A highly effective wheat stripe rust resistance locus and its development of a kasp marker

By developing the KASP marker KASP-7BL-YR for QTL QYR.GAAS-7BL on wheat chromosome 7B, the problem of easy failure of wheat stripe rust resistance genes was solved, enabling efficient screening and identification and improving breeding efficiency.

CN119639953BActive Publication Date: 2026-02-06WHEAT RES INST GANSU ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510099990.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2026-02-06
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

In existing technologies, wheat stripe rust resistance genes are prone to losing their resistance, and the number of effective genes is limited, making it difficult to identify and utilize them efficiently, which affects the efficiency of wheat breeding.

Method used

A KASP molecular marker, KASP-7BL-YR, based on the QTL QYR.GAAS-7BL at 714.2MB of wheat chromosome 7B was developed. KASP marker technology was used to efficiently identify wheat resistance to stripe rust, and combined with PCR primers and kits for rapid screening and breeding assistance.

Benefits of technology

This technology enables rapid and accurate screening and identification of wheat stripe rust resistance traits, providing a new breeding tool and improving the efficiency of wheat stripe rust resistance breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005253920370000051
    Figure BDA0005253920370000051
  • Figure BDA0005253920370000061
    Figure BDA0005253920370000061
  • Figure BDA0005253920370000071
    Figure BDA0005253920370000071
Patent Text Reader

Abstract

The application discloses a high-efficiency wheat stripe rust resistance site and a KASP marker developed by the same. Specifically disclosed are a molecular marker (SEQ ID NO: 4) for identifying or assisting in identifying a wheat stripe rust resistance trait, and a primer composition for amplifying or detecting the KASP molecular marker. The application also discloses a method for identifying or assisting in identifying a wheat stripe rust resistance trait. Experiments show that the molecular marker and the detection primer thereof can be used for quickly and accurately screening wheat with the stripe rust resistance trait, and can be applied to identifying, assisting in identifying wheat with the stripe rust resistance trait, and wheat stripe rust resistance molecular marker assisted breeding. The molecular marker and the primer thereof developed by the application are closely linked to the wheat stripe rust resistance gene QTL, and provide a good tool for wheat stripe rust resistance molecular marker assisted breeding, and play an important role in wheat stripe rust resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to a high-efficiency wheat stripe rust resistance site and a KASP marker developed therefrom, in particular to identification of a newly discovered wheat stripe rust resistance QTL (Quantitative Trait Locus) and application of a linked KASP (Kompetitive Allele-Specific PCR) marker thereof. BACKGROUND

[0002] Wheat stripe rust is a kind of air-borne fungal disease caused by Puccinia striiformis West.f.sp.tritici (Pst) and mainly invades wheat leaves, but also invades wheat leaf sheaths, spikes, stems, chaffs and almost all above-ground vegetative organs. In China, almost all wheat production areas are threatened by wheat stripe rust except for spring wheat in the northeast. In history, these areas have experienced several large-scale outbreaks of wheat stripe rust, which has brought great losses to economy and yield. Controlling wheat stripe rust outbreak has always been a difficult task. Chemical control can reduce the losses caused by stripe rust, but the cost is high and long-term use can pollute the environment. Therefore, cultivating wheat varieties resistant to stripe rust is considered to be the most economical, safe and effective strategy.

[0003] In recent years, 89 stripe rust resistance genes have been reported to be distributed on 20 chromosomes except for chromosome 1A. In addition, more than 300 quantitative trait loci (QTL) of adult plant resistance to stripe rust have been identified, and the most are resistance loci in the B genome. Due to the rapid variation of wheat stripe rust, resistance genes are easy to lose resistance, and some genes may be linked to undesirable traits. Therefore, the number of effective genes that can be used for wheat stripe rust resistance improvement is relatively limited. Therefore, it is of great significance to find new resistance genes (QTL) to stripe rust and develop molecular markers associated therewith for breeding. At present, KASP (Kompetitive Allele Specific PCR) marker technology has been widely used in SNP site detection of wheat, rice, corn and other crops. The electrophoresis step is omitted, and high-throughput genotyping is realized. Using the genotype data generated by wheat SNP chip, combined with QTL mapping and genome-wide association study (GWAS), the relevant SNPs can be converted into KASP markers and directly used for molecular marker-assisted breeding to improve breeding efficiency. SUMMARY

[0004] The technical problem to be solved by the present application is how to identify or assist in identifying wheat resistance to stripe rust traits. The technical problem to be solved is not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0005] To solve the above technical problems, the present application first provides a molecular marker for identifying or assisting in identifying wheat resistance to stripe rust traits, and the nucleotide sequence of the molecular marker can be SEQ ID NO: 4.

