A SNP site for identifying or assisting in identifying paris polyphylla var. chingii, a KASP primer group and application thereof

Abstract

The application discloses a SNP site for identifying or assisting in identifying Parthenocissus henryana, a KASP primer group and application thereof. The SNP site is located at the 2688th position of SEQ ID No. 1. The KASP primer group is composed of single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4. The application performs second-generation sequencing and assembly on Parthenocissus henryana for the first time, forms an ultralong scaffold as a reference genome ultralong fragment, then performs simplified genome sequencing on 15 kinds of Parthenocissus plants and carries out alignment with the reference genome ultralong fragment, obtains a difference site, and finally develops a KASP molecular marker CA24547 based on the difference site and verifies the KASP molecular marker. The KASP molecular marker developed in the application can realize accurate identification of Parthenocissus henryana at a seedling stage, and has important significance for protecting Parthenocissus henryana.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, and particularly relates to a SNP site for identifying or assisting in identifying Clematis acerifolia, a KASP primer set and application thereof. BACKGROUND

[0002] There are many plants in the genus Clematis, and Clematis acerifolia Maxim. is one of them. The plant is small in size, and the flowers are elegant. Every April, it blooms on the cliffs in Fangshan and Mentougou, Beijing, becoming a unique and beautiful landscape. As a unique germplasm resource in China, Clematis acerifolia has high ornamental value, a narrow distribution area, and a small population, and has been listed as a national second-class protected plant. It is also an extremely rare ornamental plant in early spring.

[0003] KASP (Competitive Allele-Specific PCR) is an allelic typing technology, which has the characteristics of high accuracy, low cost and convenient operation. As a SNP (Single Nucleotide Polymorphism) typing method, KASP-SNP markers are widely used in species identification and classification, and have good application effect. There are many plants in the genus Clematis, and the development of general KASP-SNP molecular markers for Clematis plants is of great significance for studying the evolution rules and species classification of different species in the genus. However, there is no report on whole genome sequencing of Clematis plants at present, and the efficiency of molecular marker development is not high due to the lack of reference genome. SUMMARY

[0004] An object of the present application is to provide a new use of a substance for detecting the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 in a plant to be tested.

[0005] The present application provides the use of a substance for detecting the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 in a plant to be tested in identifying or assisting in identifying Clematis acerifolia.

[0006] The present application also provides the use of a substance for detecting the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 in a plant to be tested in preparing a product for identifying or assisting in identifying Clematis acerifolia.

[0007] The present application also provides the use of a substance for detecting the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 in a plant to be tested in distinguishing or assisting in distinguishing Clematis acerifolia from other plants in the genus Clematis.

[0008] The application also provides a use of a substance for detecting the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 of a plant to be tested in the preparation of a product for distinguishing or assisting in distinguishing Tetracentrum sinense from other plants in the genus Tetracentrum.

[0009] Another object of the application is to provide a method for distinguishing or assisting in distinguishing Tetracentrum sinense from other plants in the genus Tetracentrum.

[0010] The method for distinguishing or assisting in distinguishing Tetracentrum sinense from other plants in the genus Tetracentrum provided by the application is to detect whether the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 of a plant to be tested is CC or TT, and determine whether the plant to be tested is Tetracentrum sinense or other plants in the genus Tetracentrum according to the genotype of the plant to be tested: if the genotype of the plant to be tested is CC, the plant to be tested is or is a candidate for Tetracentrum sinense; if the genotype of the plant to be tested is TT, the plant to be tested is or is a candidate for other plants in the genus Tetracentrum.

[0011] The CC genotype is a homozygote in which the deoxyribonucleotide at position 2688 of SEQ ID No. 1 is C.

[0012] The TT genotype is a homozygote in which the deoxyribonucleotide at position 2688 of SEQ ID No. 1 is T.

[0013] In the above method, the method for detecting whether the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 of a plant to be tested is CC or TT comprises the following steps: using the genomic DNA of the plant to be tested as a template, performing PCR amplification with a KASP primer set, performing fluorescence signal scanning on the obtained amplification product, and determining whether the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 of the plant to be tested is CC or TT according to the fluorescence signal.

[0014] In some embodiments, the KASP primer set consists of forward primer F1, forward primer F2, and reverse primer R.

