Composition for miRNA detection based on infinite zipper hybridization chain reaction, fluorescent biosensor, and construction method and application thereof

Abstract

The invention discloses a kind of miRNA detection composition based on infinite zipper type hybridization chain reaction (ZHCR), fluorescent biosensor and its construction method and application.HCR is combined with PER by the present invention, and the single-stranded DNA product generated by PER is used as the track for fixing hairpin, and is reacted and combined with the leg hairpin H1-1, H2-1 of HCR to generate ZH1 and ZH2 respectively;Target recognition unit is also designed according to miRNA sequence, and after target miRNA is combined with it, closed chain falls off, exposes initiation sequence, causes ZH2 and ZH1 to occur ZHCR, produces fluorescent signal.Reaction substrate preparation and sequence design of the present invention are simple, and free hairpin can be positioned on long track, so as to improve reaction rate, realize isothermal, rapid, sensitive amplification to miRNA in vitro, can provide a promising new platform for miRNA efficient imaging and in vitro detection in living cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a composition for detecting miRNA based on infinite zipper hybridization chain reaction, a fluorescent biosensor, and a construction method and application thereof. Background Art

[0002] A variety of small molecule biomarkers in the human body play a key role in early disease screening, drug guidance, auxiliary diagnosis, and prognosis assessment. MicroRNA (miRNA) is a short, non-coding, single-stranded RNA (approximately 22 nucleotides) that plays an important role in gene expression regulation by targeting messenger RNAs (mRNAs) at the post-transcriptional level to stimulate gene expression or degrade the transcripts of their target genes. Due to its high sensitivity and specificity, it has been studied as an emerging biomarker for cancer diagnosis, prognosis, and treatment monitoring.

[0003] Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) has long been the gold standard for miRNA detection. Unlike long RNA species (e.g., mRNA), short miRNAs require specialized reverse steps to facilitate PCR amplification and detection of the amplified sequence, requiring precise temperature control, specialized instrumentation, and prolonged detection times. As alternatives to thermal cycling-based qPCR, which requires complex analytical procedures and instrumentation, a number of isothermal assays have been developed to advance miRNA detection, such as rolling circle amplification, hybridization chain reaction, and catalytic hairpin assembly. Although these detection methods offer the advantages of simplicity or even instrumentation, they are limited by high background signal and nonspecific amplification, relatively slow kinetics, and low sensitivity. The hybridization chain reaction (HCR), a toehold-mediated strand displacement reaction (TMSD), has attracted considerable attention due to its enzyme-free, isothermal, and high amplification efficiency. Currently proposed HCR-based confined nanoassemblies, such as locating hairpins, tetrahedrons, and triangular prisms, can accelerate DNA nanoassemblies by positioning free hairpins and increasing the local concentration of reactants. However, these methods still have some drawbacks, such as complex substrate preparation and the potential for nonspecific hybridization and steric hindrance caused by the self-entanglement of locating hairpins. For example, a method proposed by previous researchers to independently fix two hairpin probes in their respective tracks, however, this method only allows for a limited number of hairpins to be combined, resulting in a smaller assembly with a higher mobility. Therefore, the intracellular residence time may be shortened, increasing the possibility of the probes being expelled from the cell. Summary of the Invention

[0004] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a composition for miRNA detection based on infinite zipper hybridization chain reaction, a fluorescent biosensor, and a construction method and application thereof, which are used to solve a series of problems of current HCR-based confined nanoassembly, such as: complex substrate preparation; nonspecific hybridization and steric hindrance caused by alternating hairpins; or the limited number of bound hairpins, resulting in a small assembly size and high mobility, which may shorten the residence time in the cell and increase the possibility of the probe being expelled from the cell.

[0005] To achieve the above-mentioned and other related objects, the present invention provides, in a first aspect, a composition for detecting miRNA, comprising a first component, a second component, and a third component;

[0006] The first component includes a primer;

[0007] The second component includes a hairpin with legs H1-1 and a hairpin with legs H2-1;

[0008] The primer generates a linear single-stranded DNA through a primer exchange reaction (PER), wherein the linear single-stranded DNA contains a repeated short DNA sequence; the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H1-1 to form a DNA double-strand ZH1, and the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H2-1 to form a DNA double-strand ZH2;

[0009] The third component includes a double-stranded DNA IMB; or, the third component includes a single-stranded DNA IM and a closed chain B; or, the third component includes a priming chain I, a miRNA recognition sequence M and a closed chain B;

[0010] The double-stranded DNA IMB includes the single-stranded DNA IM and the closed strand B, and the single-stranded DNA IM includes the priming strand I and the miRNA recognition sequence M; the miRNA recognition sequence M is partially or completely complementary to the nucleotide sequence of the target miRNA;

[0011] After the miRNA recognition sequence M binds to the target miRNA, the closed chain B in the DNA double-strand IMB will fall off, exposing the initiator chain I. The initiator chain I then undergoes an infinite zipper hybridization chain reaction (ZHCR) with the DNA double-strand ZH1 and DNA double-strand ZH2 in sequence to form a long zipper DNA polymer.