[0006] The molecular marker can be a KASP molecular marker for screening wheat stripe rust resistance gene QTL, and the name can be KASP-7BL-YR.

[0007] The wheat stripe rust resistance gene QTL is located at 714.2MB of 7B chromosome, named QYR.GAAS-7BL, and can explain 11.8%-44.2% of the phenotypic variation.

[0008] The KASP molecular marker Kasp-7BL-YR is developed based on a SNP site, and the genomic position of the SNP site is 713988566bp on wheat 7B chromosome, and the polymorphism of the SNP site is A or C. The physical position of the SNP site is determined based on the version number of the whole genome sequence of the wheat iwgsc refseqv2.1

[0009] The nucleotide (m) at position 51 of the KASP molecular marker KASP-7BL-YR (SEQ ID NO: 4) is A or C.

[0010] The present application also provides a PCR primer, which can be a primer composition for amplifying or detecting the molecular marker.

[0011] Further, the primer composition includes a forward primer A with a nucleotide sequence of SEQ ID NO: 1 at positions 22-45, a forward primer B with a nucleotide sequence of SEQ ID NO: 2 at positions 22-46, and a reverse primer C with a nucleotide sequence of SEQ ID NO: 3.

[0012] Further, the 5' end of the forward primer A and the forward primer B can be connected to different fluorescent label sequences.

[0013] Further, the fluorescent label sequence can be combined with a specific fluorescent dye (such as FAM, HEX, VIC).

[0014] Further, the fluorescent tag sequence can be a FAM fluorescent tag sequence (positions 1-21 of SEQ ID NO: 1) and a HEX fluorescent tag sequence (positions 1-21 of SEQ ID NO: 2).

[0015] Further, the primer composition comprises a forward primer A with a nucleotide sequence of SEQ ID NO: 1, a forward primer B with a nucleotide sequence of SEQ ID NO: 2, and a reverse primer C with a nucleotide sequence of SEQ ID NO: 3.

[0016] The present application also provides a kit for identifying or assisting in identifying a wheat stripe rust resistance trait, the kit comprising the PCR primer of any one described herein.

[0017] Further, the kit can further comprise reagents required for KASP (Kompetitive Allele-Specific PCR) detection.

[0018] Further, the kit can further comprise one or more of a nucleic acid extraction reagent, a DNA polymerase (such as Taq DNA polymerase, Tth DNA polymerase, Vent DNA polymerase, and Pfu DNA polymerase, etc.), dNTPs, a Mg 2+ solution (such as MgSO4or MgCl2solution), a PCR buffer (such as Tris-HCl).

[0019] The nucleic acid extraction reagent is well known to those skilled in the art and is used to extract nucleic acid from a sample to be tested. For example, the nucleic acid extraction reagent can comprise a lysis solution (such as any one or more of guanidine isothiocyanate, guanidine hydrochloride, and trisodium citrate), lysozyme, proteinase K, a washing solution (such as ethanol and / or guanidinium salt), and / or an elution solution (such as TE buffer), etc.

[0020] The various reagent components of the kit can be present in separate containers, or can be pre-combined, in whole or in part, into a reagent mixture.

[0021] The components of the kit can be provided in solution, for example, in the form of an aqueous solution. In the case of being present in an aqueous solution, the concentration or content of these components can be readily determined by those skilled in the art according to different needs. For example, for the purpose of storage, the components can be present in a higher concentration, and when in working condition or in use, the concentration can be reduced to a working concentration by diluting the above-mentioned solution with a higher concentration.

[0022] Further, the kit can further comprise a readable carrier containing a protocol for detecting multiple microorganisms simultaneously. The readable carrier can be a kit instruction (e.g., a printed instruction) for practicing the method of the present application or a computer readable medium (e.g., a floppy disk, a CD, etc.) on which information has been recorded.

[0023] The present application also provides use of the molecular marker, the PCR primer or the kit as described in any of the above in any of the following:

[0024] A1) use in identifying or assisting in identifying a wheat stripe rust resistance trait;

[0025] A2) use in screening or assisting in screening a wheat with a stripe rust resistance;

[0026] A3) use in a molecular marker assisted breeding of a wheat with a stripe rust resistance.

[0027] The present application also provides use of the PCR primer as described in any of the above in preparing a product with at least one of the following functions:

[0028] B1) detecting the molecular marker;

[0029] B2) identifying or assisting in identifying a wheat stripe rust resistance trait;

[0030] B3) screening or assisting in screening a wheat with a stripe rust resistance;

[0031] B4) use in a molecular marker assisted breeding of a wheat with a stripe rust resistance.