[0015] In some embodiments, the PCR amplification system is as follows: DNA 1 uL, PCR mix 2.5 uL, primer mixture solution 0.025 uL, and ddH2O is used to make up the system volume to 5 uL. In the primer mixture solution, the primers consist of forward primer F1, forward primer F2, and reverse primer R, and the molar ratio of the forward primer F1, the forward primer F2, and the reverse primer R is 1:1:2.

[0016] Further, the final concentration of the forward primer F1 in the PCR amplification system is 1.25 x 10 -71.25 x 10-6 mol / L, the final concentration of the forward primer F2 in the PCR amplification system is 1.25 x 10-6 mol / L, and the final concentration of the reverse primer R in the PCR amplification system is 2.5 x 10-6 mol / L. -7 1.25 x 10-6 mol / L, the final concentration of the forward primer F2 in the PCR amplification system is 1.25 x 10-6 mol / L, and the final concentration of the reverse primer R in the PCR amplification system is 2.5 x 10-6 mol / L. -7

[0017] In some embodiments, the PCR amplification program is as follows: a first stage of denaturation at 96℃ for 10 min; a second stage of denaturation at 96℃ for 20 s, annealing at 65℃ for 10 s, for a total of 10 cycles (from the 2nd cycle, each cycle is reduced by 0.5℃); and a third stage of denaturation at 96℃ for 20 s, 56℃ for 10 s, for a total of 30 cycles.

[0018] In some embodiments, the PCR amplification is performed in an Eppendorf PCR instrument, and the fluorescent signal is read after the reaction is completed using an Omega fluorescent scanner.

[0019] In some embodiments, the method for determining whether the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 of the plant to be tested is CC or TT according to the fluorescent signal is as follows: if the fluorescent signal is blue, the genotype of the plant to be tested is CC; and if the fluorescent signal is red, the genotype of the plant to be tested is TT.

[0020] Another object of the present application is to provide a KASP primer set for identifying Aceriphyllum or distinguishing Aceriphyllum from other plants in the genus Tetracentron.

[0021] The KASP primer set for identifying Aceriphyllum or distinguishing Aceriphyllum from other plants in the genus Tetracentron provided by the present application is composed of a forward primer F1, a forward primer F2, and a reverse primer R.

[0022] Any of the above-mentioned forward primer F1 is as follows a1) or a2):

[0023] a1) a single-stranded DNA molecule as shown in SEQ ID No. 2;

[0024] a2) a single-stranded DNA molecule obtained by substituting and / or deleting and / or adding one or more nucleotides from SEQ ID No. 2 and having the same function as SEQ ID No. 2;

[0025] Any of the above-mentioned forward primer F2 is as follows a3) or a4):

[0026] a3) a single-stranded DNA molecule as shown in SEQ ID No. 3;

[0027] ​a4) a single-stranded DNA molecule of SEQ ID No. 3 with one or several substitutions and / or deletions and / or additions of nucleotides and having the same function as SEQ ID No. 3;

[0028] Any of the above reverse primers R is as follows a5) or a6):

[0029] a5) a single-stranded DNA molecule of SEQ ID No. 4;

[0030] a6) a single-stranded DNA molecule of SEQ ID No. 4 with one or several substitutions and / or deletions and / or additions of nucleotides and having the same function as SEQ ID No. 4.

[0031] A last object of the present application is to provide a kit for identifying A. × leucophaeopsis or distinguishing A. × leucophaeopsis from other Clematis plants.

[0032] The kit for identifying A. × leucophaeopsis or distinguishing A. × leucophaeopsis from other Clematis plants provided by the present application contains the above KASP primer set.

[0033] In some embodiments, the kit further comprises other reagents for PCR amplification, such as PCR mix.

[0034] In some embodiments, the kit further comprises a negative control (such as sterile ultrapure water) and a positive control (such as genomic DNA of A. × leucophaeopsis).

[0035] The use of the above KASP primer set or the above kit in identifying or assisting in identifying A. × leucophaeopsis also belongs to the protection scope of the present application.

[0036] The use of the above KASP primer set or the above kit in preparing a product for identifying or assisting in identifying A. × leucophaeopsis also belongs to the protection scope of the present application.