[0012] In some embodiments, the nucleotide sequence of the primer is shown as SEQ ID NO.3.

[0013] In some embodiments, the first component further comprises a catalytic hairpin and / or a clean hairpin G (Clean.G). The nucleotide sequence of the catalytic hairpin is shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the nucleotide sequence of the clean hairpin G is shown in SEQ ID NO. 4. Clean.G comprises a C template, upon which its 3' end can be extended. During the initial incubation, the dATP, dTTP, and dCTP solutions may contain a small amount of dGTP contamination. The addition of Clean.G can serve as a strategy to filter out these contaminating nucleotides, thereby halting extension.

[0014] In some embodiments, the nucleotide sequence of the linear single-stranded DNA is shown as SEQ ID NO.5.

[0015] In some embodiments, the nucleotide sequence of the legged hairpin H1-1 includes fragment 1, fragment 2 and fragment 3 connected in sequence from the 5' end to the 3' end, the nucleotide sequence of the legged hairpin H2-1 includes fragment 4, fragment 2 and fragment 1 connected in sequence from the 5' end to the 3' end, the nucleotide sequence of fragment 1 includes GTTAAGTTGTGTTAAGTTGT, the nucleotide sequence of fragment 2 includes 0 to 10 consecutive bases T, the nucleotide sequence of fragment 3 includes the nucleotide sequence shown in SEQ ID NO.6, and the nucleotide sequence of fragment 4 includes the nucleotide sequence shown in SEQ ID NO.7.

[0016] In some embodiments, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15 or SEQ ID NO.17.

[0017] In some embodiments, the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16 or SEQ ID NO.18.

[0018] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.9, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.10.

[0019] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.11, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.12.

[0020] In one embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO. 13, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO. 14. In one embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO. 15, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO. 16.

[0021] In a specific embodiment, the nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.17, and the nucleotide sequence of the hairpin H2-1 comprises the nucleotide sequence shown in SEQ ID NO.18.

[0022] In some embodiments, the nucleotide sequence of the priming chain 1 is shown in SEQ ID NO.19.

[0023] In some embodiments, the target miRNA is selected from at least one of miR-221, miR-222, miR-375, miR-141, or miR-146b, but is not limited thereto.

[0024] In some embodiments, when the target miRNA is miR-221, the nucleotide sequence of the single-stranded DNA IM is shown as SEQ ID NO.30, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.25.

[0025] In some embodiments, when the target miRNA is miR-222, the nucleotide sequence of the single-stranded DNA IM is shown as SEQ ID NO.31, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.26.

[0026] In some embodiments, when the target miRNA is miR-375, the nucleotide sequence of the single-stranded DNA IM is shown as SEQ ID NO.32, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.27.

[0027] In some embodiments, when the target miRNA is miR-141, the nucleotide sequence of the single-stranded DNA IM is shown as SEQ ID NO.33, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.28.

[0028] In some embodiments, when the target miRNA is miR-146b, the nucleotide sequence of the single-stranded DNA IM is shown as SEQ ID NO.34, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.29.

[0029] In some embodiments, the first component further comprises at least one of the following components: a buffer, a buffering agent, deoxynucleoside triphosphates (dNTPs), and a DNA polymerase. The deoxynucleoside triphosphates (dNTPs) include, but are not limited to, adenine deoxynucleotides (dATP), thymine deoxynucleotides (dTTP), and cytosine deoxynucleotides (dCTP).

[0030] In some embodiments, the buffer is selected from at least one of PBS buffer and Tris buffer, but is not limited thereto, wherein the Tris buffer comprises the following components: 0.8 M NaCl, 20 mM Tris, pH=7.6.

[0031] In some embodiments, the buffering agent is selected from magnesium sulfate, but is not limited thereto.

[0032] In some embodiments, the DNA polymerase is selected from BST Warm Start 2.0 polymerase, but is not limited thereto.

[0033] In some embodiments, the legged hairpins H1-1 and H2-1 are respectively labeled with a fluorescent group and a quenching group, or the legged hairpin H1-1 is labeled with a fluorescent group and a quenching group; the fluorescent group is selected from FAM, HEX, TET, ROX, TAMRA, JOE, Cy, etc., for example, at least one of 6-FAM, 6-HEX, 6-TET, 6-ROX, 6-TAMRA, 6-JOE, Cy3, and Cy5, and the quenching group is selected from at least one of BHQ1 and BHQ2, but is not limited thereto.

[0034] In some embodiments, the nucleotide sequence shown in SEQ ID NO. 11, 13 or 15 is labeled with a fluorescent group, and the nucleotide sequence shown in SEQ ID NO. 12, 14 or 16 is labeled with a quencher group.

