Flow cell with patterned substrate

Abstract

An example of a flow cell includes a substrate; a plurality of reactive regions spatially separated from each other across the substrate; and a plurality of independently removable coatings, wherein the plurality of independently removable coatings are respectively positioned above each of the plurality of reactive areas. Each reactive region of the plurality of reactive regions comprises a polymer hydrogel layer; and a reactive entity attached to the polymeric hydrogel layer. At least one of the independently removable coatings is a composite material comprising a thermally responsive polymer and a photo-thermal additive.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 586,716, filed on September 29, 2023, and U.S. Provisional Application Serial No. 63 / 387,874, filed on December 16, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] The sequence listing submitted herewith is hereby incorporated by reference in its entirety. The file name is ILI251B2PCT_IP-2639-PCT_Sequence_Listing.xml, the file size is 17,871 bytes, and the file creation date is December 11, 2023. Background Art

[0005] Some biological containers and / or chemical containers, such as assay plates and flow cells, include a specified reaction zone so that the surface chemical substances that can interact or react with the desired reaction are positioned in the specified reaction zone. When a reactive substance is introduced into a container, the reactive substance interacts or reacts with the surface chemical substances to produce a detectable signal (e.g., an electrical signal or a light signal). Many containers are constructed with a plurality of reaction zones that are connected to a single flow channel fluid. In these containers, a single sample can be introduced into a flow channel and its associated reaction zone, or a plurality of samples can be merged and introduced into a flow channel and its associated reaction zone. Summary of the invention

[0006] The biocontainers and / or chemical containers disclosed herein include multiple reactive regions that are spatially separated from each other across a substrate. These reactive regions include corresponding reactive entities that may be the same or different.

[0007] In some examples disclosed herein, each reactive region is coated with an independently removable coating, which may be a photoreactive coating. These independently removable coatings enable controlled access to the reactive regions. For example, one or more coatings may be removed via light exposure, while one or more other coatings remain intact. The reactive regions exposed by coating removal become active and are therefore able to participate in a specified reaction. The reactive regions with intact coatings remain passivated or protected and therefore remain inactive.

[0008] In some other examples disclosed herein, each reactive region is independently electronically addressable. Independent electronic addressability enables conductive fluid to be directed to a specific reactive region, while other reactive regions remain free of fluid. Controlled fluid exposure enables a specified reaction to occur at a specific reactive region. Unexposed reactive regions remain inactive. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly different parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0010] Figure 1A is a top view of the flow cell;

[0011] Figure 1B yes Figure 1A A semi-schematic, partially cross-sectional, and partially perspective view of an exemplary architecture of a flow cell;

[0012] Figure 1C yes Figure 1A A semi-schematic, partially cross-sectional, and partially perspective view of another exemplary architecture of a flow cell;

[0013] Figure 2A is a schematic cross-sectional view of a reactive area defined in a recess and coated with different removable coatings;

[0014] Figure 2B is a schematic cross-sectional view of a reactive region defined in a recess and coated with different removable coatings, some of which include multiple sub-layers;

[0015] Figure 2C is a schematic cross-sectional view of a reactive area defined in a recess and coated with the same removable coating having different thicknesses;

[0016] Figure 3A is a schematic cross-sectional view of a reactive area defined on a protrusion and coated with different removable coatings;

[0017] Figure 3B is a schematic cross-sectional view of a reactive region defined on a protrusion and coated with different removable coatings, some of which include multiple sub-layers;

[0018] Figure 3C is a schematic cross-sectional view of a reactive area defined on a protrusion and coated with the same removable coating having different thicknesses;

[0019] Figure 3D is a schematic cross-sectional view of a reactive zone defined on a protrusion and coated with a single removable coating having a stepped thickness;

[0020] Figure 3E is a schematic cross-sectional view of a reactive zone defined on a protrusion and coated with a single removable coating having a linear thickness gradient;

[0021] Figure 4 Two exemplary methods (A.-E. or A., ​​B., F., G., E.) utilizing two photoreactive protective layers are schematically shown, wherein:

[0022] A. illustrates exposure of one photoreactive protective layer to light, B. illustrates introduction of a first library template strand, C. illustrates seeding of a first library template strand and exposure of another photoreactive protective layer to light, D. illustrates introduction of a second library template strand, E. illustrates an amplified template strand; and

[0023] A. illustrates exposure of one photoreactive protective layer to light, B. illustrates introduction of a first library template strand, F. illustrates seeding and amplification of a first library template strand and exposure of another photoreactive protective layer to light, G. illustrates introduction of a second library template strand, E. illustrates an amplified template strand;

[0024] Figure 5A is an exemplary chemical structure of a photoreactive protective layer comprising a hydrophilic polymer cross-linked with a photocleavable cross-linking agent;

[0025] Figure 5B depicts the chemical structure of another example of a photoreactive protective layer comprising a hydrophilic polymer cross-linked with a photocleavable cross-linking agent and reactions involving the photoreactive protective layer;

[0026] Figure 5C depicts the chemical structure of yet another example of a photoreactive protective layer comprising a hydrophilic polymer cross-linked with a photocleavable cross-linking agent and another reaction involving the photoreactive protective layer;

[0027] Fig. 6A is an exemplary chemical structure of a photoreactive protective layer comprising a polymer terminated with a photocleavable hydrophobic group or an acid-labile group;

[0028] Figure 6B Depicted is the chemical structure of another example of a photoreactive protective layer comprising a polymer terminated with a photocleavable hydrophobic group or an acid-labile group and reactions involving the photoreactive protective layer;

[0029] Figure 7is a schematic diagram of a digital fluid system;

[0030] Fig. 8A is a top view of a resin layer of a digital fluid box patterned with three different reactive regions;

[0031] Figure 8B is a top view of an array of individually addressable control electrodes of the instrument;

[0032] Figure 8C is shown covered in Figure 8B An array of individually addressable control electrodes on Fig. 8A A top view of a resin layer; and

[0033] Fig. 9 is a schematic diagram of a complementary metal oxide semiconductor imaging device coupled to a substrate.

[0034] definition

[0035] It should be understood that, unless otherwise indicated, the terms used herein are to be understood to have their ordinary meanings in the relevant art. Several terms used herein and their meanings are listed below.

[0036] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0037] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0038] The terms top, bottom, lower, upper, and above are used herein to describe the various components of the flow cell and / or the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation.

[0039] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0040] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor variations (up to + / - 10%) from the value.

[0041] "Acrylamide monomer" is a monomer with the structure A monomer or a monomer containing an acrylamide group. Examples of monomers containing an acrylamide group include azidoacetamidopentyl acrylamide: And N-isopropylacrylamide: Other acrylamide monomers may be used.

[0042] As used herein, the term "activation" refers to the process of generating reactive groups at the surface of a substrate. Activation can be accomplished using silanization or plasma ashing. Although the accompanying drawings do not depict a separate silanized layer or hydroxyl groups (-OH groups) generated by plasma ashing, it should be understood that activation generates a silanized layer or -OH groups at the surface of the activated support or layer to covalently attach the functionalized layer to the underlying support or layer.

[0043] As used herein, an aldehyde is an organic compound containing a functional group having the structure -CHO including a carbonyl center (i.e., a carbon double-bonded to an oxygen) whose carbon atom is also bonded to a hydrogen and an R group such as an alkyl or other side chain. The general structure of an aldehyde is:

[0044] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is completely saturated (i.e., does not contain double bonds and triple bonds). The alkyl group may have 1 to 20 carbon atoms. Typical alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc. As an example, the name "C1-4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl.

[0045] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0046] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0047] As used herein, "aryl" refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When aryl is a ring system, each ring in the ring system is aromatic. Aryl groups may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0048] An "amine" or "amino" functional group refers to a -NR a Rb Group, where R a and R b are each independently selected from hydrogen (e.g., ), C1-6 (or C1-C6) alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0049] As used herein, the term "attachment" refers to the state in which two things are joined, fastened, adhered, connected or bound to each other, directly or indirectly. For example, nucleic acids can be attached to the polymer hydrogel layer by covalent bonds or non-covalent bonds. Covalent bonds are characterized by sharing electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve sharing electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0050] An "azide" or "azido" functional group refers to an -N 3 .

[0051] As used herein, "bonding region" refers to a region of a patterned structure to be bonded to another material, which may be, for example, a spacer layer, a cover, another patterned structure, etc., or a combination thereof (e.g., a spacer layer and a cover, or a spacer layer and another patterned structure). The bond formed at the bonding region may be a chemical bond or a mechanical bond (e.g., using a fastener, etc.).

[0052] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the main chain of the ring system. When the carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged or spiro-connected manner. The carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclic group can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl and spiro[4.4]nonanyl.

[0053] As used herein, the term "carboxylic acid" or "carboxyl" refers to -COOH.

[0054] As used herein, "cycloalkylene" refers to a fully saturated carbocyclic ring or ring system that is attached to the rest of the molecule through two points of attachment.

[0055] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbon ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbon ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.

[0056] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. One example is cyclooctyne. Another example is bicyclononyne. Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.

[0057] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Generally speaking, deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0058] As used herein, the term "recess" refers to a discrete concave feature defined in a substrate and having a surface opening at least partially surrounded by a gap region of the substrate. The recess may have any of a variety of shapes at its opening in the surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of the recess taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0059] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0060] As used herein, the term "epoxy" (also known as a glycidyl or oxirane group) refers to

[0061] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can be performed, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell is suitable for detecting reactions occurring in the flow cell. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc.

[0062] As used herein, a "flow channel" or "channel" may be an area defined between two bonding components or an area defined in a patterned structure open to the external environment, either of which may selectively receive a liquid sample. In some examples, a flow channel may be defined between two patterned structures, and thus may be in fluid communication with the surface chemical substances of each of these patterned structures. In some examples, a flow channel may be defined between a patterned structure and a cover, and thus may be in fluid communication with the surface chemical substances of one patterned structure. In still other examples, a flow channel may be defined in the base of a patterned structure so that it is open to the external environment.

[0063] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) containing one or more heteroatoms (i.e., elements other than carbon, including but not limited to nitrogen, oxygen and / or sulfur) in the ring backbone. When heteroaryl is a ring system, each ring in the ring system is aromatic. A heteroaryl group may have 5-18 ring members.

[0064] As used herein, "heterocycle" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. The heterocycles can be joined together in a fused, bridged or spiro manner. The heterocycle can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In the ring system, heteroatoms can be present in non-aromatic rings or aromatic rings. The heterocyclic group can have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N or S.

[0065] As used herein, the term "hydrazine" or "hydrazine group" refers to -NHNH 2 Group.

[0066] As used herein, the term "hydrazone" or "hydrazine" refers to Group, where R a and R b Each is independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocycle, as defined herein.

[0067] As used herein, "hydroxy" refers to an -OH group.

[0068] As used herein, the term "gap region" refers to an area of ​​a substrate that separates, for example, recesses or protrusions. For example, a gap region may separate one recess or protrusion of an array from another recess or protrusion of the array. Two recesses or protrusions that are separated from each other may be discrete, i.e., lack physical contact with each other. In many examples, the gap region is continuous and the recesses or protrusions are discrete, such as for a plurality of recesses defined in an otherwise continuous surface or a plurality of protrusions defined on an otherwise continuous surface. The gap region may have a surface material that is different from the surface material of the recesses or protrusions. For example, the recess may have a polymer hydrogel layer and a primer therein, and the gap region may be free of a polymer hydrogel layer and a primer.

[0069] As used herein, "nitrile oxide" refers to "R a C≡N + O - " group, where R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloroamide-T or by the action of a base on an imidic chloride [RC(Cl)=NOH] or by reaction between hydroxylamine and an aldehyde.

[0070] As used herein, "nitrone" refers to Group, where R 1 , R 2 and R 3 It can be R as defined in this article a Group and R b Any of the groups, except that R 3 Not hydrogen (H).

[0071] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is the monomer unit of a nucleic acid sequence. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position in the ribose. The nitrogenous heterocyclic base (i.e., a nucleobase) may be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0072] In some examples, the term "over" may mean that one component or material is directly on another component or material. When one is directly on another, the two are in contact with each other. For example, Figure 1C In the embodiment shown in FIG. 1 , when a multi-layer substrate 18 is included, a plurality of functionalized pads 24 are positioned directly above layer 28 .