[0037] The use of the above KASP primer set or the above kit in distinguishing or assisting in distinguishing A. × leucophaeopsis from other Clematis plants also belongs to the protection scope of the present application.

[0038] The use of the above KASP primer set or the above kit in preparing a product for distinguishing or assisting in distinguishing A. × leucophaeopsis from other Clematis plants also belongs to the protection scope of the present application.

[0039] Any of the above other Clematis plants is C. integrifolia and / or C. wushensis and / or C. fluminensis and / or C. chekiangensis and / or C. marmorata and / or C. asperula and / or C. brevicaudata and / or C. brevicaudata and / or C. macrophylla and / or C. semicordata and / or C. terniflora and / or C. fluminensis and / or C. fluminensis.

[0040] The present application firstly performs second-generation sequencing and assembly on the plant Clematis Henryi of the genus Clematis, forms super-long scaffolds as reference genome super-long fragments, then performs simplified genome sequencing on 15 plants of the genus Clematis and performs alignment with the reference genome super-long fragments, obtains difference sites, and finally develops the KASP molecular marker CA24547 which can be used for distinguishing Clematis Henryi from other 14 plants of the genus Clematis based on the difference sites and verifies it. The KASP molecular marker CA24547 developed in the present application can realize accurate identification of Clematis Henryi at the seedling stage, which has important significance for protecting Clematis Henryi. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 Figure 4 is the KASP marker detection results of 15 plants of the genus Clematis. Among them, the yellow box represents Clematis Henryi, the blue box represents CC (Clematis Henryi), the green box represents other 14 Clematis plants, and the red box represents TT (other plants of the genus Clematis). Control No. 2, control No. 7 and control No. 24 are Wu Xing Clematis, Ranunculus Clematis and Clematis Henryi samples for simplified genome sequencing, respectively, as positive controls. From the control results, the KASP detection results are consistent with the simplified genome sequencing results; the primer can distinguish Clematis Henryi from other 14 plants of the genus Clematis.

[0042] Figure 2 Figure 5 is the query results of the super-long fragment sequence in NCBI.

[0043] Figure 3 Figure 6 is the query results of the simplified genome sequencing data in NCBI. DETAILED DESCRIPTION

[0044] The present application will be further described in detail below in conjunction with specific embodiments. The examples provided below are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.

[0045] The experimental methods in the following examples are all conventional methods, unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0046] The Clematis fruticosa in the following examples is described in the literature "Yuan L, Huang W Z, Liang D Q, et al. Studies on flavonoid glycosides from Clematis fruticosa [J]. Chinese Pharmaceutical Journal, 2015, 50(06): 497-501."

[0047] Clematis henryana in the following example is recorded in the literature "Mingjian Chen, Shuan Wang, Peng Wang, et al. Chromosome Karyotype Analysis of Clematis Sect. (Clematis) Plants [J]. Journal of Plant Resources and Environment, 2024, 33(02): 99-105."

[0048] Clematis grata in the following example is recorded in the literature "Xiaoting Na. Propagation Technology of Clematis grata [J]. China's Forest and By-product Specialties, 2017, (04): 68-69."

[0049] Clematis finetiana in the following example is recorded in the literature "Bing Yu, Zhen-Sheng Yao. Medicinal Plant Resources of Clematis in Zhejiang Province [J]. Jiangxi Sciences, 2006, (01): 89-92."

[0050] Clematis farinosa in the following example is recorded in the literature "Rolan Wang, Dequan Zhang. Analysis of Chloroplast Genome and Phylogenetic Analysis of Clematis farinosa [J]. Journal of Jishou University (Natural Science Edition), 2024, 45(01): 66-76."

[0051] Clematis dentata in the following example is recorded in the literature "Wen Zhang, Hongmei Zhang, Long Song. Analysis of Volatile Oil Chemical Components of Clematis dentata [J]. Medical Information (Mid-month Edition), 2011, 24(03): 1211-1212."

[0052] Clematis campaniflora in the following example is recorded in the literature "Qiang Zhang, Likun Zhang, Lei Jiang, et al. Characteristics of Typical Community Structure and Species Diversity in Baihu Mountain Nature Reserve [J]. Journal of Beijing Normal University (Natural Science Edition), 2020, 56(01): 122-131."

