A molecular marker associated with the standard deviation of pig litter weight and its application
Through whole-genome association analysis and designed primer pairs to detect the SNP site g.47023718G>A polymorphism on chromosome 16 of the pig reference genome Sscrofa11.1, the problem of difficult determination of pig resilience was solved, and early screening of pig breeds with high resilience was achieved, thereby improving breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202510049584.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-13
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-01-13
AI Technical Summary
Existing technology makes it difficult to accurately measure pig resilience, resulting in slow progress in disease-resistant breeding and affecting the economic benefits of the pig farming industry.
Through genome-wide association analysis, the SNP site g.47023718G>A polymorphism on chromosome 16 of the porcine reference genome Sscrofa11.1 was discovered. Primer pairs were designed and a kit was established to detect the standard deviation of litter weight within pigs and screen for pig breeds with high resilience.
It achieves early screening of pigs with high resilience, shortens breeding time, improves the economic benefits of the pig herd, and increases corporate profits.
Smart Images

Figure CN119639922B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology for pig genetic marker screening, and in particular to a molecular marker related to the standard deviation of pig internal litter weight, a detection primer and an application thereof. Background Art
[0002] The standard deviation of pig litter weight within a pig refers to the variation in litter weight at birth across multiple parities. Smaller standard deviations indicate that sows are less susceptible to environmental influences and have higher resilience; larger standard deviations indicate greater environmental influences and lower resilience.
[0003] The question of animal disease resistance involves multiple factors, including genetics, environmental factors, disease resilience, and immune system health. In practice, pig resilience, a disease-resistance trait, is difficult to accurately measure, hindering progress in breeding for disease resistance. Resilience refers to an animal's ability to minimize the effects of a disturbance or quickly return to its pre-disturbance state, encompassing aspects such as resistance and endurance. In recent years, numerous studies have reported on the definition and quantification of resilience, providing a basis for incorporating it into breeding objectives.
[0004] The pig farming industry is greatly affected by epidemic diseases. If the standard deviation of pig litter weight is evaluated through biotechnology and the pig resilience is further evaluated based on the standard deviation, the key SNP sites that affect the standard deviation of pig litter weight can be obtained and added to molecular marker-assisted selection, the genetic improvement of the excellent traits of high pig resilience can be accelerated, the individual stress resistance can be improved, and economic benefits can be increased. Summary of the Invention
[0005] In order to overcome the shortcomings of the existing technology, the primary purpose of the present invention is to provide a molecular marker related to the standard deviation of pig litter weight. This molecular marker is obtained through whole genome association analysis and can significantly affect the size of the standard deviation of pig litter weight, thereby further evaluating the level of pig resilience.
[0006] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular markers.
[0007] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, which comprises the above-mentioned primer pair.
[0008] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.
[0009] A fifth object of the present invention is to provide a method for screening pig breeds with small internal litter weight standard deviation.
[0010] The sixth object of the present invention is to provide a method for genetic improvement of pigs.
[0011] The present invention is achieved in that:
[0012] A molecular marker located on chromosome 16 of the porcine reference genome Sscrofa11.1 and associated with the standard deviation of pig litter weight within the pig. The SNP site of the molecular marker corresponds to the G>A mutation at the 47023718th base from the 5′ end of chromosome 16 of the porcine reference genome Sscrofa11.1 in the GenBank database. The polymorphism of the bases at this site leads to different standard deviations of pig litter weight within the pig, thereby leading to different levels of pig resilience. Specifically, when the single nucleotide at the SNP site is A, the standard deviation of pig litter weight within the pig is small and the pig resilience is high; when the single nucleotide at the SNP site is G, the standard deviation of pig litter weight within the pig is large and the pig resilience is low.
[0013] Preferably, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein M in the sequence is G or A.
[0014] A primer pair for detecting the aforementioned molecular marker comprises an upstream primer U and a downstream primer D, the nucleic acid sequence of which is as follows:
[0015] U (upstream primer): 5'-TCCAAAGCCCTCATAAATGG-3' (SEQ ID No. 2); D (downstream primer): 5'-TCCATCCTCACCCTCTTCTG-3' (SEQ ID No. 3).
[0016] A kit for detecting the aforementioned molecular marker, the kit comprising the aforementioned primer pair.
[0017] The aforementioned molecular markers, primer pairs or kits are used in identifying the standard deviation of litter weight within pigs, screening pig breeds with small standard deviation of litter weight within pigs or pig genetic breeding, and the pigs include Landrace pigs and their synthetic lines.