[0073] In other examples, the term "over" may mean that one component or material is indirectly located on another component or material. By indirectly, it is meant that a gap or another component or material may be located between the two components or materials. Figure 1C In the embodiment shown in FIG. 1 , when a multi-layer substrate 18 is included, a plurality of functionalized pads 24 are positioned indirectly above a base carrier 26. A layer 28 is located therebetween.

[0074] A "patterned structure" refers to a substrate that includes surface chemicals in a pattern (e.g., in depressions or as protrusions) across the substrate. The surface chemicals may include a polymer hydrogel layer and primers (e.g., for library template capture and amplification). In some examples, the substrate has been exposed to a patterning technique (e.g., etching, photolithography, etc.) to produce a pattern for the surface chemicals. However, the term "patterned structure" is not intended to imply that such a patterning technique must be used to generate the pattern. The patterned structure can be generated via any method disclosed herein.

[0075] As used interchangeably herein, the terms "photoreactive layer," "photoreactive protective layer," and "photoreactive coating" refer to a shielding layer (e.g., over a reactive entity) that is capable of undergoing a chemical / physical reaction when exposed to a predetermined range of light wavelengths, wherein during or after the reaction, the layer becomes removable or becomes removable using a solvent. The term may also refer to a material that is capable of preventing a reactive entity from chemically reacting prior to removal of the photoreactive layer.

[0076] As used interchangeably herein, the terms "photothermal filler" and "photothermal additive" refer to nanoscale or microscale structures that absorb light of a predetermined wavelength and convert the absorbed energy into heat (thermal energy). The photothermal filler (or photothermal additive) described herein can be included as part of a composite material comprising a thermally responsive polymer and a photothermal additive, wherein the composite material is included in a photoreactive coating that can be removed independently.

[0077] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a 2 ) and silicone (R 2 SiO) hybrid intermediates (such as RSiO 1.5). Examples of polyhedral oligomeric silsesquioxanes may be as described by Kehagias et al. in Microelectronic Engineering 86 (2009) pp. 776-778, which is incorporated by reference in its entirety. In one example, the composition is a composition having the formula [RSiO 3 / 2 ] n The organosilicon compounds of the present invention are preferably selected from the group consisting of epoxy, azide / azide, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or other groups such as alkyl, aryl, alkoxy and / or haloalkyl groups.

[0078] As used herein, "polymer hydrogel layer" refers to a gel material applied over at least a portion of a substrate. The gel material comprises functional groups that can be attached to primers. The polymer hydrogel layer can be positioned in a recessed portion defined in the substrate (see Figure 1B The recessed portion 22 of the substrate may be defined as a portion of the substrate, or a protrusion on the substrate (see Figure 1C The protrusion 24 in the middle).

[0079] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers referred to herein as amplification primers are used as the starting point for template amplification and cluster generation. Other primers referred to herein as sequencing primers are used as the starting point for DNA synthesis. The 5' end of the primer may be modified to allow coupling reaction with the functional group of the polymer. The primer length may be any number of base lengths and may include a variety of non-natural nucleotides. In one example, the sequencing primer is a short chain ranging from 10 to 60 bases, or 20 to 40 bases.

[0080] As used herein, the term "protrusion" refers to a discrete convex feature defined on a substrate and surrounded by interstitial regions of the substrate. The protrusion may have any of a variety of shapes at its opening in the surface, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. A cross-section of the protrusion taken orthogonally to the surface may be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0081] As used herein, the term "reactive entity" refers to a flow cell surface chemistry that enables a desired interaction or reaction. As examples, reactive entities can be primers used as starting points for template amplification and cluster generation; or enzyme tags, such as transposome complexes for tagging; or reactive functional groups, such as dibenzocyclooctyne (DBCO), strained alkynes, or azides; and biotin.

[0082] As used herein, "reactive region" refers to a discrete area on or in a substrate that includes a polymerized hydrogel and a reactive entity.

[0083] A "removable coating," "protective coating," or "independently removable coating" is a layer of a polymer hydrogel layer that is positioned over a reactive region and that can be removed from the reactive region without deleteriously affecting the reactive entities of the reactive region. The coatings described herein may be sensitive to different solvents / removants such that a remover for one type of coating will not remove a different type of coating. These terms may refer to a photoreactive coating (as defined herein) or a coating having various properties in terms of solubility.

[0084] A "removal agent" is a material or mechanism capable of removing a removable coating.

[0085] As used herein, "spacer layer" refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation absorbing material that facilitates bonding, or can be in contact with a radiation absorbing material that facilitates bonding.

[0086] The term "substrate" refers to a single-layer base support or a multi-layer structure onto which the reactive regions are introduced.

[0087] As used herein, the term "thermoresponsive polymer" refers to a polymer material that is capable of undergoing a phase change (e.g., melting, changing from a hydrophobic state to a hydrophilic state, from a hydrophilic state to a hydrophobic state, etc.) when exposed to a certain temperature change. The thermoresponsive polymers described herein can be included as part of an exemplary composite material comprising a thermoresponsive polymer and a photothermal additive.

[0088] A "thiol" functional group refers to -SH.

[0089] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0090] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. Tetrazole may be optionally substituted.

[0091] Flow cell

[0092] Examples of flow cells disclosed herein generally include: a substrate; a plurality of reactive regions spatially separated from one another across the substrate, each of the plurality of reactive regions comprising: a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; and a plurality of independently removable coatings, each of the plurality of reactive regions being respectively located above the plurality of reactive regions.

[0093] Figure 1A A top view of the flow cell 10 is shown in FIG. Figure 1B and Figure 1C 1 and 2 show different examples of architectures within the flow channel 12 of the flow cell 10. Each of the structures may include one patterned structure 14A or 14B bonded to a cover (not shown), or two patterned structures bonded together (the second of which is not shown). In still other structures, the patterned structures 14A, 14B are open wafers and are therefore not bonded to a cover or another patterned structure.

[0094] In some examples, the flow channel 12 is defined between a patterned structure 14A or 14B and a cover or second patterned structure bonded together via a spacer (not shown). Therefore, in these examples, each flow channel 12 is defined by the patterned structure 14A or 14B, the spacer, and the cover or second patterned structure. In other examples, the patterned structure 14A or 14B may include a sidewall at the periphery (e.g., at the bonding area 20) that extends over the void area 30 to form an open flow channel 12.

[0095] Figure 1A The exemplary flow cell 10 shown includes eight flow channels 12. Although eight flow channels 12 are shown, it should be understood that any number of flow channels 12 (e.g., a single flow channel 12, four flow channels 12, etc.) may be included in the flow cell 10. When multiple flow channels 12 are included, each flow channel 12 may be isolated from another flow channel 12 so that a fluid introduced into a flow channel 12 does not flow into an adjacent flow channel 12.

[0096] Each flow channel 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be positioned at opposite ends of the flow cell 10. The inlet and outlet of the respective flow channel 12 may alternatively be positioned at any position along the length and width of the flow channel 12 that enables the desired fluid flow.

[0097] The inlet allows fluid to be introduced into the flow channel 12, and the outlet allows fluid to be drawn out of the flow channel 12. Each of the inlet and the outlet is fluidically connected to a fluid control system (including, for example, a reservoir, a pump, a valve, a waste container, etc.), which controls the introduction and discharge of fluids. Some examples of fluids introduced into the flow channel 12 can introduce reaction components (e.g., DNA samples, polymerases, sequencing primers, nucleotides, etc.), washing solutions, deblocking agents, etc.

[0098] The flow channel 12 may have any desired shape. In one example, the flow channel 12 has a generally rectangular configuration with curved ends (eg, Figure 1AThe length of the flow channel 12 depends in part on the substrate used to form the patterned structure 14A or 14B (e.g., 16 or 18, see Figure 1B and Figure 1C ). The width of the flow channels 12 depends in part on the size of the substrate 16 or 18 used to form the patterned structures 14A, 14B, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing at the perimeter of the patterned structures 14A or 14B. The spacing between channels 12 and at the perimeter may be sufficient to attach to a cover (not shown) or another patterned structure (also not shown).

[0099] When microcontact printing, aerosol printing, or inkjet printing is used to deposit a separate material (e.g., a spacer (not shown)) that defines at least a portion of the sidewalls of flow channel 12, the depth of flow channel 12 may be as small as a single layer thickness. For other examples, the depth of flow channel 12 may be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth may be in the range of about 10 μm to about 100 μm. In another example, the depth may be in the range of about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of flow channel 12 may be greater than, less than, or between the values ​​specified above.

[0100] The spacer used to attach to the patterned structure 14A, 14B and the cover or second patterned structure can be any material that will seal the patterned structure 14A, 14B and the cover or second patterned structure. As an example, the spacer can be an adhesive, a radiation absorbing material that facilitates bonding, etc. In some examples, the spacer is a radiation absorbing material, such as black.

[0101] The patterned structures 14A, 14B and the cap or second patterned structure may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art.

[0102] When used, the cover can be any material that is transparent to the excitation light directed toward the flow cell 10. In an optical detection system, the cover can also be transparent to the emissions generated by the reactions occurring in the flow cell 10. For example, the cover can include glass (e.g., borosilicate, fused quartz, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable polymeric materials (ie, cycloolefin polymers) are available from Zeon Chemicals LP. In some cases, the cover is shaped to form the top of the flow cell 10 , and in other cases, the cover is shaped to form both the top of the flow cell and the sidewalls of the flow channel 12 .

[0103] The patterned structures 14A, 14B include bonding areas 20 where the patterned structure can be sealed to the cover or second patterned structure. The bonding areas 20 can be located at the periphery of each flow channel 12 (e.g., Figure 1B and Figure 1C ) and at the periphery of the flow cell 10. This area 20 can be used as the periphery of the open wafer type of the patterned structure 14A, 14B.

[0104] Figure 1B and Figure 1C The examples shown can also be used as an open wafer flow cell without a cover or a second patterned structure. In these examples, the patterned structures 14A, 14B are open to the external environment.

[0105] like Figure 1B and Figure 1C As shown, the patterned structure 14A, 14B includes a substrate 16 or 18. The substrate 16 is a single-layer base carrier, and the substrate 18 is a multi-layer structure. The substrate 16 is a single material having a recessed portion 22 defined therein or a protrusion 24 defined thereon. The substrate 18 includes a base carrier 26 and another layer 28 positioned on the base carrier 26, wherein the other layer 28 has a recessed portion 22 defined therein or a protrusion 24 defined thereon.

[0106] Examples of suitable materials for substrate 16 include silicones (e.g., epoxysilicone), glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours), ), polyethylene terephthalate (PET), polycarbonate, cycloolefin / cycloolefin polymer (COP) (such as from Zeon ), polyimide, nylon (polyamide), etc.), ceramic / ceramic oxides, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si 3 N 4 ), carbon, metal, resin, etc. Examples of suitable inorganic resins include inorganic oxides, such as tantalum pentoxide (e.g., Ta 2 O 5 ) or other tantalum oxides (TaO x ), aluminum oxide (e.g., Al 2 O 3 ), silicon dioxide (i.e. silicon dioxide (SiO 2)), fused silica or silica-based materials, hafnium dioxide (e.g., HfO 2 ), indium tin oxide, titanium dioxide, etc. Examples of suitable polymer resins include polyhedral oligomeric silsesquioxane-based resins (e.g., ), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opening epoxy resins), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., ) and their combinations.

[0107] As mentioned, examples of a multilayer structure (i.e., substrate 18) include a base carrier 26 and at least one other layer 28 thereon. Any example of a single-layer base carrier (i.e., substrate 16) may be used as the base carrier 26. In these examples, the other layer 28 may be any material that can be etched or stamped to form the recessed portion 22. Examples of layer 28 include inorganic oxides, such as tantalum pentoxide (e.g., Ta 2 O 5 ), aluminum oxide (e.g., Al 2 O 3 ), silicon oxide (e.g., SiO 2 ), or hafnium dioxide (e.g., HfO 2 ), or polymer resins such as polyhedral oligomeric silsesquioxane-based resins (e.g., ), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opening epoxy resins), acrylic resins, acrylate resins, methacrylic resins, amorphous fluoropolymers (e.g., ) and their combinations.