[0035] In a specific embodiment, the nucleotide sequence shown in SEQ ID NO. 17 is labeled with a fluorescent group and a quenching group.

[0036] The second aspect of the present invention provides a method for constructing a fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction using the composition described in the first aspect, comprising the following steps:

[0037] (1) constructing a primer exchange reaction system, and subjecting the primers to a primer exchange reaction to generate a linear single-stranded DNA product;

[0038] (2) incubating the primer exchange reaction product with the legged hairpins H1-1 and H2-1, respectively, to generate double-stranded DNA ZH1 and double-stranded DNA ZH2;

[0039] (3) The double-stranded DNA ZH1 and the double-stranded DNA ZH2 are incubated with the double-stranded DNA IMB to construct the fluorescent biosensor.

[0040] In some embodiments, the primer exchange reaction process in step (1) includes: the catalytic hairpin and the cleaning hairpin G are first mixed and incubated with DNA polymerase and deoxynucleoside triphosphates, and then the primer is added and incubated continuously to obtain a linear single-stranded DNA product.

[0041] In some embodiments, in the primer exchange reaction system of step (1), the concentration of the catalytic hairpin is 0.125 μM to 1 μM, preferably 1 μM.

[0042] In some embodiments, in the primer exchange reaction system of step (1), the concentration of DNA polymerase is 0.2 units / μl to 1.6 units / μl, preferably 8 units / μl, where units / μl is abbreviated as u / μl.

[0043] In some embodiments, in step (1), the incubation temperature is 37°C.

[0044] In some embodiments, in step (1), the catalytic hairpin and the cleaning hairpin G are mixed with DNA polymerase and deoxynucleoside triphosphates and incubated for 10 min to 15 min.

[0045] In some embodiments, in step (1), the incubation time after the primer is added is 2 hours.

[0046] In some embodiments, step (1) further comprises: heating to inactivate the enzyme after the incubation is completed, the heating temperature is 80° C., and the heating time is 15 min to 20 min.

[0047] In some embodiments, in step (2), the incubation temperature is 37° C. and the incubation time is 2 h.

[0048] In some embodiments, in the reaction system in step (2), the concentration of the legged hairpin H1-1 is 0.1 μM to 2.5 μM, and the concentration of the legged hairpin H2-1 is 0.1 μM to 2.5 μM.

[0049] In some embodiments, step (2) further comprises: after annealing, the legged hairpin H1-1 and the legged hairpin H2-1 are incubated with the primer exchange reaction product, the annealing temperature is preferably 95° C., and the annealing time is preferably 5 min.

[0050] In some embodiments, in step (3), the incubation temperature is 37° C. and the incubation time is 0.5 h to 1 h.

[0051] In some embodiments, in step (3), the concentration of the double-stranded DNA IMB is 10 nM to 50 nM, preferably 20 nM to 50 nM.

[0052] The third aspect of the present invention provides a fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction, which is constructed according to the method described in the second aspect.

[0053] The fourth aspect of the present invention provides a miRNA detection method using the composition described in the first aspect and / or the fluorescent biosensor described in the third aspect.

[0054] The fifth aspect of the present invention provides use of the composition described in the first aspect, and / or the method described in the second aspect, and / or the fluorescent biosensor described in the third aspect in preparing a miRNA detection reagent.

[0055] As described above, the miRNA detection composition based on infinite zipper hybridization chain reaction, the fluorescent biosensor, and the construction method and application thereof of the present invention have the following beneficial effects:

[0056] The present invention proposes a confined nano-DNA self-assembled fluorescent biosensor with miRNA as the target and constructed based on ZHCR. It can provide a promising new method for efficient imaging of miRNA in living cells and detection of clinical samples, and has good detection performance. It has certain potential application value in effectively distinguishing thyroid cancer and normal people in clinical serum samples, as well as in the auxiliary diagnosis of other diseases.

[0057] (1) The present invention combines HCR with PER, utilizes the single-stranded DNA product generated by PER as the track for fixing the hairpin, and designs the hairpins H1-1 and H2-1 with legs on the basis of the hairpins H1 and H2 of the classic HCR, and then reacts and combines the track with H1-1 and H2-1 to generate ZH1 and ZH2 respectively, so that the free hairpins H1-1 and H2-1 are anchored on the track respectively, significantly improving the local concentration between the hairpins, and after adding the target, it is possible to increase the collision frequency between the hairpins, thereby significantly improving the reaction rate, and producing a more efficient and sensitive amplification than HCR. At the same time, the single-stranded track preparation method is simple, and after the hairpins H1-1 and H2-1 with legs are positioned on the long track, the target is introduced, and a fluorescent signal output can be quickly generated. Therefore, compared to traditional HCR, the reaction speed is significantly improved.