[0018] A method for identifying the standard deviation of pig litter weight, comprising the following steps: detecting the SNP site of the molecular marker according to claim 1 or 2 on pig chromosome 16, and judging the standard deviation of pig litter weight according to the genotype of the SNP site, when the SNP site is the AA genotype, the standard deviation of pig litter weight is smaller than that of the AG genotype; when the SNP site is the AG genotype, the standard deviation of pig litter weight is smaller than that of the GG genotype; the pig with the AA genotype is the pig reference genome Sscrofa11.1. The pig has an A at the 47023718th base from the 5' end on chromosome 16; the pig with the AG genotype is a pig with an A and G at the 47023718th base from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1; the pig with the GG genotype is a pig with a G at the 47023718th base from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1; the pig reference genome Sscrofa11.1 is the pig reference genome sequence in the GenBank database.
[0019] A method for screening pig breeds with a small internal litter weight standard deviation comprises the following steps: detecting the SNP site of the aforementioned molecular marker on pig chromosome 16, eliminating individuals whose single nucleotide at the SNP site is G, and retaining individuals whose single nucleotide at the SNP site is A as breeding pigs; the pigs include Landrace pigs and their synthetic lines.
[0020] Preferably, the detection method comprises the following steps: (1) extracting genomic DNA of the pig to be tested; (2) using the aforementioned primer pair or the primer pair in the aforementioned kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, performing PCR amplification to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain a sequencing result; (4) determining the genotype based on the sequencing result.
[0021] A method for genetic improvement of pigs, comprising the following steps: determining the aforementioned molecular markers of breeding pigs in a core group of breeding pigs, and making corresponding selections based on the molecular markers: for the subsequent breeding of breeding pigs, breeding pig individuals with the AA or AG genotype at the 47023718th base from the 5′ end on chromosome 16 of the pig reference genome Sscrofa11.1 are selected, and breeding pig individuals with the GG genotype at this point are eliminated, so as to increase the frequency of allele A at this site generation by generation, thereby reducing the standard deviation of litter weight within offspring pigs and improving the resilience of offspring pigs; the pigs include Landrace pigs and their synthetic lines.
[0022] Application of the aforementioned molecular markers, the aforementioned primer pairs and / or any of the aforementioned methods in pig breeding.
[0023] The present invention has the following advantages and effects compared to the prior art:
[0024] The method used in the present invention detects the bases at the g.47023718G>A polymorphic site on chromosome 16 of the porcine reference genome Sscrofa11.1, identifies the genotype of individual pigs, and selects pigs with a smaller internal standard deviation of litter weight and higher resilience. The method provided by the present invention allows for early screening of candidate pigs, reduces breeding costs, and effectively reduces the internal standard deviation of litter weight. This method offers high accuracy, low detection costs, and automated detection, making it highly valuable for pig breeding.
[0025] (1) The present invention detected a significant molecular marker on the nucleotide sequence of chromosome 16 of the pig that was associated with the standard deviation of the pig's litter weight through genome-wide association study (GWAS). The present invention established a molecular marker-assisted selection breeding technology, which improved the breeding process of Landrace pigs and their synthetic lines with small standard deviations of litter weight, adapted to market demand, and contributed to increasing sales profits and improving core competitiveness for enterprises.
[0026] (2) The present invention provides a primer pair and a kit for detecting a SNP molecular marker located on chromosome 16 of pigs and associated with the standard deviation of litter weight within pigs. By using the primer pair and the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits, which can be applied to the genetic improvement of related traits of breeding pigs, thereby improving the excellent qualities of pigs, accelerating the breeding process, and thereby increasing corporate profits and core competitiveness.
[0027] (3) The present invention provides a method for pig breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of the pig herd and shorten the time for improving Landrace pigs, thereby effectively improving the economic benefits of breeding. The present invention can ultimately improve the resilience of commercial pigs and increase economic benefits by optimizing the dominant allele A with a small standard deviation of internal litter weight from individual SNP molecular markers. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is a genome-wide association study (GWAS) analysis of the standard deviation of litter weight within Landrace pigs on chromosome 16;
[0029] Figure 2 This is the standard deviation analysis of litter weight within individual pigs of AA, AG, and GG genotypes;
[0030] Figure 3These are the results of sequence sequencing near the SSC16g.47023718G>A polymorphic site on chromosome 16 of individual pigs with AA, AG and GG genotypes. DETAILED DESCRIPTION
[0031] The present invention will be further described in detail below with reference to specific embodiments and drawings, but the embodiments of the present invention are not limited thereto.