[0108] In any of the examples described herein, the substrate 16 or susceptor carrier 26 can be a circular sheet, panel, wafer, die, etc. having a diameter ranging from about 2 mm to about 300 mm (e.g., about 200 mm to about 300 mm), or can be a rectangular sheet, panel, wafer, die, etc. having a maximum size of up to about 10 feet (about 3 meters). As an example, the width of the die can range from about 0.1 mm to about 10 mm. Although exemplary sizes have been provided, it should be understood that the substrate 16 or susceptor carrier 26 can have any suitable size.

[0109] like Fig. 9 As shown, one example of a flow cell 10' includes a complementary metal oxide semiconductor (CMOS) chip 94 attached to a substrate 16. For ease of illustration, the substrate 16 is Fig. 9However, it should be understood that a multi-layer substrate 18 could alternatively be used and the CMOS chip 94 would be attached to the substrate 18 via a base carrier 26 .

[0110] In addition to the CMOS chip 94 , the exemplary flow cell 10 ′ includes a substrate 16 above the CMOS chip 94 , the substrate 16 including a plurality of recesses 22 separated by void regions 30 ; a polymer hydrogel 32 within the recesses 22 ; and a reactive entity 34 attached to the polymer hydrogel 32 .

[0111] In the illustrated example, the substrate 16 can be directly attached to the complementary metal oxide semiconductor chip 94 by one or more fixing mechanisms (e.g., adhesives, bonding agents, fasteners, etc.), and thus physically contact the complementary metal oxide semiconductor chip. It should be understood that the substrate 16 can be removably coupled to the complementary metal oxide semiconductor (CMOS) chip 94.

[0112] The CMOS chip 94 includes a plurality of stacked layers 96 including, for example, a silicon layer, a dielectric layer, a metal-dielectric layer, a metal layer, etc. The stacked layers 96 constitute a device circuit including a detection circuit.

[0113] CMOS chip 94 includes optical components, such as optical sensors 98 and optical waveguides 100. The optical components are arranged so that each optical sensor 98 is at least substantially aligned with a single optical waveguide 100 and a single reactive region 29A or 29B of a flow cell 10', and is therefore operatively associated with the single optical waveguide and the single reactive region of the flow cell. However, in other examples, a single optical sensor 98 may receive photons through more than one optical waveguide 100 and / or from multiple reactive regions 29A, 29B. In these other examples, a single optical sensor 98 is operatively associated with more than one optical waveguide 100 and / or more than one reactive region 29A, 29B.

[0114] As used herein, a single optical sensor 98 may be an optical sensor including one pixel or more than one pixel. As an example, each optical sensor 98 may have a pixel size of less than about 50 μm. 2 For example, the detection area can be less than about 10 μm 2 As yet another example, the detection area may be less than about 2 μm 2In the latter example, the optical sensor 98 may comprise a single pixel. The average read noise per pixel of the optical sensor 98 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor 98 may be greater than about 0.5 megapixels (Mpixel). In other examples, the resolution may be greater than about 5 Mpixel, or greater than about 10 Mpixel.

[0115] Also as used herein, a single optical waveguide 100 can be a light guide including a cured filter material that: i) filters the excitation light 104 (propagating from outside the flow cell 10' into the flow channel 12), and ii) allows light emission (not shown, generated by the reaction at the reactive regions 29A, 29B) to propagate therethrough toward the corresponding optical sensor 98. In one example, the optical waveguide 100 can be, for example, an organic absorption filter. As a specific example, the organic absorption filter can filter the excitation light 104 at a wavelength of about 532 nm and allow light emission at a wavelength of about 570 nm or longer. The optical waveguide 100 can be formed by first forming a guide cavity in the dielectric layer 106, and then filling the guide cavity with a suitable filter material.

[0116] The optical waveguide 100 can be configured relative to the dielectric material 106 to form a light-guiding structure. For example, the optical waveguide 100 can have a refractive index of about 2.0, so that light emission is substantially reflected at the interface between the optical waveguide 100 and the surrounding dielectric material 106. In some examples, the optical waveguide 100 is selected so that the optical density (OD) or absorbance of the excitation light 104 is at least about 4 OD. More specifically, the filter material can be selected and the size of the optical waveguide 100 can be set to achieve at least 4 OD. In other examples, the optical waveguide 100 can be configured to achieve at least about 5 OD or at least about 6 OD.

[0117] In this example, the substrate 16 serves as a passivation layer. At least a portion of the passivation substrate 16 contacts the first embedded metal layer 112 of the CMOS chip 94 and also contacts the input region 110 of the optical waveguide 100. The contact between the passivation substrate 16 and the first embedded metal layer 112 may be direct contact or may be indirect contact through the shielding layer 114.

[0118] The substrate 16 (passivation layer) can provide primary corrosion protection for the embedded metal layer 112 of the CMOS chip 94 closest to the substrate 16. In this example, the substrate 16 can include a passivation material that is transparent to light emissions (e.g., visible light) generated by the reaction at the reactive regions 29A, 29B and at least initially resists the fluid environment and moisture that may be introduced into or present in the flow channel 12. The at least initially resistant material acts as an etching barrier to high pH reagents (e.g., pH range 8 to 14) and acts as a moisture barrier. Examples of suitable materials for the substrate 16 (or base carrier 26) of the flow cell 10' include silicon nitride (Si 20). 3 N 4 ), silicon oxide (SiO 2 ), tantalum pentoxide (TaO 5 ), hafnium dioxide (HfO 2 ), boron-doped p+ silicon, etc. The thickness of substrate 16 may vary depending in part on the sensor size. In one example, the thickness of substrate 16 ranges from about 100 nm to about 500 nm.

[0119] In one example, the cover 116 of the flow cell 10' can be a generally rectangular block having at least a generally flat outer surface 118 and at least a generally flat inner surface 120 that defines a portion of the flow channel 12. The block can be mounted to the material 64. Alternatively, the block can be etched so that the cover 116 defines both the top and the sidewalls of the channel 12. In these cases, a thin layer of material 64 can bond the cover 116 to the substrate 16. In one example, a groove can be etched into the transparent block. When the etched block is mounted to the substrate 16, the groove can become the flow channel 12.

[0120] As described above, cover 116 can be physically connected to substrate 16 via material 64. Material 64 is coupled to a portion of a surface of substrate 16 and extends between those portions of cover 116 that will contact substrate 16. In some examples, material 64 includes a curable adhesive layer that bonds cover 116 to substrate 16 (at a portion of a surface thereof).

[0121] The cover 116 may include an inlet port 122 and an outlet port 124 that are configured to fluidly engage other ports (not shown) to direct fluid into the flow channel 12 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 12 (e.g., to a waste removal system).

[0122] The size and shape of the flow channel 12 can be set to guide the fluid along the reactive regions 29A, 29B. The height of the flow channel 12 and other sizes of the flow channel 12 can be configured to maintain a substantially uniform flow of the fluid along the reactive regions 29A, 29B. The size of the flow channel 12 can also be configured to control bubble formation. In one example, the height of the flow channel 12 can be in the range of about 50 μm to about 400 μm. In another example, the height of the flow channel 12 can be in the range of about 80 μm to about 200 μm. It should be understood that the height of the flow channel 12 can vary and can be the largest when the reactive regions 29A, 29B are located in a reaction chamber (e.g., a recess 22) defined in the surface of the substrate 16. In these examples, the recess 22 increases the height of the flow channel 12 at the particular region.

[0123] Each reactive region 29A, 29B is a localized area of ​​the substrate 16 where a specified reaction may occur. In the flow cell 10', each reactive region 29A, 29B is a recess 22 having a polymer hydrogel 32 therein, wherein the polymer hydrogel 32 is functionalized with a reactive entity 34. Fig. 9 Not depicted, but each of the reactive regions 29A, 29B may include one example of an independently removable coating 36 disclosed herein overlying the reactive entity 34.

[0124] The polymer hydrogel 32 may be selectively deposited (eg, using sputter coating, thermal evaporation, or any other suitable technique) into the recessed portion 22, or as described herein with reference to Figure 1B Apply and polish as described.

[0125] In one example, the reactive region 29A or 29B is at least substantially aligned with the input region 110 of a single optical waveguide 100. Thus, light emission at the reactive region 29A, 29B can be directed into the input region 110, through the waveguide 100, and to the associated optical sensor 98. In other examples, one reactive region 29A, 29B can be aligned with several input regions 110 of several optical waveguides 100. In other examples, several reactive regions 29A, 29B can be aligned with one input region 110 of one optical waveguide 100.

[0126] The embedded metal layer 112 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCl), tungsten (W), nickel (Ni), or copper (Cu). The embedded metal layer 112 is a functional part of the CMOS AVdd line and is also electrically connected to the optical sensor 98 through the stacked layer 96. Thus, the embedded metal layer 112 participates in the detection / sensing operation.

[0127] It should be understood that other optical sensors 98 and associated components can be configured in the same or similar manner. However, it should also be understood that the CMOS chip 94 may not be manufactured identically or consistently. Instead, one or more optical sensors 98 and / or associated components may be manufactured differently or have a different relationship relative to each other.

[0128] The stacked layers 96 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) that can conduct electrical current. The circuit may be configured to selectively transmit data signals based on the detected photons. The circuit may also be configured for signal amplification, digitization, storage, and / or processing. The circuit may collect and analyze the detected light emissions and generate data signals for transmitting the detection data to a bioassay system. The circuit may also perform additional analog and / or digital signal processing in the CMOS chip 94.

[0129] CMOS chip 94 can be manufactured using integrated circuit manufacturing processes. CMOS chip 94 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer). The sensor base / layer may include an optical sensor 98. When CMOS chip 94 is fully formed, optical sensor 98 may be electrically coupled to the rest of the circuitry in stacked layers 96 through gates, transistors, etc.

[0130] As referenced in this article Fig. 9 As used herein, the term "layer" is not limited to a single continuous body of material unless otherwise indicated. For example, the sensor base / layer may include multiple sub-layers having different materials and / or may include coatings, adhesives, etc. In addition, one or more layers (or sub-layers) may be modified (e.g., etched, deposited with materials, etc.) to provide the features described herein.

[0131] The stack layer 96 also includes a plurality of metal-dielectric layers. Each of these layers includes a metal element (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and a dielectric material 106 (e.g., SiO 2 ). Various metal elements M1-M5 and dielectric material 106 may be used, such as those suitable for integrated circuit fabrication.

[0132] exist Fig. 9In the example shown, each of the plurality of metal-dielectric layers L1-L6 includes both metal elements M1, M2, M3, M4, M5 and dielectric material 106. In each layer of layer L1-L6, metal elements M1, M2, M3, M4, M5 are interconnected and embedded in dielectric material 106. In some of the metal-dielectric layers L1-L6, additional metal elements may also be included. Some of these additional metal elements can be used to address each pixel through row and column selectors. The voltage at these elements can vary and switch between about -1.4V and about 4.4V, depending on which pixel the device is reading out.

[0133] Fig. 9 The configuration of metal elements M1, M2, M3, M4, M5 and dielectric layer 106 in FIG. 1 is illustrative of a circuit, and it is understood that other examples may include fewer or additional layers and / or may have different configurations of metal elements M1 to M5.

[0134] exist Fig. 9 In the example shown, the shielding layer 114 contacts at least a portion of the substrate 16. The shielding layer 114 has an aperture at least partially adjacent to the input region 110 of the optical waveguide 100. The aperture enables the reactive regions 29A, 29B (and at least some of the optical emissions therefrom) to be optically connected to the waveguide 100. It should be understood that the shielding layer 114 can have an aperture at least partially adjacent to the input region 110 of each optical waveguide 100. The shielding layer 114 can extend continuously between adjacent apertures.

[0135] Shielding layer 114 may include any material that can block, reflect and / or significantly attenuate an optical signal propagating through flow channel 12. The optical signal may be excitation light 104 and / or light emission from reactive regions 29A, 29B. For example, shielding layer 114 may be tungsten (W).

[0136] It should be understood that the flow cell 10' can also be used for optical detection.

[0137] Now back to Figure 1B and Figure 1C , respectively depict different examples of the architecture within the flow channel 12 of the flow cell 10. Figure 1B In FIG. 1 , the recess 22 is defined in the substrate 16 or in a layer 28 of the substrate 18. Figure 1C In FIG. 1 , the protrusions 24 are defined on the substrate 16 or on a layer 28 of the substrate 18 .