[0053] Clematis brevicaulis in the following example is recorded in the literature "Mingjian Chen, Shuan Wang, Peng Wang, et al. Chromosome Karyotype Analysis of Clematis Sect. (Clematis) Plants [J]. Journal of Plant Resources and Environment, 2024, 33(02): 99-105."

[0054] Clematis brevicaulis in the following example is recorded in the literature "Dong Lin, Zhaoyang Feng, Shihai Lv, et al. Study on Chlorophyll Fluorescence Characteristics of Clematis brevicaulis [J]. Acta Botanica Boreali-Occidentalia Sinica, 2008, (11): 2299-2305."

[0055] Clematis chelidonifolia in the following example is recorded in the literature "Yi Yang, Na Wang, Kui-ling Wang, et al. Megasporogenesis and Development of Male and Female Gametophytes in Clematis chelidonifolia [J]. Acta Botanica Sinica, 2019, 54(05): 596-605."

[0056] Clematis ternifolia in the following examples is recorded in the literature " Tian Xiaolin. Study on insecticidal active ingredients of Clematis ternifolia [D]. Northwest A&F University, 2019."

[0057] Clematis armandi in the following examples is recorded in the literature "Li Yongmei, Zhu Zhu, Song Zhanbang. Phenotypic analysis of wild Clematis armandi seeds in arid areas [J]. Land and Natural Resources Research, 2024(3): 72-78."

[0058] Clematis chrysocoma in the following examples is recorded in the literature "Liu Zhijie, Zheng Yan, Niu Weikang, et al. Induction and identification of polyploidy in two wild Clematis species [J]. North Horticulture, 2022."

[0059] Clematis pectinata in the following examples is recorded in the literature "Shi Jinghua. Preliminary study on the origin of Clematis pectinata hybridization [D]. Institute of Botany, Chinese Academy of Sciences [2024-11-05]."

[0060] Clematis acerifolia in the following examples is recorded in the literature "Pang Jushuai, Yuan Yangchen, Zhou Miaomiao, et al. Study on the ecological niche of Clematis acerifolia Maxim. community species [J]. Acta Ecologica Sinica, 2022(042-008)."

[0061] The picking license number of Clematis acerifolia sample in the following examples is 11BJ20230421000063.

[0062] Example 1, obtaining of SNP site and development of KASP molecular marker CA24547

[0063] I. Obtaining of SNP site

[0064] 1. Super long fragment assembly of Clematis acerifolia

[0065] A leaf of Clematis henryi was collected, and DNA was extracted using the CTAB method. After quality detection, the DNA sequence was fragmented into random fragments by ultrasonic wave. The fragmented DNA was subjected to end repair, 3' end A addition, and sequencing adapter ligation in turn. The fragments with a length of about 350 bp were enriched by magnetic bead adsorption, and a sequencing library was formed by PCR amplification. The library was qualified for library quality detection, and sequencing was performed on the Illumina NovaSeqTM platform after passing the quality detection. The sequencing mode was Illumina PE150, and the total sequencing read length was 300 bp. A total of 398G of second-generation sequencing data was obtained. The sequence assembly was performed using the SPAdes genome assembler v3.15.2 software, and the assembled sequence was filtered according to the length. The scaffold with a length of more than 1000 bp was retained as the reference genome super-length fragment of this test, and the accession number of the super-length fragment sequence in NCBI was PRJNA1179677 Figure 2 )。