[0032] The pig reference genome sequences in the following examples all refer to Sscrofa11.1.
[0033] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0034] Example 1: Evaluating pig resilience by identifying the standard deviation of litter weight within pigs
[0035] 1. Experimental Animals and Phenotypic Recording
[0036] The experimental pigs used in the present invention are all from the breeding pig group of Chifeng Jiayu Breeding Technology Co., Ltd.
[0037] A total of 1,807 sows from this population were selected for this study. Parity was recorded from 1 to 10, and litter weights were recorded for each parity. The standard deviation of litter weight within each sow was calculated using Equation 1 to assess resilience. All phenotypic data were collected in accordance with the data format requirements of the National Swine Genetic Evaluation Center.
[0038] Formula 1: Where n is the total number of pig parity records, x i is the litter weight of pigs at parity i, It is the average litter weight of pigs.
[0039] 2. Chip SNP Typing
[0040] Ear samples were collected from 1,807 pigs in the above group, ground with liquid nitrogen, and whole-genome DNA was extracted using the standard phenol-chloroform method. The DNA quality of each sample was accurately measured using a Nanodrop 2000 / 2000C nucleic acid protein detector. The qualified DNA samples were sent to Beijing Compson Biotechnology Co., Ltd. for pig whole-genome DNA analysis according to the company's standard procedures. Zhongxin-1Porcine Breeding Chip_V2 (176 heads), Genotyping was performed using the Zhongxin-1 Porcine BreedingChip_plus (1,017 pigs) and CAU50K (614 pigs) chips. All sample chip data were merged and quality-controlled using PLINK software, ultimately generating valid genotype data for 46,358 SNPs. These genotype data were used for genome-wide association studies of standard deviation of litter weight within pigs.
[0041] 3. Genome-wide association analysis
[0042] The pigs were phenotyped and corrected for standard deviations in litter weight within the farm and batch, and breeding values were estimated using ASReml. Association analysis between SNPs and breeding values was performed using GCTA software. The significance threshold for association between SNPs and breeding values was 1.0786 × 10 -6 GWAS analysis results are as follows. Figure 1 As shown. Figure 1 It can be seen that there is a locus on chromosome 16 that significantly affects the standard deviation of pig litter weight. The SNP locus g.47023718G>A is significantly correlated with the standard deviation of pig litter weight (P<2.94×10 -7 ).from Figure 2 Significant phenotype differences were observed between genotypes within the population. The standard deviation of litter uniformity within AA pigs was significantly lower than that within GG pigs (P<0.05), while the standard deviation within litter uniformity within heterozygous AG pigs was intermediate between the two homozygous genotypes. A greater standard deviation of litter uniformity indicates lower resilience, and vice versa. This suggests that this molecular marker significantly influences pig resilience and can be used in marker-assisted selection to improve resilience in this population, thereby accelerating breeding for resilience traits.
[0043] 4. Determination of the polymorphism of the porcine SNP site g.47023718G>A
[0044] (1) Three pig ear samples were used as experimental materials, and genomic DNA was extracted from each of them.
[0045] (2) Primer design and synthesis
[0046] Based on the porcine reference genome Sscrofa11.1 sequence, the following primers were designed and synthesized:
[0047] U (upstream primer): 5′-TCCAAAGCCCTCATAAATGG-3′ (SEQ ID No. 2);
[0048] D (downstream primer): 5'-TCCATCCTCACCCTCTTCTG-3' (SEQ ID No. 3).
[0049] (3) PCR amplification
[0050] The three pig genomic DNAs obtained in step (1) were used as templates and U and D were used as primers for PCR amplification to obtain PCR amplification products, which were named products 1, 2 and 3, respectively.
[0051] PCR amplification system: 100 ng of genomic DNA, 25 μL of Green Taq Mix, 200 nM of upstream and downstream primers, and the system was made up to 50 μL with ddH2O.
[0052] PCR amplification program: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, and extension at 72°C for 60 seconds, for a total of 35 cycles; and final extension at 72°C for 5 minutes.