[0138] Many different layouts of recesses 22 or protrusions 24 can be envisioned, including regular, repeated and irregular patterns. In an example, recesses 22 or protrusions 24 are arranged in a hexagonal grid to achieve close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be an xy format in rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of recesses 22 or protrusions 24 and gap regions 30. In yet other examples, the layout or pattern may be a random arrangement of recesses 22 or protrusions 24 and gap regions 30.

[0139] The layout or pattern can be characterized with respect to the density (number) of recesses 22 or protrusions 24 in a defined area. For example, the recesses 22 or protrusions 24 can be approximately 2 million / mm. 2 The density can be adjusted to different densities, including, for example, about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 pieces / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 or greater or lesser density. It should also be understood that the density can be between one of the lower and upper limits selected from the above ranges, or other densities (outside the given ranges) can be used. As an example, a high-density array can be characterized as having recesses 22 or protrusions 24 separated by less than about 100 nm, a medium-density array can be characterized as having recesses 22 or protrusions 24 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having recesses 22 or protrusions 24 separated by more than about 1 μm.

[0140] The layout or pattern of the recessed portion 22 or the protrusion 24 may also be characterized according to or alternatively according to the average pitch, or the spacing from the center of a recessed portion 22 or a protrusion 24 to the center of an adjacent recessed portion 22 or a protrusion 24 (center-to-center spacing) or the spacing from the right edge of a recessed portion 22 or a protrusion 24 to the left edge of an adjacent recessed portion 22 or a protrusion 24. The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.15 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch of a particular pattern of recessed portions 22 or protrusions 24 may be between a value selected from the lower limit value and a value in the upper limit value of the range herein. In one example, the depressions 22 or protrusions 24 have a pitch (center-to-center spacing) of about 1.5 μm. While exemplary average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0141] The size of each recess 22 can be characterized by its volume, opening area, depth and / or diameter or length and width. For example, the volume can be about 1×10 -3 μm 3 to about 100 μm 3 In the range of, for example, about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , or larger, or smaller. For another example, the opening area can be about 1×10 -3 μm 2 to about 100 μm 2 In the range of, for example, about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 , or greater, or less. For another example, the depth can be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater, or less. For another example, the depth can be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater, or less. For another example, each of the length and width or the diameter can be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater, or less.

[0142] The size of each protrusion 24 can be characterized by its top surface area, height and / or diameter or length and width. The top surface area can be about 1×10 -3 μm 2 to about 100 μm 2 In the range of, for example, about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 , or larger, or smaller. The height may be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or larger, or smaller. The diameter or each of the length and width may be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or larger, or smaller.

[0143] Each of the structures also includes a reactive region 29A or 29B. Figure 1B In the example shown, the reactive region 29A comprises a polymer hydrogel 32 applied within the recess 22, and reactive entities 34 attached to the polymer hydrogel 32. Figure 1C In the example shown, the reactive region 29B comprises a polymer hydrogel 32 applied to the substrate 16 or layer 28 in the form of protrusions 24 , and reactive entities 34 attached to the polymer hydrogel 32 .

[0144] The polymer hydrogel 32 can be any gel material that can swell when absorbing liquid and shrink when the liquid is removed, such as by drying. In one example, the gel material is an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0145]

[0146] in:

[0147] R A is selected from the group consisting of an azide, an optionally substituted amino, an optionally substituted alkenyl, an optionally substituted alkyne, a halogen, an optionally substituted hydrazone, an optionally substituted hydrazine, a carboxyl group, a hydroxyl group, an optionally substituted tetrazole, an optionally substituted tetrazine, a nitrile oxide, a nitrone, a sulfate, and a thiol;

[0148] R B is H or optionally substituted alkyl;

[0149] R C , R D and R Eare each independently selected from the group consisting of H and optionally substituted alkyl;

[0150] -(CH 2 ) p - each of which may be optionally substituted;

[0151] p is an integer ranging from 1 to 50;

[0152] n is an integer in the range of 1 to 50,000; and

[0153] m is an integer in the range of 1 to 100,000.

[0154] A specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM).

[0155] One of ordinary skill in the art will recognize that the arrangement of the recurring "n" and "m" features in structure (I) is representative, and that the monomer subunits may be present in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof). The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in one specific example may be about 312 kDa.

[0156] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a lightly cross-linked polymer.

[0157] In other examples, the gel material can be a variation of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by Substitute, where R D , R E and R F Each is H or C1-C6 alkyl, R G and R H Each is a C1-C6 alkyl group (rather than H in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can also be used. In this example, in addition to the recurring "n" and "m" features, structure (I) can also include Where R D , R E and R F are each H or C1-C6 alkyl, and R G and RH Each is a C1-C6 alkyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0158] As another example of a gel material, the recurring "n" feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):

[0159]

[0160] Where R 1 is H or C1-C6 alkyl; R 2 is H or C1-C6 alkyl; L is a linker including a straight chain having 2 to 20 atoms selected from the group consisting of carbon, oxygen and nitrogen atoms and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen atoms and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0161] As yet another example, the gel material may include repeating units of each of structures (III) and (IV):

[0162]

[0163] Where R 1a , R 2a , R 1b and R 2b Each of R is independently selected from hydrogen, optionally substituted alkyl or optionally substituted phenyl; 3a and R 3b Each of L is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7-C14 aralkyl; and each L 1 and L 2 are independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0164] In yet another example, acrylamide copolymers are formed using nitroxide-mediated polymerization, and thus at least some of the copolymer chains have alkoxyamine end groups. In the copolymer chains, the term "alkoxyamine end groups" refers to dormant species -ONR 1 R 2 , where R 1 and R 2Each of the may be the same or different and may independently be a linear or branched alkyl or ring structure, and wherein the oxygen atom is attached to the remainder of the copolymer chain. In some examples, an alkoxyamine may also be introduced into some of the recurring acrylamide monomers, for example, at position R of structure (I). A Thus, in one example, structure (I) includes alkoxyamine terminal groups; and in another example, structure (I) includes alkoxyamine terminal groups and alkoxyamine groups in at least some of the side chains.

[0165] It should be understood that other molecules can be used to form the polymer hydrogel 32, as long as they can be functionalized with the desired chemical substance (e.g., a primer set or another desired reactive entity 34). Some examples of suitable materials for the polymer hydrogel 32 include functionalized silanes, such as norbornene silanes, azido silanes, alkyne functionalized silanes, amine functionalized silanes, maleimide silanes, or any other silanes with functional groups that can be connected to the desired chemical components, respectively. Still other examples of suitable materials for the polymer hydrogel 32 include those with colloidal structures, such as agarose; or those with polymer mesh structures, such as gelatin; or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, acrylamide (SFA) or an azidized version of SFA without silane. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of suitable materials for the polymer hydrogel 32 include mixed copolymers of acrylamide and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) can be used in the examples disclosed herein, such as branched polymers, including dendritic polymers (e.g., multi-arm polymers or star polymers or star block polymers). For example, monomers (e.g., acrylamide, acrylamide containing catalysts, etc.) can be incorporated randomly or in blocks into the branches (arms) of the dendritic polymer.

[0166] The gel material for polymer hydrogel 32 may be formed using any suitable copolymerization method, such as nitroxide-mediated polymerization (NMP), reversible addition-fragmentation chain transfer (RAFT) polymerization, and the like.

[0167] The attachment of the polymer hydrogel 32 to the underlying component (e.g., substrate 16 or layer 28) can be performed by covalent bonding. In some cases, the underlying substrate 16 or layer 28 can be activated first, for example, by silanization or plasma ashing. Covalent attachment helps maintain the primer set in the desired region during various uses throughout the life of the flow cell 10.

[0168] In each example, the polymer hydrogel 32 has a reactive entity 34 attached thereto. In some examples of the flow cell 10, the reactive entity 34 in each of the plurality of reactive regions 29A, 29B is a primer set. In one of these examples, the primer set is the same in each of the plurality of reactive regions 29A, 29B. In other of these examples, the primer set of at least one of the plurality of reactive regions 29A, 29B is different from the primer set of at least one other of the plurality of reactive regions 29A, 29B.

[0169] A primer set that can be used as the reactive entity 34 includes two different primers for sequential paired end sequencing. In another example, the reactive entity 34 is an enzyme tag, such as a transposome complex capable of tagging. Therefore, in one example, the reactive entity 34 in each of the plurality of reactive regions 29A, 29B is independently selected from the group consisting of a primer set and an enzyme tag.

[0170] As mentioned, when reactive entity 34 is a primer set, the primer set includes two different primers for sequential paired end sequencing. As an example, the primer set may include a P5 primer and a P7 primer, a P15 primer and a P7 primer, or any combination of a PA primer, a PB primer, a PC primer, and a PD primer as described herein. For example, the primer set may include any two PA, PB, PC, and PD primers, or any combination of a PA primer and a PB, PC, or primer PD, or any combination of a PB primer and a PC primer or a PD primer, or any combination of a PC primer and a PD primer.

[0171] Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example in HISEQ TM HISEQX TM MISEQ TM MISEQDX TM MINISEQ TM 、NEXTSEQ TM 、NEXTSEQDX TM 、NOVASEQ TM 、ISEQ TM 、GENOME ANALYZER TM and other instrument platforms. The P5 primer (shown as a cleavable primer due to the cleavable nucleobase uracil or "n") is:

[0172] P5#1: 5' → 3'

[0173] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1);

[0174] P5#2: 5' → 3'

[0175] AATGATACGGCGACCACCGAGAnCTACAC (SEQ.ID.NO.2) wherein "n" is inosine in SEQ.ID.NO.2; or

[0176] P5#3: 5' → 3'

[0177] AATGATACGGCGACCACCGAGAnCTACAC (SEQ.ID.NO.3) wherein "n" is ene-thymidine (ie, ene-dT) in SEQ.ID.NO.3.

[0178] The P7 primer (shown as a cleavable primer) can be any of the following:

[0179] P7#1: 5' → 3'

[0180] CAAGCAGAAGACGGCATACGAnAT(SEQ.ID.NO.4)

[0181] wherein "n" is 8-oxoguanine in SEQ.ID.NO.4;

[0182] P7#2: 5' → 3'

[0183] CAAGCAGAAGACGGCATACnAGAT(SEQ.ID.NO.5)

[0184] wherein "n" is 8-oxoguanine in SEQ.ID.NO.5;

[0185] P7#3: 5' → 3'

[0186] CAAGCAGAAGACGGCATACnAnAT(SEQ.ID.NO.6)

[0187] Wherein two examples of "n" are 8-oxoguanine in SEQ.ID.NO.6;

[0188] P7#4: 5' → 3'

[0189] CAAGCAGAAGACGGCATACGAUAT (SEQ.ID.NO.7); or

[0190] P7#5: 5' → 3'

[0191] CAAGCAGAAGACGGCATACUAGAT(SEQ.ID.NO.8).

[0192] The P15 primer (shown as a cleavable primer) is:

[0193] P15:5'→3'

[0194] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.9)

[0195] Wherein "n" is allyl-T (i.e., a thymine nucleotide analog with an allyl functional group). The above other primers (PA-PD, shown as non-cleavable primers) include:

[0196] PA 5'→3'

[0197] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.10)

[0198] PB 5'→3'

[0199] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.11)

[0200] PC 5'→3'

[0201] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.12), and

[0202] PD 5'→3'

[0203] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 13).

[0204] Although not shown in the exemplary sequence of PA-PD, it is understood that any of these primers may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc., at any point in the chain.

[0205] Each of the primers disclosed herein may also include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases.

[0206] The 5' end of each primer may also include a linker. Any linker comprising a terminal alkyne group or another suitable terminal functional group capable of attaching to a surface functional group of the polymer hydrogel 32 may be used. In one example, the primer is terminated with a hexynyl functional group.

[0207] As described, in some examples, the same reactive entity 34 (e.g., primer set) is attached to the polymer hydrogel 32 present in each of the recesses 22 or forming each of the protrusions 24. For example, the primer set is the same in each of the reactive regions 29A, 29B. In other examples, one reactive entity 34 (e.g., a primer set including P5 and P7 primers) is attached in a subset of the recesses 22 or attached to a subset of the protrusions 24, while a different reactive entity 34 (e.g., another primer set including PA and PB primers) is attached in a subset of the recesses 22 or attached to a subset of the protrusions 24. Therefore, as described, the primer set of at least one reactive region in the plurality of reactive regions 29A, 29B is different from the primer set of at least one other reactive region in the plurality of reactive regions 29A, 29B.