[0066] 2. Simplified genome sequencing

[0067] GBS sequencing (Genotyping-By-Sequencing) was performed on Clematis henryi, C. wuxingensis, C. trichotoma, C. zhejiangensis, C. ranomafanae, C. asperidens, C. brevicaudata, C. macrophylla, C. semicordata, C. petiolulata, C. heracleifolia, C. frutescens, C. lutea, C. pectinata, and C. henryi. The assembled reference genome super-length fragment of C. henryi was used as a reference for silicon electronic enzyme cutting evaluation and enzyme cutting effect verification to obtain information including enzyme cutting combination, screened fragment size, tag number, and reference genome coverage. The specific steps of GBS sequencing are as follows: sampling was performed at the Clematis Resource Garden of Beijing Municipal Greening Science and Research Institute, and 1 plant of each material was selected to extract the genomic DNA of 15 Clematis species. After quality detection, 0.1-1 ug of DNA was subjected to double enzyme digestion (MseI+TaqaI) test. That is, MseI restriction endonuclease was used for the first enzyme digestion, and Solexa P1 and P2 adapters (containing a 6 bp barcode sequence) were added to the ends of the enzyme-digested fragments. These adapters can recognize the MseI restriction endonuclease site and are complementary to the enzyme-digested end. TaqaI enzyme was used for the second enzyme digestion to adjust the tag number. The sequences containing P1 and P2 adapters on both ends were amplified by PCR, and DNA pooling was performed. The DNA in the required interval was recovered by electrophoresis. Finally, the PCR product was purified using AMPure XP beads, and a GBS library was obtained. After passing the GBS library quality detection, sequencing was performed on the X-plus platform, and the sequencing mode was PE150. The simplified genome sequencing data has the accession number PRJNA1184821 in NCBI.Figure 3 ).

[0068] 3. Obtaining of SNP site

[0069] After the machine, the raw data (Raw_data) is quality controlled using Fastp, and Clean data is obtained. The Clean Data is aligned to the reference genome sequence using BWA-MEME software to obtain the sequence position attribution (i.e. BAM file). The Haplotyper method of the Best Practices process of the GATK software is used for SNP detection, and the filtering conditions are snp and indel filtering conditions: QD < 2.0 || FS > 30.0 || SOR > 3.0 || MQ < 40.0 || MQRankSum < -3.0 || ALT == "*" || ReadPosRankSum < -3.0. The reference genome is compared, and the SNP results of the sample are counted.

[0070] Finally, one SNP site that can distinguish between A. fulgens and other 14 species of the genus Clematis is found, which is located at position 2688 of SEQ ID No. 1, and the polymorphism of the site is C / T, and there are two genotypes of CC and TT.

[0071] Among them, the CC genotype is a homozygote with deoxyribonucleotide C at position 2688 of SEQ ID No. 1; the TT genotype is a homozygote with deoxyribonucleotide T at position 2688 of SEQ ID No. 1.

[0072] II. Development of KASP molecular markers

[0073] According to the SNP site obtained in step one, the sequences of 500 bp upstream and downstream are extracted for the design of KASP molecular markers, and the primer sequences of the finally designed KASP molecular marker CA24547 are as follows (the genotype of the site is [C / T], and when the kasp primer is designed, [C / T] Tcctccccaaatcatacccc becomes ggggtatgatttggggaggA [G / A] after reverse complementation):

[0074] Forward primer F1: 5'- GAAGGTCGGAGTCAACGGATT ggggtatgatttggggaggAA-3' (SEQ ID No. 2);

[0075] Forward primer F2: 5'- GAAGGTGACCAAGTTCATGCT ggggtatgatttggggaggAG-3' (SEQ ID No. 3);

[0076] Reverse primer R: 5'-AccatccttgttTttctcctcaaC-3' (SEQ ID No. 4).

[0077] wherein the sequence underlined in the forward primer F1 is the VIC fluorescent sequence, and the sequence underlined in the forward primer F2 is the FAM fluorescent sequence.

[0078] Example 2, verification of KASP molecular marker CA24547

[0079] 1. Obtaining of test samples

[0080] Select 15 Clematis materials in Table 1, 2-4 plants for each material, extract genomic DNA and perform quality detection.