[0053] Sequencing and sequence analysis
[0054] Products 1, 2, and 3 were sequenced to obtain the sequences of products 1, 2, and 3. The three product sequences differed by only one base, which was a G>A mutation at position 106 from the 5' end. Figure 3 Indicated by the arrow in the middle. This site is located at base 47023718 from the 5′ end of chromosome 16 in the porcine reference genome Sscrofa11.1, and is therefore named SSC16 g.47023718G>A. Sequencing is shown below: The primer-amplified sequence, base 106 is M, which can be either G or A. SEQ ID No. 1:
[0055] TCCAAAGCCCTCATAAATGGTGGGTAAGCCAATATTTATGTCAAAGATTGGGGAAAGTGG
[0056] CATAGCCAGACCACATAAATTTCAAAGGAAAAGAGACTTTTGCATMAGGGTCCAAGAGA
[0057] AATGGTTTAGTGGGACATGAAGAAACACAAACGCCTCCCTTGGCCCAGGGATGTGTAGAA
[0058] TATGAAAGAATGAGCCTCCTTTCCTCCAAAGGGCCACTGAGGAAGCAGGTCCTAAGGAGG
[0059] AATGCATTCAGTGAGAGCTAGGGGGTGAAAAGAAGGTTTTTTAAGAAGTTTAAGATATA
[0060] GAAGAGATCATTTAAAATAGAATGAGGTACGGAGGATGCAGAAGAGGGTGAGGATGGA
[0061] The individual whose base at position 47023718 from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1 or the base at position 106 from the 5' end of the PCR amplification product obtained in step (3) is G is a homozygous individual, and the genotype of this individual is named GG. The individual whose base at position 47023718 from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1 or the base at position 106 from the 5' end of the PCR amplification product obtained in step (3) is A is a homozygous individual, and the genotype of this individual is named AA. The individual whose base at position 47023718 from the 5' end on chromosome 16 of the pig reference genome Sscrofa11.1 or the base at position 106 from the 5' end of the PCR amplification product obtained in step (3) is G and A is a heterozygous individual, and the genotype of this individual is named GA.
[0062] The present invention provides a SNP molecular marker that can significantly reduce the standard deviation of pig litter weight. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of Landrace pigs with high resilience. The standard deviation of pig litter weight within the AA type individual is 2.79kg, and the standard deviation of pig litter weight within the GG type individual is 4.38kg. AA type individuals are significantly smaller than GG type individuals. If the present invention selects all GG type individuals into AA type individuals, the resilience of the pig herd will be significantly improved, and the potential for economic benefits of a large-scale pig farm with 10,000 heads is huge. Among the individuals of this SNP molecular marker, by optimizing the dominant allele A of this SNP, it is ultimately possible to improve the economic benefits of commercial pigs, thereby increasing the profits of the enterprise.
[0063] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. The use of molecular markers related to the standard deviation of litter weight within Landrace pigs, characterized in that: The application is any one of the following A1 to A4: A1) Identify the standard deviation of litter weight and resilience within Landrace pigs; A2) Selecting Landrace pig breeds with low standard deviation in litter weight and high resilience; A3) Landrace genetics and breeding; A4) Preparation of a kit for detecting molecular markers related to standard deviation of litter weight within Landrace pigs; The nucleotide sequence of the molecular marker is shown in SEQ ID NO:
1. The SNP site is located at the 106th bp of sequence 1. The nucleotide type of the SNP site is G or A. The genotype of the SNP site is related to the standard deviation of litter weight and resilience of Landrace pigs.
2. A method for identifying the standard deviation of litter weight within Landrace pigs, characterized in that: The following steps are included: S1 extracts the pig genomic DNA to be tested as a template; S2 designed primers targeting the 106 bp site of the DNA molecule shown in SEQ ID NO.1 and performed PCR amplification; S3 detects the genotype of the 106 bp site of the pig sequence SEQ ID NO.1 to be tested; S4 The SNP site genotype obtained in step S3 is used to determine the standard deviation of the litter weight of the pigs to be tested. When the SNP site is the AA genotype, the standard deviation of the litter weight of the pigs is smaller than that of the AG genotype, and the resilience is higher than that of the AG genotype; when the SNP site is the AG genotype, the standard deviation of the litter weight of the pigs is smaller than that of the GG genotype, and the resilience is higher than that of the AG genotype.
3. The method according to claim 2, characterized in that The sequences of the primers in step S2 are shown as SEQ ID NO. 2 and SEQ ID NO.
3.
4. A method for breeding a Landrace pig breed with a small internal litter weight standard deviation and high resilience, characterized in that: The following steps are involved: The genotype at base position 47023718 from the 5' end on chromosome 16 of the tested pig is detected, and the tested pig with the AA genotype is selected as a parent for breeding. The AA genotype is the homozygous type with A at the 106th bp of the SEQ ID NO.1 sequence; the breeding pig individuals with the GG genotype are eliminated to gradually increase the frequency of allele A, thereby reducing the standard deviation of litter weight within the offspring pigs and improving the resilience of the offspring pigs. The reference genome of the Landrace pig is Sscrofa11.1.