[0208] Figure 1B The illustrated architecture may be produced by forming a recess 22 in substrate 16 or layer 28 of substrate 18 , introducing a polymer hydrogel 32 into the recess 22 , and attaching a reactive entity 34 (eg, a primer of a primer set) to the polymer hydrogel 32 .

[0209] The recessed portion 22 may be formed using etching or nanoimprint lithography.

[0210] A mixture of polymer hydrogel 32 may be produced. In one example, polymer hydrogel 32 may be present in a mixture (e.g., a mixture with water or a mixture with ethanol and water). Polymer hydrogel 32 may be blanket deposited over substrate 16 or over layer 28 of substrate 18 and subsequently removed from void region 30 using a polishing technique.

[0211] Reactive entities 34 can then be attached to polymer hydrogel 32. For example, primers or transposome complexes can be grafted to polymer hydrogel 32. Grafting can be achieved by: flow-through deposition (e.g., using a temporarily bonded cap), bubble coating, spray coating, whipping distribution, or by another suitable method. Each of these exemplary techniques can utilize a solution or mixture that can contain reactive entities 34, water, buffer, and a catalyst. Using any of the grafting methods, reactive entities 34 are attached to the reactive groups of polymer hydrogel 32 and do not react with gap regions 30. For another example, an enzyme tag can be attached by oligonucleotide hybridization or by biotin / streptavidin interaction. For oligonucleotide hybridization, the enzyme tag may include an oligonucleotide sequence that can be hybridized with a primer that is bonded to a polymer hydrogel. Through biotin / streptavidin interaction, the polymer hydrogel 32 can be biotinylated, and the enzyme tag may include streptavidin.

[0212] When a single type of reactive entity 34 is used, the reactive entity 34 may be pre-grafted to the polymer hydrogel 32, and the pre-grafted hydrogel may be deposited and polished, or selectively deposited.

[0213] When multiple reactive entities 34 are used, some recesses 22 may be masked (e.g., with a photoresist or other suitable mask) while other recesses 22 have one type of reactive entity 34 grafted thereto. Alternatively, the reactive entities 34 may be pre-grafted to different samples of the polymer hydrogel 32, and the pre-grafted hydrogels may be separately and selectively deposited into the desired recesses 22. High precision coating techniques may be used for selective deposition. In one example, a precision gantry tool is used.

[0214] Figure 1C The illustrated architecture may be produced by forming protrusions 24 on substrate 16 or layer 28 of substrate 18 using polymer hydrogel 32 and attaching reactive entities 34 to polymer hydrogel 32. A mixture of polymer hydrogel 32 may be produced as described herein.

[0215] In one example, a photoresist may first be deposited on substrate 16 or layer 28 and developed so that soluble photoresist portions are removed where it is desired to form protrusions 24 and insoluble photoresist portions remain where it is desired to form gap regions 30. A mixture including polymer hydrogel 32 may be blanket deposited over the insoluble photoresist portions and over the exposed portions of substrate 16 or layer 28 and cured. The polymer hydrogel 32 applied to the exposed portions of substrate 16 or layer 28 becomes the protrusions 24. The insoluble photoresist portions and the polymerized hydrogel 32 thereon may be removed using a suitable remover for the photoresist to expose gap regions 30.

[0216] Alternatively, the mixture including the polymer hydrogel 32 may be selectively deposited (using a mask covering the gap regions 30 , a controlled printing technique, etc.) to deposit the polymer hydrogel 32 specifically at the regions where the protrusions 24 are desired to be formed.

[0217] The reactive entity 34 can then be grafted to the protrusion 24. As an example, the grafting can be achieved by flow-through deposition (e.g., using a temporarily bonded cap), bubble coating, spray coating, whipping distribution, or by another suitable method. Each of these exemplary techniques can utilize a reactive entity 34 solution or mixture, which can include reactive entities 34, water, buffer and / or catalyst. Using any of the grafting methods, the reactive entity 34 is attached to the reactive groups of the polymer hydrogel 32 / protrusion 24 and does not react with the gap region 30.

[0218] When a single reactive entity 34 is used, the reactive entity 34 may be pre-grafted to the polymer hydrogel 32, and the pre-grafted hydrogel may be deposited to form the projections 24 according to the examples described herein.

[0219] When multiple reactive entities 34 are used, some protrusions 24 may be masked (e.g., with a photoresist or other suitable mask) while other protrusions 24 have grafted thereto one type of reactive entity 34. Alternatively, the reactive entities 34 may be pre-grafted to different samples of the polymer hydrogel 32, and the pre-grafted hydrogels may be separately and selectively deposited to form the protrusions 24.

[0220] Each flow cell architecture includes an independently removable coating 36 positioned above the reactive regions 29A, 29B. Figure 1B and Figure 1C Each of the figures shows an independently removable coating 36. The independently removable coating 36 renders the reactive regions 29A, 29B inactive (e.g., unable to participate in a specified chemical reaction) until the independently removable coating 36 covering the specific reactive regions 29A, 29B is removed to expose the reactive regions 29A, 29B. Thus, the coating 36 can be designed so that the specific reactive regions 29A, 29B are exposed for analysis or for a specified reaction at a specific time.

[0221] In some examples, the substrates 16, 18 include a plurality of recesses 22; each of the plurality of reactive regions 29A, 29B is located within a corresponding one of the plurality of recesses 22; and each of the plurality of independently removable coatings 36 covers a corresponding one of the plurality of reactive regions 29A, 29B. Figure 1B One of these examples is shown in .

[0222] In some other examples, the substrates 16 , 18 include a plurality of protrusions 24 ; each of the plurality of reactive regions 29A, 29B is located at a corresponding one of the plurality of protrusions 24 ; and each of the plurality of independently removable coatings 36 covers a corresponding one of the plurality of protrusions 24 . Figure 1C One of these examples is shown in .

[0223] Now refer to FIG. 2A to FIG. 2C and FIG. 3A to FIG. 3E Several different examples of removable coatings 36 are described.

[0224] In some exemplary flow cells 10, at least one of the plurality of independently removable coatings 36 has a different removal characteristic than at least one other of the plurality of independently removable coatings 36. Some examples of these independently removable coatings 36A, 36B, 36C are shown in FIG. Figure 2A and Figure 3A Shown in.

[0225] In these examples, the independently removable coatings 36A, 36B, 36C are positioned directly above the reactive regions 29A, 29B, and not on the void regions 30 separating the reactive regions 29A, 29B. Although a single coating 36A, 36B, 36C is shown as covering a single reactive region 29A, 29B, it should be understood that each coating 36A, 36B, 36C may cover a subset of reactive regions 29A, 29B, wherein each subset includes two or more reactive regions 29A, 29B. In these examples, the coatings 36A, 36B, 36C may cover each of the reactive regions 29A, 29B in the subset, as well as the void regions 30 separating the specific reactive regions 29A, 29B. In one example, the coatings 36A, 36B, 36C may each cover about 1 mm 2 To about 500mm 2 of the substrate surface area.

[0226] The respective coatings 36A, 36B, 36C may be applied in the recessed portion 22 ( Figure 2A ) or above the protrusion 24 ( Figure 3A). In one example, a slot die coating manifold may coat a rectangular strip along a web material at a predefined thickness. Coating may be turned on and off to form individual coatings 36A, 36B, 36C by employing a vision system that records the web position. The respective coatings 36A, 36B, 36C may alternatively be applied in the recess 22 using a blanket deposition technique (e.g., spray coating) together with a removable mask (e.g., photoresist) ( Figure 2A ) or above the protrusion 24 ( Figure 3A ), which masks covers areas that do not receive a particular coating 36A, 36B, or 36C to be deposited. In still other examples, a roll-to-roll deposition method can be used to transfer the coating from a source to a desired location on the patterned structure 14A, 14B.

[0227] exist Figure 2A and Figure 3A In the example shown, each of the multiple independently removable coatings 36A, 36B, 36C has different removal characteristics relative to each other in the multiple independently removable coatings 36A, 36B, 36C. However, it should be understood that many combinations and arrangements of coatings 36A, 36B, 36C are possible. Therefore, in an array of recessed portions 22 or protrusions 24, each recessed portion 22 or protrusion 24 in the array can have a different independently removable coating 36A, 36B, 36C thereon, or a subset of recessed portions 22 or protrusions 24 in the array can have a different independently removable coating 36A, 36B, 36C thereon. Each subset can include two or more recessed portions 22 or protrusions 24.

[0228] One example of a removal characteristic that a coating 36A, 36B, 36C may exhibit is solubility. Figure 2A and Figure 3A In the example shown, the solubility of one coating 36A is orthogonal to each of the other coatings 36B and 36C. In this context, the term "orthogonal" means that the solubility conditions that one coating 36A is susceptible to are at least partially different from the solubility conditions that each of the other coatings 36B, 36C is susceptible to. The coatings 36A, 36B, 36C may be soluble in different solvents, or may be soluble in different aqueous solutions having different pH values.

[0229] Table 1 illustrates an example of a completely orthogonal solvent.

[0230] Table 1

[0231] Solvent 1 Solvent 2 Solvent 3 Polymer for coating 36A Soluble Insoluble Insoluble Polymer for coating 36B Insoluble Soluble Insoluble Polymer used for coating 36C Insoluble Insoluble Soluble

[0232] In this example, three different polymers (forming each coating in coating 36A, 36B, 36C respectively) are easy to be removed by three different solvents.It should be appreciated that any number of polymers can be used for coating 36A, 36B, 36C, as long as the reactive zone 29A, 29B of desired number is exposed at the desired time.For example, half reactive zone 29A, 29B along flow cell channel 12 can be coated with coating 36A, and the other half reactive zone 29A, 29B can be coated with coating 36B.This enables half reactive zone 29A, 29B to be analyzed (or used for specified reaction) simultaneously, and the reactive zone 29A, 29B of the other half can be analyzed (or used for specified reaction) at another time.

[0233] It should be understood that polymers with partial orthogonality can be used for coatings 36A, 36B, 36C as long as the removal of the respective coatings 36A, 36B, 36C is performed in a specific order so that the reactive regions 29A, 29B are not exposed prematurely. Table 2 illustrates an example of partially orthogonal solvents.

[0234] Table 2

[0235] Solvent 1 Solvent 2 Solvent 3 Polymer for coating 36A Soluble Soluble Soluble or insoluble Polymer for coating 36B Insoluble Soluble Insoluble Polymer used for coating 36C Insoluble Insoluble Soluble

[0236] Examples of polymers with partially orthogonal solvent solubilities that can be used as coatings 36A, 36B, 36C, respectively, include acrylic polymers such as poly(dimethylsiloxane) (PDMS), which is soluble in hexane and toluene; poly(methyl methacrylate) (PMMA), which is insoluble in hexane but soluble in toluene; and poly(vinyl alcohol) (PVA), which is soluble in water but not in hexane or toluene. In this particular example, coating 36A can be removed first with solvent 1, as it will not remove either of the other coatings 36B, 36C. In this particular example, solvent 2 would not be used before solvent 1 unless it is desired to expose the reactive areas 29A, 29B covered by each of coatings 36A, 36B, as solvent 2 would remove both coatings 36A, 36B.

[0237] Several examples of polymers that can be used as coatings 36A, 36B, 36C and their solubility in three different solvents are shown in Table 3. Any combination of these polymers can be used for coatings 36A, 36B, 36C, and two or more of coatings 36A, 36B, 36C can be used in any channel 12 of the flow cell 10. In addition, the polymers selected for coatings 36A, 36B, 36C can have partial orthogonality, and the order in which the solvents are used can be selected so that one or more coatings are not removed prematurely while other coatings are removed.

[0238] Table 3

[0239]

[0240] Examples of polymers soluble in aqueous solutions with different pH levels include chitosan, which is soluble under acidic conditions, and copolymers of water-insoluble monomers and amine-functional monomers, which can be adjusted to dissolve at different pH values ​​depending on the content of the amino-functional monomer. An example of a copolymer is dimethylaminoethyl methacrylate, which is soluble under alkaline conditions.