[0081] Table 1

[0082] Material name Sample number Sample site (the number after indicates the number) Adenocaulon synanthum 3 Laojunshan, Lijiang, Yunnan 1, Dali, Yunnan 1, Kunming, Yunnan 1 Adenocaulon wuxingense 4 Hangzhou, Zhejiang 2, Jinhua, Zhejiang 1, Control No. 2 Adenocaulon tomentosum 3 Dalian, Liaoning 1, Haidian, Beijing 2 Adenocaulon zhejiangense 3 Ningbo, Zhejiang 2, Huangshan, Anhui 1 Adenocaulon chrysanthum 4 Yulong Snow Mountain, Lijiang, Yunnan 1, Guiyang, Guizhou 2, Control No. 7 Adenocaulon crassum 4 Laojunshan, Lijiang, Yunnan 2, Wu'an, Hebei 1, Taiyuan, Shanxi 1 Adenocaulon semitubulosum 3 Mentougou, Beijing 1, Miyun, Beijing 1, Yanqing, Beijing 1 Adenocaulon brevicaule 3 Wuhu, Zhejiang 2, Changping, Beijing 1 Adenocaulon brevicaule 4 Nanyang, Yanchi, Mentougou, Beijing 2, Lingshan Forest Farm, Beijing 2 Adenocaulon grandifolium 4 Mentougou, Beijing 1, Lingshan Forest Farm, Beijing 3 Adenocaulon petiolatum 2 Mentougou, Beijing 1, Songshan, Beijing 1 Adenocaulon fruticosum 3 Yungang, Datong, Shanxi 1, Chicheng, Hebei 2 Adenocaulon chrysanthum 3 Dazhuangke, Yanqing, Beijing 2, Chongli Tunnel, Hebei 1 Adenocaulon pinnatum 4 Huyu North, Changping, Beijing 2, Shenyang, Liaoning 2 Adenocaulon acerifolium 5 Mentougou, Beijing 4, Control No. 24

[0083] Note: Control No. 1, Control No. 7 and Control No. 24 are all samples sequenced in Example 1, serving as positive controls.

[0084] 2. KASP reaction

[0085] The KASP molecular marker CA24547 designed in Example 1 was used to perform KASP reaction on the test samples obtained in step 1, to obtain the genotypes of the test samples.

[0086] KASP reaction system (5uL): 1uL of DNA with a concentration of 30ng / uL, 2.5uL of (2X) PCR mix (LGC company, item number KBS-1050-112), 0.025uL of primer mixture solution (primers) with a concentration of 100umol / L, and ddH2O was used to make up the system volume to 5uL. The primers in the primer mixture solution consisted of forward primer F1, forward primer F2 and reverse primer R, and the molar ratio of forward primer F1, forward primer F2 and reverse primer R was 1:1:2. Among them, the final concentration of forward primer F1 in the KASP reaction system was 1.25x10- 7 mo l / L, the final concentration of forward primer F2 in the KASP reaction system was 1.25x10- 7 mo l / L, and the final concentration of reverse primer R in the KASP reaction system was 2.5x10- 7 mo l / L.

[0087] KASP reaction program: denaturation at 96℃ for 10 m i n; second stage 96°C denaturation 20s, 65°C annealing 10s, 10 cycles in total (from the 2nd cycle, decrease 0.5°C for each cycle); the third stage is 96°C denaturation 20s, 56°C 10s, 30 cycles in total.

[0088] The KASP reaction is carried out in an Eppendorf PCR instrument (Eppendorf, model Mastercycler X50), and after the reaction, the fluorescence signal is read by using an Omega fluorescence scanner (LGC, model Omega F).

[0089] 3. Result analysis

[0090] The results are shown in Figure 1 As shown in the figure, the results show that: from the figure, it can be seen that the genotypes of Adenovincetoxicum pedatisectum, A. wuxingense, A. pileatum, A. delavayi, A. hirsutum, A. crassum, A. brevicaule, A. brevicauloides, A. macrophyllum, A. semiclaviculatum, A. petiolatum, A. fruticosum, A. luteum and A. pterosum are TT, and the genotype of A. aceroides is CC. The KASP detection results of control 2, control 7 and control 24 are consistent with the results of simplified genome sequencing. It is indicated that the KASP molecular marker CA24547 of the present application can effectively distinguish A. aceroides from other 14 kinds of plants of the genus Adenovincetoxicum.

[0091] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by using conventional techniques known in the art, which are out of the scope disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. Use of a substance for detecting the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of a plant to be tested in identifying Tetracentron sinense or preparing a product for identifying Tetracentron sinense; The use is to detect whether the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of the plant to be tested is CC or TT, and to determine whether the plant to be tested is Tetracentron sinense or other plants in the genus Tetracentron according to the genotype of the plant to be tested: if the genotype of the plant to be tested is CC genotype, the plant to be tested is Tetracentron sinense; if the genotype of the plant to be tested is TT genotype, the plant to be tested is not Tetracentron sinense; The CC genotype is a homozygote in which the deoxyribonucleotide at position 2680 of SEQ ID No. 1 is C; The TT genotype is a homozygote in which the deoxyribonucleotide at position 2680 of SEQ ID No. 1 is T.

