobacco of a specific tobacco variety and tobacco of a tested formula, respectively, and detecting the concentration and purity of the extracted DNA; S3, using the fluorescent quantitative PCR primers in step S1 to perform fluorescent quantitative PCR on the tobacco DNA of the specific tobacco variety diluted to different concentrations, to obtain the Ct values ​​of the tobacco DNA of the specific tobacco variety at different concentrations, and to establish a standard curve of the concentration and Ct value of the DNA of the specific tobacco variety by regression analysis; S4, using the fluorescent quantitative PCR primers in step S1 to perform fluorescent quantitative PCR on the DNA of the tested formula tobacco sample to obtain the Ct value of the tested formula tobacco sample, calculating the concentration of the specific tobacco variety DNA in the formula tobacco sample DNA according to the standard curve in step S3, and calculating the actual proportion of the specific tobacco variety DNA = (specific tobacco variety DNA concentration / formula tobacco sample DNA concentration) × 100%; S5. The degree of achievement of specific tobacco varieties in formula tobacco samples = (1-│actual proportion of DNA of specific tobacco varieties-formula design proportion of DNA of specific tobacco varieties│ / formula design proportion of DNA of specific tobacco varieties) × 100%.

2. The method for detecting the homogeneity of tobacco blends of cigarette formulas according to claim 1, characterized in that: The specific gene segment of the specific tobacco variety is the specific gene segment of Yunyan 87.

3. The method for detecting the homogeneity of tobacco blends of cigarette formulas according to claim 1, characterized in that: The primers for fluorescent quantitative PCR are: Csp F17: CCCTGGATTGGTCTGTCTTGG; Csp R17:ACAGCAGTAACAGCAGGAACA.

4. The method for detecting the homogeneity of tobacco blends of cigarette formulas according to claim 3, characterized in that: The primer specificity was determined by conventional PCR product electrophoresis and fluorescent quantitative PCR melting curve. The specific steps are as follows: In conventional PCR amplification, the 20 μL reaction system is: DNA template, 50 ng / μL, 1-2 μL; 2×PCR Buffer mix, 10 μL; Upstream and downstream primers, 10 μmol / L, 0.3-0.5 μL each; ddH2O, add to 20 μL; For fluorescent PCR amplification, 0.4 µl of ROX Reference Dye (50x) should be added to 20 µL of reaction system, and the remaining components are the same as those for conventional PCR amplification; The conventional PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 20 s, for 30 cycles; extension at 72°C for 5 min; The fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 60°C for 20 s, 40 cycles; extension at 72°C for 5 min; melting curve analysis: 65°C for 15 s.

5. The method for detecting the homogeneity of tobacco blends of cigarette formulas according to claim 3, characterized in that: In step S2, the optimized CTAB method or kit is used to extract genomic DNA from Yunyan 87 tobacco and tobacco of the test formula.

6. The method for detecting the homogeneity of tobacco blends of cigarette formulas according to claim 5, characterized in that: In step S2, the tobacco varieties to be tested include one or more of Yunyan 87, Honghua Dajinyuan, K326, Zhongyan 100 and Longjiang 911.

7. A kit, characterized in that: Comprising the fluorescent quantitative PCR primers according to claim 3.

8. The kit according to claim 7, characterized in that The kit is used in detecting the homogeneity of blended tobacco varieties in a tobacco leaf group formula.

Images