[0241] Another example of a removal property that coatings 36A, 36B, 36C can exhibit is differential heat release under aqueous conditions. In these examples, different low critical solution temperature (LCST) polymers, high critical solution temperature (UCST) polymers, and / or waxes with different melting temperatures can be selected for coatings 36A, 36B, 36C. LCST polymers, such as poly(N-isopropylacrylamide), become soluble in water when exposed to temperatures below the critical temperature; and conversely, UCST polymers, such as poly(N-acryloylglycinamide) and poly(acrylamide-co-acrylonitrile), become soluble in water when exposed to temperatures above the critical temperature (which may be unique to each polymer). Examples of suitable waxes include beeswax (T m From about 62°C to about 65°C), paraffin (T m from about 46°C to about 61°C) and petroleum waxes of different molecular weights (T m From about 37°C to about 95°C, where T m increases with the number of carbon atoms).

[0242] In other examples, one or more removable coatings 36D or 36D' (see Figure 4 The coatings 36D and 36D' may be identical and therefore responsive to the same wavelength, or the coatings 36D, 36D' may comprise materials responsive to different wavelength ranges of light (e.g., L 1 and L 2 ,like Figure 4 In addition, although Figure 4 , but in examples where additional selectivity is desired, additional coatings may be used, each with separate light removal properties. The photoreactive protective layers 36D, 36D' may be similar to Figure 2A and Figure 3AThe illustrated pattern of coatings 36A, 36B, 36C is positioned in each of the recesses 22 or over each of the protrusions 24. As described herein, for photoreactive coatings, the removable mechanism may be the light itself, or heat generated by the light.

[0243] Alternatively, although Figure 4 Not shown, either coating 36D or 36D' can be in the form of a single layer extending over all reactive regions 29A, 29B (including over void region 30). In such examples, another coating 36D' or 36D is not included. In these examples, a single photoreactive protective layer 36D or 36D' can be used because the photoreactivity allows layer 36D or 36D' to be selectively removed via light exposure. Light enables both spatial and temporal control. Therefore, a portion of the photoreactive protective layer 36D or 36D' (e.g., a portion covering a specific reactive region 29A, 29B or a specific subset of reactive regions 29A, 29B that will participate in subsequent reactions) can be removed by exposing the portion to light.

[0244] In one example, the photoreactive protective layer 36D or 36D' is a hydrophilic polymer cross-linked with a photo-cleavable cross-linking agent. In this example, the high degree of cross-linking within the polymer makes the coating 36D, 36D' structurally stable, thereby minimizing the release or exposure of the reactive entity 34A or 34B (below the photoreactive protective layer 36D, 36D') to the external environment. When exposed to a certain wavelength, the photo-cleavable cross-linking agent is cleaved, which produces a spatially degraded and soluble chemical structure. Therefore, controlled light exposure enables the layer 36D, 36D' to be removed (e.g., washed off) using a suitable aqueous solvent (such as water).

[0245] Examples of hydrophilic polymers that can be used in these examples of layers 36D, 36D' include PAZAMs copolymerized with or substituted with photocleavable groups, such as N-hydroxyalkyl acrylamide, polyethylene glycol (PEG), poly(hydroxyethyl acrylate), hydroxypropyl methylcellulose, poly(vinyl pyrrolidone), and polyvinyl alcohol (PVA). Examples of photocleavable crosslinkers for these examples of layers 36D, 36D' include o-nitrobenzyl moieties and coumarin moieties.

[0246] To enable crosslinking by curing, the hydrophilic polymers described herein can be chemically modified with reactive groups such as acrylates or reactive esters. Free radical polymerization (via acrylate or methacrylate groups) can be used to crosslink the hydrophilic polymer and a photocleavable crosslinker, or crosslinking can be performed via other methods of chemical curing, such as thiol-ene coupling, amine-reactive ester (via p-nitrophenyl ester or N-hydroxy-succinimide ester) coupling, or amine-epoxy coupling.

[0247] In a specific example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer and the photocleavable cross-linker is a coumarin or o-nitrobenzyl moiety. The coumarin or o-nitrobenzyl moiety can be covalently conjugated to the poly(ethylene glycol) of the polyvinyl alcohol / polyethylene glycol graft copolymer. Figure 5A An example is depicted in . Coumarin or o-nitrobenzyl groups can be cleaved upon exposure to ultraviolet (UV) light (100 nm to 400 nm) or blue light (450 nm to 495 nm), which results in a reduction in the crosslink density of the polymer coating. Thus, upon exposure, the cleaved polymer coating becomes hydrophilic and can be washed with an aqueous solution.

[0248] In another example, the photoreactive protective layer 36D or 36D' is a hydrophilic polymer cross-linked with an acid-labile cross-linker. With an acid-labile cross-linker, an acid species can be generated in the presence of a photoacid generator (PAG) and upon exposure to UV / visible light, which changes the pH and cleaves the cross-linker, thus making the polymer coating 36D or 36D' more soluble (and easily removed via washing). This enables the layer 36D, 36D' to be washed off, for example, using an aqueous solvent.

[0249] Any suitable hydrophilic polymer described herein can be crosslinked with an acid-labile crosslinking agent. Examples of acid-labile crosslinking agents include aldehyde crosslinking agents, carboxylic acid crosslinking agents, terephthalic acid crosslinking agents, suberic acid crosslinking agents, sulfosuccinic acid crosslinking agents, glutaraldehyde crosslinking agents, or glyoxal crosslinking agents.

[0250] In one specific example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer and the acid-labile cross-linker includes acetal groups.

[0251] Another example of a hydrophilic polymer cross-linked with an acid-labile cross-linker is shown in Figure 5B In this example, glutaraldehyde (GA) is used to crosslink polyvinyl alcohol (PVA) via acid-labile acetal groups. Another example is shown in Figure 5C This example depicts the use of sulfosuccinic acid to crosslink PVA via ester groups.

[0252] As mentioned, the photoacid generator used can be reactive to UV light or visible light. An example of a suitable photoacid generator (reactive to UV light) is a sulfonium-based photoacid generator. An example of a suitable photoacid generator (reactive to UV light) is an arylazosulfone-based photoacid generator.

[0253] In yet another example, the photoreactive protective layer 36D or 36D' is a polymer terminated with a photocleavable hydrophobic group or an acid-labile group. In this example, crosslinking is not utilized. The photocleavable hydrophobic group or the acid-labile protective group on the polymer side chain makes the polymer more hydrophobic. These examples of the photoreactive protective layer 36D or 36D' undergo a phase transition from hydrophobic to hydrophilic when exposed to light. In one example, the polymer is polymethacrylic acid, a polyphenol, polyvinyl alcohol, or a polyvinyl alcohol / polyethylene glycol graft copolymer, which is functionalized with a photocleavable hydrophobic group (such as a coumarin or o-nitrobenzyl moiety). These photocleavable groups are typically hydrophobic, which prevents the photoreactive protective layer 36D from being removed and washed off by aqueous solutions. When exposed to ultraviolet light or visible light, these hydrophobic groups will be cleaved, returning the polymer coating to its hydrophilic form. A specific example is shown in Fig. 6A middle. Fig. 6A The cleavage of the o-nitrobenzyl group shown in makes the coating 36D, 36D' more hydrophilic, which enables the coating to be removed / washed using an aqueous solution. In another example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer, which is functionalized with an acid-labile group. A specific example is shown in Figure 6B In the presence of a photoacid generator (PAG) and upon exposure to UV / visible light, an acid species is generated that cleaves the acid-labile group. Figure 6B In the example shown, cleavage of the tert-butyl carbonate groups produces a hydrophilic polyphenol coating that can be washed and removed by aqueous solutions.

[0254] In yet another example, at least one of the independently removable photoreactive coatings 36D or 36D' (positioned above the reactive regions 29A, 29B) is a composite material comprising a thermoresponsive polymer and a photothermal additive (or photothermal filler). In this example, the corresponding one of the removable coatings 36D or 36D' may be similar to Figure 2A and Figure 3A The coatings 36A, 36B, 36C shown in the figure are positioned in each of the recesses 22 or over each of the protrusions 24, or a removable coating 36D or 36D' can be a single layer extending over all reactive regions 29A, 29B (including over void region 30).

[0255] The thermoresponsive polymer in the composite material used to form the protective layer 36D or 36D' can be a suitable polymer material that undergoes a phase change when exposed to a predetermined temperature change. For example, the thermoresponsive polymer can be a polymer that melts when a certain temperature is reached. As another example, the thermoresponsive polymer can be a polymer that changes from a hydrophobic state to a hydrophilic state when a certain temperature is reached, such as a UCST (upper critical solution temperature) polymer, such as poly (acrylamide-co-acrylonitrile). As another example, the thermoresponsive polymer can be a polymer that changes from a hydrophilic state to a hydrophobic state when a certain temperature is reached, such as a LCST (lower critical solution temperature) polymer, such as poly (Ni isopropyl acrylamide) or PNIPAAm.

[0256] Therefore, the thermoresponsive polymer can be selected from the group consisting of: polylactic acid, poly(lactic acid-co-glycolic acid), polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer and their combinations.

[0257] The photothermal additive or photothermal filler contained in the composite material of the protective layer 36D or 36D' can be a nanoscale or any micron-scale structure that absorbs light (e.g., photon) energy under a certain wavelength range and converts the absorbed energy into heat. In one example, the structure is a spherical nanoparticle or microparticle. For example, the structure is a non-spherical nanoparticle or microparticle, such as a cube, a triangular prism, a rod, a sheet, a cage (e.g., a non-spherical hollow particle with a porous shell), a tube, etc. In another example, the structure is an irregularly shaped nanoparticle or microparticle. The size of the structure may vary depending on its shape. In the examples disclosed herein, the maximum size of the structure (e.g., diameter, length, median, etc.) is on the nanoscale, and therefore in the range of about 1nm to less than 1000nm, or on the micron scale, and therefore in the range of about 1μm to less than 1000μm. In some examples, the structure is a nanoparticle having a diameter greater than or equal to 1 nm, 2 nm, 3 nm, 4 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, or greater than or equal to 100 nm.

[0258] Absorption and conversion are partially attributed to the plasma properties of the structure (e.g., gold particles, silver particles, polypyrrole, graphene, etc.). Alternatively, the photothermal filler can be a photoisomerization dopant with a thermal activation barrier, such as azobenzene. In one example, the photothermal filler (or photothermal additive) can be selected from the group consisting of: gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole particles, graphene sheets, carbon nanotubes, carbon nanodots, black phosphorus particles, azobenzene particles, and combinations thereof. It should be understood that the morphology of the photothermal additive / filler can be tuned or otherwise manipulated according to the desired wavelength for removing the coating 36D, 36D'. For example, gold nanostructures (e.g., gold nanorods) with a higher aspect ratio absorb higher wavelength light (e.g., red light to NIR light) relative to gold nanospheres (e.g., which absorb blue light).

[0259] The photothermal additive / filler in combination with the thermoresponsive polymer can be distributed in the polymer matrix (i.e., composite material) that forms the removable coating 36D or 36D'. Upon exposure to UV or visible light, the energy absorbed by the photothermal additive is converted into heat, which induces a phase change in the polymer matrix (due to the presence of the thermoresponsive polymer). This phase change causes the composite-based photoreactive coating 36D or 36D' to soften or dissolve. The softened or dissolved coating 36D or 36D' can then be removed using an aqueous solvent.

[0260] As described, in some cases, two different photoreactive protective layers 36D, 36D' are used. In these examples, layers 36D and 36D' are responsive to different ranges of light wavelengths L 1 and L 2 The layers 36D and 36D' can be any photoreactive coating material described herein, as long as the coatings 36D and 36D' respond to different ranges of light wavelengths L 1 , L 2 For example, one of the layers 36D, 36D' may be responsive to light wavelengths L ranging from 220 nm to 370 nm. 1 , while the other layer 36D', 36D may respond to light wavelengths L ranging from 440nm to 800nm 2 .

[0261] Any of the exemplary coatings (36A, 36B, 36C, 36D, or 36D') described herein can be used in combination to obtain a multilayer coating. Some examples of multilayer removable coatings 38A, 38B are shown in Figure 2B and Figure 3BIn this example, at least one of the plurality of independently removable coatings includes a plurality of sub-layers (i.e., is a multi-layer removable coating 38A, 38B); and the plurality of sub-layers define the removal characteristics of at least one of the plurality of independently removable coatings. When a plurality of light-triggered removable materials are included in the multi-layer removable coating 38A, 38B, the wavelengths should be selected to avoid overlap and prevent premature removal of a particular coating.