[0058] (2) Compared with other confined nanoassembly methods, the substrate preparation and sequence design of the present invention are very simple. The separate preparation of the legged hairpins H1-1 and H2-1 avoids the high background signal caused by nonspecific hybridization of the hairpins. In addition, the infinite extension of the DNA chain of PER can enable more free hairpins to be positioned, solving the problems existing in the current confined nanoassembly.

[0059] (3) Based on the programmability of nucleic acids, the present invention also designs a target recognition unit that can react in different target situations to form long zipper-like DNA polymers, increase the size of the assembly, and thus promote the intracellular detection and imaging of miRNAs.

[0060] (4) Compared with the existing gold standard RT-qPCR for detecting miRNA, the detection method established based on the present invention does not require complex instruments and equipment, does not require reversal, and the process of detecting miRNA is only carried out under isothermal and enzyme-free conditions at 37°C. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 This is a technical principle diagram of the ZHCR-based fluorescent biosensor for detecting miRNA in the present invention.

[0062] Figure 2 Schematic diagram of PER reaction (a), the results of gel electrophoresis characterization of PER (b), and the optimization results of PER catalytic hairpin and DNA polymerase concentration (c, d).

[0063] Figure 3 The results of gel electrophoresis characterization of ZH1 and ZH2 formed by the PER products binding to different concentrations of H1-l (a) and H2-l (b), respectively.

[0064] Figure 4Figure 3 shows the feasibility verification results of classic HCR and HCR-1 (a), the fluorescence kinetic signal comparison between ZHCR-1 and HCR-1 from on-off (b), the fluorescence kinetic signal comparison between HCR-1 and four groups, namely, ZHCR-1-0T, ZHCR-1-5T, and ZHCR-1-10T, from three times from on-off (c) and the kinetic reaction rate constant fitting results of the four groups (d), and the fluorescence kinetic signal comparison between HCR-1 and ZHCR-1-5T groups from three times from off-on (e, f).

[0065] Figure 5 Figure 3 shows the signal-to-noise ratio (a) of the ZHCR-1-5T group when different concentrations of legged hairpins were added, the sensitivity detection results (b) when different concentrations of initiator chains were added, and the linear relationship analysis results (c).

[0066] Figure 6 Figures (a, b) show the feasibility verification results of miR-221 and miR-222 detection after the introduction of IMB into the ZHCR-l-5T group, the optimization results of IMB concentration (c), the sensitivity detection results at different miRNA concentrations (d, e), and the linear relationship analysis results (f, g).

[0067] Figure 7 This is the specific detection result of different miRNAs after introducing different IMBs into the ZHCR-l-5T group. DETAILED DESCRIPTION

[0068] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0069] In the present invention, unless otherwise specified, the term "plurality" means two or more.

[0070] The character " / " indicates that the preceding and following objects are in an "or" relationship. For example, A / B means: A or B.

[0071] The term "and / or" describes an association between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or A and B.

[0072] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0073] Example 1

[0074] 1. Experimental Materials

[0075] Agarose, dATP, dTTP, dCTP, PBS, and all HPLC-purified oligonucleotides were purchased from Bio-Tech (Shanghai, China). 6× loading buffer and 20–200 bp DNA markers were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). DNA Cycle pure Kit was purchased from Omega Bio-Tek (Guangzhou, China). ZHCR probe assembly was performed in reaction buffer (0.8 M NaCl, 20 mM Tris, pH 7.6). BST 2.0 Warm Start DNA polymerase was purchased from New England Biolabs (Beijing, China). Deionized water (≥18 MΩ, Millipore Bedford, MA, USA) was used in all experiments.

[0076] The nucleotide sequences involved in the present invention are shown in Table 1 and Table 2.

[0077] Table 1 DNA nucleotide sequences involved in the PER reaction system

[0078]

[0079] Table 2 DNA nucleotide sequences involved in HCR and ZHCR reaction systems

[0080]

[0081]

[0082] 2. Experimental Instruments

[0083] Fluorescence spectra were measured on a F-4700 (Hitachi, Japan) fluorescence spectrophotometer (Hitachi, Japan). Native polyacrylamide gel electrophoresis (PAGE) was performed on an electrophoresis instrument (Bio-Rad, USA), and image analysis was performed using a Chemi-Doc XRS system (Bio-Rad, USA). The concentration of the purified PER product was quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

[0084] 3. Experimental Process

[0085] 1. Construction of a fluorescent biosensor for detecting miRNA based on infinite zipper hybridization chain reaction (ZHCR)

[0086] 1.1 Technical Principles:

[0087] like Figure 1 As shown, PER was first used to generate a linear single-stranded DNA consisting of a repetitive short DNA sequence. This single-stranded DNA served as a track for anchoring the hairpins, hybridizing with the legged hairpins H1-1 and H2-1, respectively. Because the single-stranded DNA consisted of repetitive sequences, it could bind to multiple H1-1 and H2-1 fragments, forming ZH1 and ZH2.