[0032] The present application also provides a method for identifying or assisting in identifying a wheat stripe rust resistance trait, the method comprising the following steps:

[0033] C1) performing PCR amplification using the PCR primer as described in any of the above with a wheat genomic DNA as a template to obtain a PCR product and collecting a fluorescent signal;

[0034] C2) determining a genotype of the wheat to be tested according to the fluorescent signal and identifying or assisting in identifying a wheat stripe rust resistance trait according to the genotype.

[0035] In the above method, identifying or assisting in identifying a wheat stripe rust resistance trait according to the genotype can be that a wheat with a genotype of CC has a higher stripe rust resistance than a wheat with a genotype of AA.

[0036] Further, the determination of the genotype of the wheat to be tested can be specifically determining whether the genotype of the wheat to be tested at position 713988566 bp on the 7B chromosome is CC or AA.

[0037] Further, the reaction condition of PCR amplification can be 94℃ 15min; 94℃ 20s, 63-55℃ 1min (decrease 1℃ for each cycle), 10 cycles; 94℃ 20s, 55℃ 60s, 32 cycles.

[0038] Further, the reaction system of PCR amplification can be as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl) per 4 μl reaction system, and the ratio of Primer Mix is as follows: 12% HEX primer, 12% FAM primer, 30% Common primer.

[0039] Further, if the amplification product of the wheat to be tested is separated to the red side, the genotype is CC, and if the amplification product of the wheat to be tested is separated to the blue side, the genotype is AA.

[0040] Funo is originally from Albania, and has good resistance to wheat stripe rust. Its resistance has been maintained for nearly a hundred years, so it is of great significance to analyze the genetic mechanism of Funo resistance and excavate important stripe rust resistance genes. In the present application, a recombinant inbred line (RIL) population including 389 families is constructed by using Funo and Huixunhong. A QTL that stably exists in multiple environments is detected by using a genetic map constructed by a 50K chip to analyze the stripe rust resistance of the RIL population, which is located near 714.0 Mb of chromosome 7B and is named QYR.gaas-7BL, and can explain 14.7%-31.7% of the phenotypic variation. The KASP marker Kasp-7BL-YR developed based on the QTL can be used for molecular marker detection, and provides a new tool for wheat stripe rust resistance breeding.

[0041] Experiments show that the molecular marker Kasp-7BL-YR and the detection primer thereof can be used to quickly and accurately screen wheat with stripe rust resistance, and can be applied to identification and assisted identification of wheat with stripe rust resistance and molecular marker assisted breeding of wheat with stripe rust resistance. The molecular marker tightly linked to the QTL of the wheat stripe rust resistance gene developed in the present application and the primer thereof provide a good tool for molecular marker assisted breeding of wheat with stripe rust resistance, and play an important role in wheat stripe rust resistance breeding. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 The genotyping results of the KASP marker Kasp-7BL-YR on 111 wheat varieties (red is the Funo genotype CC, blue is the Huixunhong genotype AA, and green is the heterozygote AC). DETAILED DESCRIPTION

[0043] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0044] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0045] Example 1, Discovery of a stripe rust resistance gene QTL in wheat material Avena and obtaining of a KASP marker thereof

[0046] I. Obtaining of phenotype

[0047] The Avena / Guixianhong RIL population was planted in Chengdu, Sichuan and Tianshui, Gansu in 2021-2022 and 2023-2024, using a completely randomized block design, three replicates, single row area, row length 1 m, row width 0.3 m, and 30 seeds were uniformly sown in each row. Field management was carried out according to local routine. The RIL population was identified for resistance at the seedling stage using the current prevalent stripe rust mixed strains in China, and the disease index maximum disease severity (MDS) showed continuous change in the field, which was a typical quantitative trait inheritance. The improved CTAB method (Murray et al., 1980) was used to extract 389 family leaf genomic DNA, the DNA concentration was determined by NanoDrop2000c spectrophotometer, and the DNA sample was adjusted to a standard concentration of 50 ng / ul, then the DNA quality was detected by 0.8% agarose gel, and the qualified DNA was subjected to SNP typing. The 12K SNP chip completed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences and Affymetrix Axiom Company was used for SNP analysis.

[0048] II. Construction of linkage map

[0049] After removing markers with heterozygosity between parents and deletion rate greater than 10%, Icimapping V4.1 was used to remove redundant markers, and then the markers were grouped according to the genetic distance and chromosome position information to construct a high-density genetic map.