2. Use of a substance for detecting the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of a plant to be tested in distinguishing Tetracentron sinense from other plants in the genus Tetracentron or preparing a product for distinguishing Tetracentron sinense from other plants in the genus Tetracentron; The use is to detect whether the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of the plant to be tested is CC or TT, and to determine whether the plant to be tested is Tetracentron sinense or other plants in the genus Tetracentron according to the genotype of the plant to be tested: if the genotype of the plant to be tested is CC genotype, the plant to be tested is Tetracentron sinense; if the genotype of the plant to be tested is TT genotype, the plant to be tested is other plants in the genus Tetracentron; The CC genotype is a homozygote in which the deoxyribonucleotide at position 2680 of SEQ ID No. 1 is C; The TT genotype is a homozygote in which the deoxyribonucleotide at position 2680 of SEQ ID No. 1 is T.

3. A method for distinguishing Tetracentron sinense from other plants in the genus Tetracentron, which comprises detecting whether the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of a plant to be tested is CC or TT, and determining whether the plant to be tested is Tetracentron sinense or other plants in the genus Tetracentron according to the genotype of the plant to be tested: if the genotype of the plant to be tested is CC genotype, the plant to be tested is Tetracentron sinense; if the genotype of the plant to be tested is TT genotype, the plant to be tested is other plants in the genus Tetracentron; The CC genotype is a homozygote in which the deoxyribonucleotide at position 2680 of SEQ ID No. 1 is C; The TT genotype is a homozygote in which the deoxyribonucleotide at position 2680 of SEQ ID No. 1 is T.

4. The method of claim 3, wherein: The method for detecting whether the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of a plant to be tested is CC or TT comprises the following steps: using the genomic DNA of the plant to be tested as a template, performing PCR amplification with a KASP primer set, performing fluorescence signal scanning on the obtained amplification product, and determining whether the genotype of deoxyribonucleotide at position 2680 of SEQ ID No. 1 of the plant to be tested is CC or TT according to the fluorescence signal.

5. The method of claim 4, wherein: The KASP primer set consists of forward primer F1, forward primer F2 and reverse primer R. The forward primer F1 is the single-stranded DNA molecule shown in SEQ ID No. 2; The forward primer F2 is the single-stranded DNA molecule shown in SEQ ID No. 3; The reverse primer R is a single-stranded DNA molecule as shown in SEQ ID No.

4.

6. The method of claim 3, wherein: The other Clematis species mentioned are Clematis stalkae and / or Clematis wuxingensis and / or Clematis pubescens and / or Clematis zebrina and / or Clematis zebrina zebrina and / or Clematis breviscara and / or Clematis serrulata and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara.

7. The application of the KASP primer set or a kit containing the KASP primer set in the identification of Clematis macrantha or the preparation of products for identifying Clematis macrantha; The KASP primer set consists of forward primer F1, forward primer F2, and reverse primer R; The forward primer F1 is the single-stranded DNA molecule shown in SEQ ID No. 2; The forward primer F2 is the single-stranded DNA molecule shown in SEQ ID No. 3; The reverse primer R is a single-stranded DNA molecule as shown in SEQ ID No.

4.

8. The application of the KASP primer set or a kit containing the KASP primer set in distinguishing *Clematis macrantha* from other *Clematis* species or in preparing products that distinguish *Clematis macrantha* from other *Clematis* species; The KASP primer set consists of forward primer F1, forward primer F2, and reverse primer R; The forward primer F1 is the single-stranded DNA molecule shown in SEQ ID No. 2; The forward primer F2 is the single-stranded DNA molecule shown in SEQ ID No. 3; The reverse primer R is a single-stranded DNA molecule as shown in SEQ ID No.

4.

9. Use according to claim 8, characterized in that: The other Clematis species mentioned are Clematis stalkae and / or Clematis wuxingensis and / or Clematis pubescens and / or Clematis zebrina and / or Clematis zebrina zebrina and / or Clematis breviscara and / or Clematis serrulata and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara.

Images