[0088] Then, in order to identify different miRNAs, based on the programmability of nucleic acids, the target recognition unit (IMB) is designed according to the miRNA sequence. The IMB is a double-stranded chain consisting of a chain (IM) synthesized by the initiator chain (Initiator, I) and the miRNA recognition sequence (M) and a blocking chain (Blocker, B).

[0089] The hairpin with legs is modified with a fluorescent group and a quenching group to detect miRNA by detecting changes in the fluorescence signal. Due to the different modification positions of the fluorescent group and the quenching group, the changes in the fluorescence signal during the fluorescence detection process have the following two situations:

[0090] When the fluorescence signal exhibits a reverse on-off state, the fluorophore FAM and the quencher BHQ1 are modified at corresponding positions in the DNA sequences of the legged hairpins H1-1 and H2-1, respectively. In this case, in the absence of target, ZH1 and ZH2 remain stable, allowing for the detection of a fluorescence signal. However, in the presence of the target miRNA, upon binding to the IMB, the blocking strand dislodges, exposing the initiating strand. This initiating strand undergoes ZHCR with ZH2 and then with ZH1, unzipping the hairpins H1-1 and H2-1, forming a long, zippered DNA polymer. The fluorophore and quencher come into close proximity, quenching the fluorescence signal.

[0091] When the fluorescence signal exhibits a positive off-on signal, the fluorophore FAM and the quencher BHQ1 are modified at the corresponding positions in the DNA sequence of the legged hairpin H1-1. In this case, in the absence of target, ZH1 and ZH2 remain stable, and the fluorescence signal is quenched. However, when the target miRNA is present, the miRNA binds to the IMB, causing the closed strand to fall off, exposing the initiator strand. The initiator strand undergoes ZHCR with ZH2 and then with ZH1, opening the hairpin H1-1 and forming a long zipper-like DNA polymer, generating a fluorescent signal.

[0092] 1.2 Preparation process:

[0093] (1) Constructing a PER reaction system and obtaining a PER product

[0094] Take PBS (10μl, 10×), MgSO4 (10μl, 100mM), dNTP (10μl, 6mM), Hairpin 1 / 2 (10μl, 10μM), Clean.G (10μ1, 1μM), BST Warm Start 2.0 polymerase (10μl, 8units / μl), react at 37℃ for 15min, then add primer (10μl, 10μM), add 30μl ddH2O to a total volume of 100μl, incubate at 37℃ for 2h, then heat to 80℃ and incubate for 20min to inactivate the enzyme. The resulting reaction system was purified using a DNA purification kit, and the purified PER product was quantified by nanodrop.

[0095] (2) Constructing HCR and HCR-1 systems and preparing zipper-type ZH1 and ZH2

[0096] Hairpins H1 and H2, and legged hairpins H1-1 and H2-1 were annealed (95°C, 5 min) and then cooled to room temperature.

[0097] H1 (5 μM) and H2 (5 μM) were added to the initiator chain with a hairpin to initiator chain concentration ratio of 10:1. The reaction was incubated at 37°C for 1 h to construct the HCR system.

[0098] H1-1 (5 μM) and H2-1 (5 μM) were added to the initiator chain with a hairpin to initiator chain concentration ratio of 10:1. The reaction was incubated at 37°C for 1 h to construct the HCR-1 system.

[0099] H1-1 (5 μM) and H2-1 (5 μM) were incubated with purified and quantified PER product (final concentration of 38.5 ng / ul) at 37°C for 2 h to generate ZH1 (2.5 μM) and ZH2 (2.5 μM), respectively, to prepare for ZHCR-1.

[0100] (3) Construction of ZHCR-1 system

[0101] After preparing ZH1 (2.5 μM) and ZH (2.5 μM), the initiator strand was added at a hairpin to initiator strand ratio of 10:1. The mixture was then incubated at 37°C for 1 hour, and the fluorescence endpoint signal was detected. Simultaneously, the fluorescence kinetics of the ZHCR-1 system were analyzed, indicating that the reaction was essentially complete within 30 minutes.

[0102] 1.3 Fluorescence detection

[0103] 100 μl of the above reactants were taken and added to a quartz cuvette, and the fluorescence was measured using a fluorescence spectrophotometer, specifically including the following steps:

[0104] (1) Fluorescence cuvette cleaning: Soak the fluorescence cuvette in alcohol and then clean it with DEPC water;

[0105] (2) Setting parameters: set the excitation wavelength to 520 nm, the emission wavelength range to 490-600 nm, and the voltage to 650 V;

[0106] (3) Zero adjustment: Add DEPC water to the fluorescence cuvette to adjust the zero;

[0107] (4) Perform detection: Add the reaction solution into the fluorescence cuvette and click on “Detect” to obtain the fluorescence signal.