[0262] The sublayers of the multilayer removable coating 38A, 38B can be any of the materials described herein for the coatings 36A, 36B, 36C, 36D, and 36D'. Incorporating the coatings 36A, 36B, 36C, 36D, and / or 36D' into a stack enables the same coatings 36A, 36B, 36C, 36D, and / or 36D' to be used in different orders, which imparts different removal characteristics to the entire multilayer removable coating 38A, 38B. The overall removal characteristics of each multilayer removable coating 38A, 38B will depend on the coatings 36A, 36B, 36C, 36D, and 36D' and the order of the coatings 36A, 36B, 36C, 36D, and 36D' in a particular stack.

[0263] exist Figure 2B and Figure 3B In the example shown, the multi-layer removable coating 38A, 38B requires sequential processing in order to reveal the reactive areas 29A, 29B below. The sequential processing will depend on the sub-layers included in the stack, such as coatings 36A, 36B, 36C, 36D and / or 36D'. The sub-layers of each of the multi-layer removable coatings 38A, 38B can be selected so that even when other sub-layers of the multi-layer removable coating 38A or 38B are removed or when another multi-layer removable coating 38B or 38A is completely removed, some of the reactive areas 29A, 29B are still coated with at least some sub-layers of the multi-layer removable coating 38A or 38B.

[0264] exist Figure 2B and Figure 3B In the example shown, removal of multi-layer coating 38A involves sequential dissolution of coating 36B and then coating 36A, while removal of multi-layer coating 38B involves sequential dissolution of coatings 36C, 36A, and then 36B.

[0265] According to Table 2, in some examples, coatings 36A and 36C can be selected so that they are not soluble in the same solvent (or not susceptible to the same removal characteristics). In these examples, removal of single-layer coating 36A does not affect either of multi-layer coatings 38A, 38B. In these examples, multi-layer coatings 38A, 38B can then be removed in any order desired to expose the corresponding underlying reactive regions 29A, 29B. For example, multi-layer coating 38A can be dissolved before multi-layer coating 38B, or multi-layer coating 38B can be dissolved before multi-layer coating 38A.

[0266] Also according to Table 2, in other examples utilizing removable coatings 36A, 36B, and / or 36C based on solubility, coatings 36A and 36C may be selected so that they are soluble in the same solvent (or susceptible to the same removal characteristics). In some of these examples, removing the single-layer coating 36A will also remove the first two coatings (sub-layers) 36C, 36A of the multi-layer coating 38B, as long as the solvent exposure time is long enough for such removal. In these particular examples, the removal of the coatings (sub-layers) 36C, 36A of the multi-layer coating 38B will expose the coating 36B. The coatings (sub-layers) 36B of each of the multi-layer coatings 38A, 38B may then be removed simultaneously. Therefore, in these particular examples, the multi-layer coating 38B may be removed before the multi-layer coating 38A. Alternatively, the removal of the single-layer coating 36A may be performed so that the first coating (sub-layer) 36C of the multi-layer coating 38B is removed, but the second coating (sub-layer) 36A of the multi-layer coating 38B remains intact. In these particular examples, the remaining portions of multilayer coating 38A or multilayer coating 38B (i.e., sublayers / coatings 36A, 36B) may then be removed by exposing the respective underlying reactive regions 29A, 29B in any order desired. For example, multilayer coating 38A may be dissolved before the remaining sublayers of multilayer coating 38B, or the remaining sublayers of multilayer coating 38B may be dissolved before multilayer coating 38A.

[0267] For multilayer coatings 38A, 38B, the sublayers can be selected to act as a barrier to reagents (e.g., sequencing reagents, labeling buffers, etc.) for reactions with the exposed reactive regions 29A, 29B. As a barrier to the reaction reagents, the sublayers will minimize or prevent the penetration of these reagents into the remaining sublayers.

[0268] Any of the methods disclosed herein may be used to generate the multilayer coating 38A, 38B. For example, in a roll-to-roll coating system, multiple sequential coating heads (each coating head coating a set of unique rectangular sheets or strips) may accumulate different layers (e.g., layers 38A or 38B) (of the multilayer coating 38A or 38B) on discrete areas of a substrate. Figure 2B and Figure 2CAs shown, however, note that each coating layer need not be deposited in every pass). In a wafer coating system, inkjet, screen, stencil, or precision dispense coating can be used to build up the layers (of the multilayer coating 38A or 38B), with each material printing a unique 2D coating area.

[0269] Depending on the materials used, a curing step may be performed after the deposition of each sub-layer.

[0270] Reference now Figure 2C and FIG. 3C to FIG. 3E , depicts still other examples of independently removable coatings 36, 36', 36", 36'". In these examples, coating 36 or coatings 36', 36", 36' are formed of the same material (and can be any of the materials described herein for coatings 36A, 36B, 36C, 36D, 36D'), but coating 36 has a variable thickness or each of the multiple coatings 36', 36", 36' has a different thickness. Therefore, although coating 36 or coatings 36', 36", 36' are susceptible to the same removal characteristics, the rate at which coating 36 is removed (e.g., via dissolution, light exposure, etc.), or the rate at which coatings 36', 36", 36' are removed, varies due to the different thicknesses T 1 、T 2 、T 3 But different.

[0271] exist Figure 2C In the example shown, each of the recessed portions 22 has a removable coating 36', 36", 36'" having a different thickness positioned above the reactive region 29A, 29B associated with the recessed portion 22. In one example, the thickness T 1 <Thickness T 2 <Thickness T 3 , and T 1 In the range of about 10 nm to about 500 nm, T 2 In the range of about 100 nm to about 1 μm, and T 3 In the range of about 500 nm to about 10 μm. It should be understood that in an array of recessed portions 22, each recessed portion 22 may have a different thickness of the removable coating 36', 36", 36'", or a subset of recessed portions 22 in the array may have a different thickness of the coating 36', 36", 36'". Each subset may include two or more recessed portions 22.

[0272] exist Figure 3C In the example shown, each of the protrusions 24 has a removable coating 36', 36", 36'" having a different thickness positioned above the reactive region 29A, 29B associated with the protrusion 24. Figure 2C, thickness T 1 <Thickness T 2 <Thickness T 3 , and T 1 In the range of about 10 nm to about 500 nm, T 2 In the range of about 100 nm to about 1 μm, and T 3 In the range of about 500 nm to about 10 μm. It should be understood that in an array of protrusions 24, each protrusion 24 can have a different thickness of the removable coating 36', 36", 36'", or a subset of protrusions 24 in the array can have a different thickness of the coating 36', 36", 36'". Each subset can include two or more protrusions 24.

[0273] exist Figure 3D and Figure 3E In the example shown, a single removable coating 36 is positioned over each of the protrusions 24 (and reactive regions 29A, 29B), but the removable coating 36 has a variable thickness. Thus, the thickness T of the removable coating 36 is 1 、T 2 or T 3 It is thinner over some of the protrusions 24 (and reactive regions 29A, 29B), and thicker over some other of the protrusions 24 (and reactive regions 29A, 29B). Figure 3D In the example shown, the removable coating 36 has a width from T to 1 to T 2 to T 3 Increase the step gradient. Figure 3E In the example shown, the removable coating 36 has a width from T to 1 to T 2 to T 3 In both examples, each protrusion 24 or a subset of protrusions 24 is positioned at a different thickness T of the removable coating 36. 1 、T 2 or T 3 under.

[0274] Although in Figure 2C , Figure 3C , Figure 3D and Figure 3E, but it should be understood that any number of different coating thicknesses (e.g., 2 or greater than 3) may be used. The number of different coating thicknesses will depend on the number of recesses 22 or protrusions 24 in the channel 12, and the number of subsets (if any) of recesses 22 or protrusions 24. The number of subsets is in turn based on the desired number of reactions to be performed within a single flow cell channel 12.

[0275] Methods for using flow cells

[0276] The examples of the flow cell 10 described herein can be used in analytical methods including nucleic acid sequencing. The independently removable coating 36 (36A, 36B, 36C, 36D, 36D', 36', 36" or 36"') described herein enables selective reactive regions 29A, 29B to be covered and ready for analytical / chemical reactions while also allowing other reactive regions 29A, 29B to remain covered so that they do not participate in the analytical / chemical reactions at the time.

[0277] An example of some example methods for using the circulation pool 10 includes i) selectively removing at least one of a plurality of independently removable coatings 36A, 36B, 36C, 36D, 36D' or 36', 36", 36'" that are respectively positioned above each of a plurality of reactive regions 29A, 29B that are spatially separated from each other across a substrate 16 or 18, thereby exposing at least one of the plurality of reactive regions 29A, 29B, and a reactive entity 34 at at least one of the plurality of reactive regions 29A, 29B, wherein each of the plurality of reactive regions 29A, 29B includes a polymer hydrogel layer 32 and a reactive entity 34 attached to the polymer hydrogel layer 32, and ii) initiating a reaction involving the reactive entity 34. In some examples of the method, at least one of the independently removable coatings 36 is a composite material comprising a thermoresponsive polymer and a photothermal additive (and thus at least one of the independently removable coatings 36 is a photoreactive coating 36D or 36D').

[0278] Another example of other example methods for using the flow cell 10 includes: i) selectively removing an independently removable portion of a coating 36 positioned above each of a plurality of reactive regions 29A, 29B spatially separated from one another across a substrate 16 or 18, thereby exposing a reactive entity 34 at at least one of the plurality of reactive regions 29A, 29B and at least one of the plurality of reactive regions 29A, 29B, wherein at least one other independently removable portion remains unaffected; and ii) initiating a reaction involving the reactive entity 34.

[0279] Some example methods utilize independently removable coatings 36A, 36B, 36C, wherein the removal characteristic of each coating is solubility. In these examples, selectively removing at least one of the plurality of independently removable coatings 36A, 36B, 36C involves exposing the plurality of independently removable coatings 36A, 36B, 36C to a predetermined solvent that dissolves at least one of the plurality of independently removable coatings 36A, 36B, 36C, while not dissolving at least one other of the independently removable coatings. The solvent or aqueous solution used will depend on the respective materials of the coatings 36A, 36B, 36C. In some examples of the method, at least one of the plurality of independently removable coatings comprises a plurality of sub-layers (i.e., is a multi-layer coating 38A or 38B); and selectively removing at least one of the plurality of independently removable coatings involves exposing at least one of the plurality of independently removable coatings to a sequential removal process that sequentially dissolves each of the plurality of sub-layers. The combination of solvents or aqueous solutions used will depend on the respective materials of the sub-layers in multi-layer coating 38A or 38B.

[0280] Each of the plurality of removable coatings 36', 36", 36'" has a different thickness T 1 、T 2 、T 3; Selectively removing at least one of the plurality of independently removable coatings 36', 36", 36'" involves exposing the plurality of independently removable coatings 36', 36", 36'" to a solvent for a predetermined time. The predetermined time is selected so that the thinnest independently removable coating 36' or 36" present on the circulation pool 10 will be removed and any thicker independently removable coatings 36" and / or 36'" will remain partially intact. It should be understood that during the solvent exposure, some of the thicker independently removable coatings 36" and / or 36'" are removed (because the coatings 36', 36", 36'" are formed of the same material), but some of the thicker independently removable coatings 36" and / or 36'" are removed. ' may prevent them from being completely removed. After the current target coating 36 or 36" is removed and solvent exposure is stopped, as long as there is a thicker coating (e.g., 36" and / or 36'") than the coating targeted for removal (e.g., 36' or 36"), at least one of the thicker independently removable coatings 36" and / or 36'" remains partially intact. In these examples, the solvent exposure time will depend on the dissolution rate of the material of the coating 36', 36", 36'".

[0281] In other examples, selectively removing the independently removable portion of coating 36 involves exposing coating 36 to a predetermined solvent for a predetermined time such that the independently removable portion is removed while the remaining portion of coating 36 remains intact. Figure 3D and Figure 3E In these examples, the solvent exposure time will depend on the dissolution rate of the material of coating 36. At the selected exposure time, the thinnest portion of coating 36 present on flow cell 10 (e.g., having a thickness T 1 or T 2 ) will be removed, and any thicker parts (e.g., with a thickness of T 2 or T 3 ) remains partially intact. It should be understood that during solvent exposure, the thicker portion (e.g., having a thickness T 2 or T 3 ) will be removed, but in the thicker part (e.g., with thickness T 2 or T 3 ) will prevent these portions from being completely removed. As long as a thicker portion of coating 36 is present on flow cell 10 when the target (thinner) portion is removed, the thicker portion will remain partially intact after the current target portion of coating 36 is removed and solvent exposure ceases.