[0050] III. QTL analysis

[0051] QTL analysis was performed by using IciMapping 4.1 ICIM-ADD method, and the LOD value was selected as 2.5. QYR.gaas-7BL was located on the 7B chromosome, and was located at 714.2 Mb. Under different environmental conditions, it can explain 14.7-31.7% of the phenotypic variation. A KASP marker Kasp-7BL-YR for identifying wheat stripe rust resistance was developed at the position (713.8 Mb), and the genotypes of 111 wheat varieties were detected.

[0052] The KASP marker Kasp-7BL-YR is developed based on a SNP site, and the SNP site is located at 713988566 bp on the 7B chromosome of wheat, and the polymorphism of the SNP site is A or C. The physical position of the SNP site is determined based on the version number of the whole genome sequence of wheat, which is iwgsc refseqv2.1.

[0053] Example 2, development of KASP molecular marker specific primers

[0054] The KASP molecular marker specific primers are designed based on the SNP site found in Example 1, and the sequences are shown in Table 1.

[0055] Table 1, KASP primer sequence table for detecting stripe rust resistance QTL QYR.gaas-7BL

[0056]

[0057] Note: The underlined sequence GAAGGTGACCAAGTTCATGCT is the label sequence A (FAM), and the underlined sequence GAAGGTCGGAGTCAACGGATT is the label sequence B (HEX).

[0058] The SNP flanking sequence developed in the application, i.e. the nucleotide sequence of the KASP molecular marker Kasp-7BL-YR containing the SNP site, is as follows:

[0059] 5'-TTGTCAGAGGCTACACCAGCTTCGGGTGTTTGAGCAATCCAAGAAGGTATmGTCACACAGTAACTCCAGCCT GTTTGAGGGTTATGTGGCCAGACGGTGTT-3'(SEQ ID NO:4).

[0060] The nucleotide (m) at position 51 of SEQ ID NO:4 is A or C.

[0061] Example 3, application of KASP molecular marker Kasp-7BL-YR in identifying wheat stripe rust resistance

[0062] To verify the reliability and accuracy of KASP marker Kasp-7BL-YR, 111 wheat varieties (see Table 2) were selected for verification, and the steps were as follows:

[0063] 111 wheat varieties of different sources were planted in Pixian, Sichuan and Tianshui, Gansu test sites in 2014-2015 and 2015-2016, using a completely randomized block design, three times of repetition, single row area, row length 1 m, row width 0.3 m, each row evenly sowing 30 seeds. Field management was carried out according to local routine. The RIL population was identified for resistance at the seedling stage by using the current popular stripe rust mixed strains in China, and the maximum disease severity (MDS) was recorded. The improved CTAB method was used to extract the genomic DNA of 111 families of young leaves. When the stripe rust severity of the susceptible variety reached 80%, the stripe rust severity of the test material was investigated, and the investigation was carried out every week until the stripe rust stopped, and the maximum data of the investigation was taken as MDA.

[0064] KASP amplification requires HEX, FAM and a reverse common primer (Common). The extracted wheat genomic DNA was used as a template, and primers A (FAM primer, SEQ ID NO: 1), primer B (HEX primer, SEQ ID NO: 2), and primer C (Common primer, SEQ ID NO: 3) were used for PCR amplification. The KASP marker PCR amplification system was as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl), Master Mix was purchased from LGC company, and the ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer. The primers were synthesized by Shanghai Sungene Company. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TMThermal Cycler), and the program was as follows: 94℃ 15min; 94℃ 20s, 63-55℃ 1min (decrease 1℃ for each cycle), 10 cycles; 94℃ 20s, 55℃ 60s, 32 cycles. The PCR amplification product was placed in an automatic focusing fluorescence multifunctional enzyme label instrument (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data was imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0065] The 111 wheat varieties (Table 2) were genotyped, i.e. whether the nucleotide at position 713988566 of chromosome 7B of the wheat genome is A or C, according to the following judgment principle: if the amplification product of the wheat to be tested separates to the red side, the genotype is CC, and if the amplification product of the wheat to be tested separates to the blue side, the genotype is AA.

[0066] The CC genotype indicates that the nucleotide type of the SNP site in the wheat genome is homozygous C; the AA genotype indicates that the nucleotide type of the SNP site in the wheat genome is homozygous A. According to the CC genotype, the wheat variety resistant to stripe rust is obtained.