[0108] 2. Verify the feasibility of the PER system:

[0109] like Figure 2 As shown in a, using PER, after continuous primer cycling, a single-stranded DNA product with a repeating sequence can be generated. Because this product lacks the G base, the sequence structure is simplified, reducing the possibility of forming a secondary structure.

[0110] The feasibility of the PER system was verified by PAGE, and the results were as follows: Figure 2 As shown in b,

[0111] Lane markers are 20bp-500bp DNA markers;

[0112] Lane 1 is primer;

[0113] Lane 2 is clean.G;

[0114] Lane 3: primer + hairpin1;

[0115] Lane 4 is primer+hairpin2;

[0116] Lane 5: primer+hairpin1+clean.G;

[0117] Lane 6: primer+hairpin2+clean.G;

[0118] Lane 7: primer + hairpin1 + clean.G + dNTP (A, C, T);

[0119] Lane 8 is primer+hairpin2+clean.G++dNTP(A, C, T).

[0120] from Figure 2As shown in Figure b: Lane 1 is the primer. Due to its short sequence, no corresponding band is visible in lane 1. Lane 2 is clean.G. Lanes 3 and 4 correspond to primer + hairpin1 / hairpin2, respectively. Lanes 5 and 6 correspond to primer + clean.G + hairpin1 / hairpin2, respectively. In the absence of complete reactants, no migrating bands form in these lanes. Lanes 7 and 8, however, are primer + clean.G + dNTP (A, C, T) + hairpin1 / hairpin2. In the presence of all reactants, distinct bands are visible, indicating successful PER. Hairpin1 and hairpin2 represent differently modified hairpins, both capable of undergoing PER reactions. Hairpin1 contains a reversed dT modification at its 3' end, which prevents extension to the unbound region at the 5' end of its primer. Subsequent PER reactions select hairpin1 for execution.

[0121] The hairpin1 concentration of the PER system was optimized by PAGE, and the results were as follows Figure 2 c, where

[0122] Lane markers are 20-500 bp DNA markers;

[0123] Lane 1, 0.125 μM hairpin1;

[0124] Lane 2, 0.25 μM hairpin1;

[0125] Lane 3, 0.5 μM hairpin1;

[0126] Lane 4, 1 μM hairpin1;

[0127] according to Figure 2 As shown in c, the final concentration of hairpin1 in the subsequent PER system was selected to be 1 μM.

[0128] The concentration of BST 2.0WarmStart polymerase in the PER system was optimized by PAGE. The results are as follows: Figure 2 d, where

[0129] Lane markers are 20-500bp DNA markers;

[0130] Lane 1: 0.2u / ul polymerase;

[0131] Lane 2: 0.4u / ul polymerase;

[0132] Lane 3: 0.8u / ul polymerase;

[0133] Lane 4: 1.6u / ul polymerase;

[0134] according to Figure 2 d shows the result. The final concentration of BST 2.0WarmStart polymerase in the subsequent PER system was selected to be 0.8u / ul.

[0135] 3. Hairpin concentration optimization:

[0136] After completing the feasibility verification of PER and optimizing the concentration of hairpin1 and polymerase, PER was purified and quantified. While other reaction conditions remained unchanged, the hairpin concentration was changed and the quantified PER product was combined with different concentrations of hairpins H1-1 and H2-1 to prepare ZH1 ( Figure 3 a) and ZH2( Figure 3 b) and characterized by PAGE. Figure 3 As shown in Figures 3a and 3b, the bands change and become more distinct as the hairpin concentration increases. Considering the overall reagent cost, a final hairpin concentration of 2.5 μM was selected.

[0137] 4. To verify that the legged hairpins H1-1 and H2-1 designed on the classic HCR hairpins H1 and H2 can successfully undergo hybridization chain reactions, the feasibility of the HCR-1 system was verified and compared with the classic HCR. The advantages of the ZHCR-1 and HCR-1 systems after integration with the track were compared:

[0138] In order to prove that the legged hairpin bound to the track can undergo hybridization chain reaction, HCR-1 was first compared with HCR, and the PAGE characterization results were shown in Figure 2. Figure 4 As shown in a,

[0139] Lane markers are 20-500 bp DNA markers;

[0140] Lane 1 is H1-1;

[0141] Lane 2 is H2-1;

[0142] Lane 3: H1-1+H2-1;

[0143] Lane 4: H1-1+H2-1+initiator;

[0144] Lane 5 is H1;

[0145] Lane 6 is H2;

[0146] Lane 7 is H1+H2;

[0147] Lane 8 is H1+H2+initiator;

[0148] from Figure 4 As can be seen in a: HCR system, lanes 5 and 6 are H1 and H2 respectively, and lanes 7 and 8 represent the comparison of the absence and presence of the initiator chain, respectively. In the absence of the initiator chain, the two hairpins are stable, while in the presence of the initiator chain, bands are produced. The HCR-1 system sets the same lanes, which also verifies that the legged hairpin can smoothly undergo a hybridization chain reaction. Because the sequence of the legs in the legged hairpin is complementary to the sequence of the PER product, the legged hairpin binds to the PER product, forming a long zipper-like DNA polymer, and the reaction rate is higher than that of the classic HCR.

[0149] After verifying that HCR-1 can be successfully carried out, the hairpins H1-1 and H2-1 with legs are connected to the PER product respectively to verify ZHCR-1. Figure 4 As shown in b, the on-off fluorescence kinetics results show that ZHCR-1 exhibits faster fluorescence quenching and lower fluorescence baseline than HCR-1, which indicates that positioning the free legged hairpin on the track increases the local concentration of the legged hairpin, thereby increasing the reaction rate.

[0150] Next, T bases were added to the legged hairpins H1-1 and H2-1 to avoid tight alignment between the sequences, thereby providing more space for extension during the reaction. To explore whether the distance between the legged hairpin and the track affects the reaction rate, different numbers of T bases (0T, 5T, 10T) were added to the legged hairpin, and different distance groups ZHCR-1-0T, ZHCR-1-5T and ZHCR-1-10T were set up and compared with the kinetics of HCR-1. It can be seen that Figure 4 As shown in c, 4d, the reaction rate is fastest when the distance between the legged hairpin and the track is 5T.

[0151] Based on the optimized distance from the legged hairpin to the track, a 5-T base group was selected for subsequent experiments. Figure 4 (e, 4f) Comparison of three replicate kinetics of ZHCR-1-5T with three replicates of the classic HCR from the off-on perspective reveals that ZHCR-1-5T exhibits a faster reaction rate and higher fluorescence signal. The ZHCR-1-5T group was selected and is hereafter referred to as ZHCR.

[0152] 5. Optimization of ZHCR system conditions

[0153] Having proved the advantages of ZHCR, the following is to optimize the conditions of ZHCR system. First, the signal-to-noise ratio under different hairpin concentration conditions is compared, such as Figure 5As shown in a, with the increase of concentration, the signal-to-noise ratio did not change much. In order to save reagent costs, a final concentration of 200nM was selected. Then the sensitivity of ZHCR was tested, as shown in Figure 5 As shown in b and 5c, different concentrations of the initiator chain were set at 0nM, 0.01nM, 0.1nM, 1nM, 5nM, 10nM, 15nM, 20nM, 30nM, and 50nM, and it was found that there was a linear relationship in the range of 0.01nM to 20nM.

[0154] 6. Feasibility verification of ZHCR detection of miRNA

[0155] After the introduction of the target recognition unit IMB, the feasibility of ZHCR in detecting miR-221 and miR-222 was verified ( Figure 6 a, 6b), and after verifying its feasibility, we explored the fluorescence signal detection under different IMB concentrations. It can be seen that when ≥20nM, the fluorescence signal tends to be stable ( Figure 6 c), as well as the sensitivity (Figure d, e) and linearity (Figure f, g) under different miRNA concentrations, it was found that the miRNA concentration also had a linear relationship in the range of 0.01nM to 20nM. At the same time, the specific detection of different miRNAs (miR-221, miR-222, miR-375, miR-141, miR-146b) when different IMBs (IMB-221, IMB-222, IMB-375, IMB-141, IMB-146b) were also investigated. Figure 7 As shown, the orthogonal specificity results showed that under different IMB conditions, only when the corresponding miRNA was added could the reaction be triggered to produce a fluorescent signal, proving that the system had good specificity.

[0156] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the present invention. Anyone skilled in the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by one of ordinary skill in the art without departing from the spirit and technical principles disclosed herein are intended to be covered by the claims of the present invention.

Claims

1. A composition for detecting miRNA, characterized in that comprising a first component, a second component and a third component; The first component includes a primer; The second component includes a hairpin with legs H1-1 and a hairpin with legs H2-1; The primer generates a linear single-stranded DNA through a primer exchange reaction, wherein the linear single-stranded DNA contains a repeated short DNA sequence; the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H1-1 to form a DNA double-strand ZH1, and the linear single-stranded DNA hybridizes with a plurality of the legged hairpins H2-1 to form a DNA double-strand ZH2; The third component includes a double-stranded DNA IMB; The double-stranded DNA IMB includes a single-stranded DNA IM and a closed strand B, wherein the single-stranded DNA IM includes a priming strand I and a miRNA recognition sequence M; the miRNA recognition sequence M is partially or completely complementary to the nucleotide sequence of the target miRNA; After the miRNA recognition sequence M binds to the target miRNA, the closed strand B in the DNA double strand IMB will fall off, exposing the initiator strand I. The initiator strand I sequentially undergoes an infinite zipper hybridization chain reaction with the DNA double strand ZH2 and the DNA double strand ZH1 to form a long zipper DNA polymer; The nucleotide sequence of the primer is shown in SEQ ID NO.3; The first component further comprises a catalytic hairpin and a cleaning hairpin G, wherein the nucleotide sequence of the catalytic hairpin is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide sequence of the cleaning hairpin G is shown in SEQ ID NO.4; The nucleotide sequence of the linear single-stranded DNA is shown in SEQ ID NO.5; The nucleotide sequence of the legged hairpin H1-1 includes fragment 1, fragment 2, and fragment 3 sequentially connected from the 5' end to the 3' end. The nucleotide sequence of the legged hairpin H2-1 includes fragment 4, fragment 2, and fragment 1 sequentially connected from the 5' end to the 3' end. The nucleotide sequence of fragment 1 includes GTTAAGTTGTGTTAAGTTGT, the nucleotide sequence of fragment 2 includes 0 to 10 consecutive bases T, the nucleotide sequence of fragment 3 includes the nucleotide sequence shown in SEQ ID NO. 6, and the nucleotide sequence of fragment 4 includes the nucleotide sequence shown in SEQ ID NO.