[0067] All experimental materials were detected by using KASP molecular marker Kasp-7BL-YR. The results are shown in Table 2 and Figure 1 It can be seen that the molecular marker can clearly separate the two genotypes. Among the 111 wheat varieties, 58 varieties show the Af genotype CC (red), and the stripe rust MDS is 37.5; 48 varieties show the Huixunhong genotype AA (blue), and the stripe rust MDS is 43.5; statistical test shows that the genetic effect of Kasp-7BL-YR reaches significant difference (P<0.05).

[0068] Table 2, genotype detection results and stripe rust resistance of 111 wheat varieties

[0069]

[0070]

[0071]

[0072]

[0073] CC is the Af genotype; AA is the Huixunhong genotype.

[0074] Table 3, QYR.caas-7BL 111 natural varieties of stripe rust resistance effect

[0075]

[0076]

[0077] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.

Claims

1. Use of a reagent for detecting a molecular marker in any one of the following: A1) use in identifying a wheat stripe rust resistance trait; A2) use in screening a wheat with a stripe rust resistance; A3) use in molecular marker assisted breeding of a wheat with a stripe rust resistance; the nucleotide sequence of the molecular marker is SEQ ID NO: 4, the nucleotide M at position 51 of the molecular marker is A or C, the genotype is AA, CC or AC, and the wheat with a genotype of CC has a higher stripe rust resistance than the wheat with a genotype of AA.

2. Use of a PCR primer in any one of the following: A1) use in identifying a wheat stripe rust resistance trait; A2) use in screening a wheat with a stripe rust resistance; A3) use in molecular marker assisted breeding of a wheat with a stripe rust resistance; the PCR primer is a primer composition for amplifying or detecting the molecular marker in claim 1, the nucleotide sequence of the molecular marker is SEQ ID NO: 4, the nucleotide M at position 51 of the molecular marker is A or C, the genotype is AA, CC or AC, and the wheat with a genotype of CC has a higher stripe rust resistance than the wheat with a genotype of AA.

3. Use according to claim 2, characterized in that, the primer composition comprises a forward primer A with a nucleotide sequence of SEQ ID NO: 1, a forward primer B with a nucleotide sequence of SEQ ID NO: 2, and a reverse primer C with a nucleotide sequence of SEQ ID NO:

3.

4. Use according to claim 3, characterized in that, the 5' end of the forward primer A and the forward primer B is linked to different fluorescent label sequences.

5. Use according to any one of claims 2 to 4, characterized in that, the primer composition comprises a forward primer A with a nucleotide sequence of SEQ ID NO: 1, a forward primer B with a nucleotide sequence of SEQ ID NO: 2, and a reverse primer C with a nucleotide sequence of SEQ ID NO:

3.

6. Use of a kit in any one of the following: A1) use in identifying a wheat stripe rust resistance trait; A2) use in screening a wheat with a stripe rust resistance; A3) use in molecular marker assisted breeding of a wheat with a stripe rust resistance; the kit comprises the PCR primer in any one of claims 2-5, which is a primer composition for amplifying or detecting the molecular marker in claim 1, the nucleotide sequence of the molecular marker is SEQ ID NO: 4, the nucleotide M at position 51 of the molecular marker is A or C, the genotype is AA, CC or AC, and the wheat with a genotype of CC has a higher stripe rust resistance than the wheat with a genotype of AA.

7. Use of the PCR primer in any one of claims 2-5 in the preparation of a product with at least one of the following functions: B1) identifying a wheat stripe rust resistance trait; B2) screening a wheat with a stripe rust resistance; B3) for molecular marker assisted breeding of a wheat with a stripe rust resistance; The PCR primer is a primer composition for amplifying or detecting the molecular marker in claim 1, the nucleotide sequence of the molecular marker is SEQ ID NO: 4, the nucleotide M at position 51 of the molecular marker is A or C, the genotype is AA, CC or AC, and the stripe rust resistance of the wheat with the genotype CC is higher than that of the wheat with the genotype AA.

8. A method of identifying a wheat stripe rust resistance trait, comprising, The method comprises the following steps: C1) using the PCR primer in any one of claims 2-5 to perform PCR amplification with the wheat genomic DNA to be tested as a template to obtain a PCR product and collect a fluorescence signal; C2) determining the genotype of the wheat to be tested according to the fluorescence signal and identifying the stripe rust resistance of the wheat according to the genotype; The PCR primer is a primer composition for amplifying or detecting the molecular marker in claim 1, the nucleotide sequence of the molecular marker is SEQ ID NO: 4, the nucleotide M at position 51 of the molecular marker is A or C, the genotype is AA, CC or AC, and the stripe rust resistance of the wheat with the genotype CC is higher than that of the wheat with the genotype AA.