7. The nucleotide sequence of the priming chain I is shown in SEQ ID NO.

19.

2. The composition for detecting miRNA according to claim 1, wherein: The target miRNA is selected from at least one of miR-221, miR-222, miR-375, miR-141 or miR-146b.

3. The composition for detecting miRNA according to claim 1, wherein: The nucleotide sequence of the legged hairpin H1-1 comprises the nucleotide sequence shown in SEQ ID NO.9, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.15 or SEQ ID NO.17; And / or, the nucleotide sequence of the legged hairpin H2-1 contains the nucleotide sequence shown in SEQ ID NO.10, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.16 or SEQ ID NO.

18.

4. The composition for detecting miRNA according to claim 2, wherein: When the target miRNA is miR-221, the nucleotide sequence of the DNA single strand IM is shown as SEQ ID NO.30, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.25; And / or, when the target miRNA is miR-222, the nucleotide sequence of the DNA single strand IM is as shown in SEQ ID NO.31, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.26; And / or, when the target miRNA is miR-375, the nucleotide sequence of the DNA single strand IM is as shown in SEQ ID NO.32, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.27; And / or, when the target miRNA is miR-141, the nucleotide sequence of the DNA single strand IM is as shown in SEQ ID NO.33, and the nucleotide sequence of the closed strand B is as shown in SEQ ID NO.28; And / or, when the target miRNA is miR-146b, the nucleotide sequence of the DNA single strand IM is shown as SEQ ID NO.34, and the nucleotide sequence of the closed strand B is shown as SEQ ID NO.

29.

5. The composition for detecting miRNA according to claim 1, wherein: The first component further comprises at least one of the following ingredients: a buffer, a buffering agent, deoxynucleoside triphosphates, and a DNA polymerase; And / or, the legged hairpins H1-1 and H2-1 are respectively labeled with a fluorescent group and a quenching group, or the legged hairpin H1-1 is labeled with a fluorescent group and a quenching group.

6. A method for constructing a fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction using the composition according to any one of claims 1 to 5, characterized in that: The steps include: (1) constructing a primer exchange reaction system, and subjecting the primers to a primer exchange reaction to generate a linear single-stranded DNA product; (2) incubating the primer exchange reaction product with the legged hairpins H1-1 and H2-1, respectively, to generate double-stranded DNA ZH1 and double-stranded DNA ZH2; (3) The double-stranded DNA ZH1 and the double-stranded DNA ZH2 are incubated with the double-stranded DNA IMB to construct the fluorescent biosensor.

7. The method according to claim 6, characterized in that: The primer exchange reaction process in step (1) includes: the catalytic hairpin and the cleaning hairpin G are first mixed and incubated with DNA polymerase and deoxynucleoside triphosphates, and then the primer is added and incubated continuously to obtain a linear single-stranded DNA product; and / or, in the primer exchange reaction system of step (1), the concentration of the catalytic hairpin is 0.125 μM to 1 μM; and / or, in the primer exchange reaction system of step (1), the concentration of DNA polymerase is 0.2 units / μl to 1.6 units / μl; And / or, in the reaction system of step (2), the concentration of the legged hairpin H1-1 is 0.1 μM to 2.5 μM, and the concentration of the legged hairpin H2-1 is 0.1 μM to 2.5 μM; And / or, in step (3), the concentration of the double-stranded DNA IMB is 10 nM~50 nM.

8. A fluorescent biosensor for miRNA detection based on infinite zipper hybridization chain reaction constructed according to the method according to any one of claims 6 to 7.

9. A miRNA detection method, not for diagnosis or treatment of a disease, characterized in that: Using the composition according to any one of claims 1 to 5, and / or the fluorescent biosensor according to claim 8.

10. Use of the composition according to any one of claims 1 to 5 and / or the method according to claims 6 to 7 and / or the fluorescent biosensor according to claim 8 in the preparation of a miRNA detection reagent.

Images