[0282] After selectively removing the individually removable coating 36A, 36B, 36C, 36', 36", or 36'", a reaction can be performed at the exposed reactive areas 29A, 29B. The reaction performed will depend on the reactive entities 34A, 34B at the reactive areas 29A, 29B. In one example, the reactive entities 34A, 34B are immobilized transposome complexes, and the reaction involves tagmentation of the introduced DNA sample. In another example, the reactive entities 34A, 34B are primer sets, and the reaction involves seeding a library template strand, amplifying the library template strand to form an amplicon, and then sequencing the amplicon.

[0283] Other examples of the method involve utilizing / removing a photoreactive protective layer 36D or 36D'. In some of these examples, the substrate 16, 18 includes a plurality of recesses 22; each of the plurality of reactive regions 29A or 29B is positioned within a corresponding one of the plurality of recesses 22; and each of the independently removable coatings 36D or 36D' covers a corresponding one of the plurality of reactive regions 29A or 29B (similar to Figure 1B ). In other of these examples, substrate 16, 18 includes a plurality of protrusions 24; each of a plurality of reactive regions 29A or 29B is positioned at a corresponding one of the plurality of protrusions 24; and each of independently removable coatings 36D or 36D' covers a corresponding one of the plurality of protrusions 24 (similar to Figure 1C ).

[0284] Selectively removing at least one of the plurality of independently removable coatings 36D or 36D' may involve exposing at least one of the plurality of independently removable coatings 36D or 36D' to light without exposing at least one other of the independently removable coatings 36D or 36D' to light, thereby allowing at least one of the plurality of independently removable coatings 36D or 36D' to be removable using an aqueous solvent.

[0285] Two examples of this approach are Figure 4, and at A. to E. and at A., B., F., G., and E. in FIG. 3 . In each of these methods, a photoreactive protective layer 36D is shown as being applied over a reactive region 29A in one of the recesses 22, and a different photoreactive protective layer 36D′ is shown as being applied over a reactive region 29B in a different recess 22. In this particular example, the reactive entity 34A in one of the recesses 22 is different from the reactive entity 34B in another of the recesses 22. As an example, the reactive entities 34A, 34B may be two different primer sets. However, it should be understood that in some examples, the same photoreactive protective layer 36D or 36D′ may be applied over each of the reactive regions 29A and 29B, and the same or different reactive entities 34A or 34B may be applied in two adjacent recesses 22.

[0286] At A, light (in the first light wavelength range L 1 The photoreactive protective layer 36D covering the reactive entity 34A is selectively removed by the light (indicated by the arrow at A.). It should be understood that the wavelength range L for removing the photoreactive protective layer 36D is 1 The light-reactive protective layer 36D will depend in part on the material used. For example, when the layer 36D comprises a material that absorbs blue to near infrared light, L 1 As a specific example, when layer 36D includes spherical gold nanoparticles (eg, when layer 36D is a composite material as described herein), L 1 As another specific example, when layer 36D includes gold nanorods, L 1 As another specific example, when layer 36D includes carbon nanodots, L 1 As yet another specific example, when layer 36D includes silver nanoparticles, L 1 The range of 400 nm to 550 nm can be indicated.

[0287] At B., a template strand 40 of the first library of template strands is introduced and seeded into reactive entity 34A.

[0288] When the method continues at C., the seeded template strands 40 will occupy a certain density of reactive entities 34A. Once seeding occurs, light (in the second light wavelength range L 2 The second light wavelength range L is shown by arrows at C. and F. to selectively remove the photoreactive protective layer 36D' covering the reactive entity 34B.2 The amount of light absorbed by layer 36D' will depend in part on the material used in layer 36D'. For example, when layer 36D' comprises a material that absorbs blue to near infrared light, L 2 As a specific example, when layer 36D' comprises spherical gold nanoparticles (eg, when layer 36D' is a composite material as described herein), L 2 As another specific example, when layer 36D' includes gold nanorods, L 2 As another specific example, when the layer 36D' includes carbon nanodots, L 2 As yet another specific example, when layer 36D' contains silver nanoparticles, L 2 The range of 400 nm to 550 nm can be indicated.

[0289] At D., another template strand 40' of the second library of template strands is introduced and seeded into the reactive entity 34B. In one example, the template strand 40' does not include an adaptor for hybridizing with the reactive entity 34A, and therefore will not be seeded in the recess 22 containing the reactive entity 34A. In this example, different recesses 22 may contain different reactive entities 34A, 34B (e.g., different primer sets), respectively. In another example, the recess 22 exposed during seeding of the template strand 40 may be smaller than the recess 22 exposed during seeding of the template strand 40'. In these cases, the template strand 40' may be spatially blocked from being seeded in the recess 22 containing the template strand 40.

[0290] When the same type of coating (e.g., 36D) is used with each reactive region 29A, 29B, the same wavelength of light is used to make the coating removable, and the selectivity of the removal is controlled by the light exposure (i.e., where the light is directed). Alternatively, when two different types of coatings 36D, 36D' are used to cover the respective reactive regions 29A, 29B, the same wavelength of light is used to make the coating removable, and the selectivity of the removal is controlled by the light exposure (i.e., where the light is directed). 1 , L 2 The coatings 36D, 36D' are removed by different wavelengths of light within the coating, and the selectivity of the removal is controlled by the responsiveness of the coatings 36D, 36D' to the different wavelengths of light.

[0291] Then, each of the seeded template strands 40, 40' is amplified and aggregated on the corresponding reactive entities 34A, 34B, respectively, as shown in E. This generates a first library template amplicon 42 in at least one of the recesses 22, and a second library template amplicon 42' in at least one other of the recesses 22.

[0292] When the method continues at F. (from B.), the seeded template strands 40 are amplified and clustered across the corresponding reactive entities 34A to produce first library template amplicons 42. Once clusters of amplicons 42 are generated using reactive entities 34A, light is used to selectively remove the photoreactive protective layer 36D' (also shown at F.) covering the reactive entities 34B. When a different coating 36D' is used, the light is in the second light wavelength range L. 2 or when the same coating 36D is used, the light is in the same wavelength range L 1 Inside.

[0293] At G., another template strand 40' of the second library of template strands is introduced and seeded into reactive entity 34B. The seeded template strand 40' is then amplified and aggregated across reactive entity 34B, as shown at E. This produces a second library template amplicon 42' in at least another of the recesses 22.

[0294] In still another example, when the substrate 16, 18 includes a plurality of protrusions 24, and each of the plurality of reactive regions 29B is formed by a corresponding one of the plurality of protrusions 22, and each of the independently removable coatings is a photoreactive protective layer 36D or 36D', selectively removing at least one of the plurality of independently removable coatings 36D or 36D' involves exposing at least one of the plurality of independently removable coatings 36D or 36D' to light without exposing at least one other independently removable coating of the independently removable coating 36D' or 36D to light, thereby allowing at least one of the plurality of independently removable coatings 36D or 36D' to be removable using an aqueous solvent.

[0295] In another example, when the photoreactive protective layer 36D is a single layer positioned above multiple reactive regions 29A or 29B, the method involves selectively removing at least a portion of the coating 36D by exposing a portion of the coating 36D to light without exposing other portions of the coating 36D to light, such that the portion can be removed using an aqueous solvent.

[0296] Although Figure 4 Specific examples are depicted regarding the types of reactions performed, but it should be understood that different reactions may be performed when utilizing different reactive entities 34. As an example, tagmentation may be performed when the reactive entity 34 is a transposome complex.

[0297] Digital Fluid Box

[0298] Another exemplary device that enables controlled access to reactive region 29C is Figure 7 The digital fluid box 50 shown includes a laminate film 44; a resin 46 positioned on the laminate film 44, the resin 46 being patterned with a plurality of spatially separated reactive regions 29C; a cover 48 attached to the bonding region 20 of the resin 46; a fluid channel 12' defined between the cover 48 and the resin 46; and a ground electrode 52 positioned on a surface of the cover 48 facing the fluid channel 12'.

[0299] The digital fluid cartridge 50 may be used in a digital fluid system 54 that includes a digital fluid instrument 56. The digital fluid instrument 56 includes a plurality of individually addressable control electrodes 58A, 58B, 58C.

[0300] exist Figure 7 In the example shown, the laminating film 44 can be polyethylene terephthalate or another thin plastic material. The thickness of the laminating film 44 can be in the range of about 30 μm to about 200 μm. The laminating film 44 can act as a carrier for the resin 46. The resin 46 can be any example of the resin material described herein (e.g., for layer 28), and the reactive region includes an example of a reactive entity 34 containing a polymer hydrogel 32 and attached to the polymer hydrogel 32 ( Figure 7 The recessed portion 22 of the polymer hydrogel and reactive entity (not shown) is shown.

[0301] The cover 48 can be any of the exemplary materials described herein and can be attached to the bonding area 20 by any of the barrier materials described herein.

[0302] Ground electrode 52 may be any conductive material capable of transmitting light used in the reactions occurring in reactive region 29C. As an example, ground electrode 52 may be poly(3,4-ethylenedioxythiophene) (PEDOT) or indium tin oxide (ITO).

[0303] The plurality of individually addressable control electrodes 58A, 58B, 58C may be defined in a non-conductive (ie, non-electrically conductive) substrate 62 of the instrument 56. Examples of non-conductive substrates 62 include glass, rubber, porcelain, ceramic, and some polymeric materials.

[0304] A plurality of individually addressable control electrodes 58A, 58B, 58C in the apparatus 56 enable region-selective movement of the droplets along the surface of the resin 46. Figure 7 As shown, the recessed portion 22 (containing the reactive area 29A) is positioned over the portion of the laminate film 44 that overlies the individually addressable control electrodes 58A, 58B, 58C. This positioning creates a selectively functionalized area.

[0305] FIG. 8A to FIG. 8C A top view of resin 46 of cartridge 50 is illustrated, respectively, with A) reactive regions 29C, 29D, 29E defined in three specific regions, B) an array of individually addressable control electrodes (e.g., including electrodes 58A, 58B, 58C, etc.) of instrument 56, and C) cartridge 50 positioned on instrument 56. Electronic circuitry electrically connected to each of electrodes 58A, 58B, 58C, etc. enables one or more of electrodes 58A, 58B, 58C, etc. to be addressed at a particular time. Thus, depending on which of electrodes 58A, 58B, 58C is addressed, an electrically responsive fluid may be directed to one of reactive regions 29C, 29D, 29E, but not to the other regions.

[0306] Terms

[0307] 1. A circulation cell, comprising:

[0308] substrate;

[0309] a plurality of reactive regions, the plurality of reactive regions being spatially separated from one another across the substrate, each of the plurality of reactive regions comprising:

[0310] a polymer hydrogel layer; and

[0311] a reactive entity attached to the polymer hydrogel layer; and

[0312] a plurality of independently removable coatings, the plurality of independently removable coatings being respectively disposed over each of the plurality of reactive regions;

[0313] Wherein at least one of the plurality of independently removable coatings is a composite material comprising a thermoresponsive polymer and a photothermal additive.

[0314] 2. A flow cell according to clause 1, wherein the reactive entity in each reactive area of ​​the plurality of reactive areas is a primer set.

[0315] 3. A flow cell according to clause 2, wherein the primer set is the same in each reactive area of ​​the plurality of reactive areas.

[0316] 4. A flow cell according to clause 2, wherein the primer set of at least one reactive area among the plurality of reactive areas is different from the primer set of at least another reactive area among the plurality of reactive areas.

[0317] 5. A flow cell according to any one of clauses 1 to 4, wherein:

[0318] The base includes a plurality of recessed portions;

[0319] Each of the plurality of reactive regions is located within a corresponding one of the plurality of recessed portions; and

[0320] Each of the plurality of independently removable coatings covers a corresponding one of the plurality of reactive regions.

[0321] 6. A flow cell according to any one of clauses 1 to 4, wherein:

[0322] The base includes a plurality of protrusions;

[0323] Each of the plurality of reactive regions is located at a corresponding one of the plurality of protrusions; and

[0324] Each of the plurality of independently removable coatings covers a corresponding one of the plurality of protrusions.

[0325] 7. A flow cell according to any one of clauses 1 to 6, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer and combinations thereof.

[0326] 8. The flow cell according to any one of clauses 1 to 7, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene and combinations thereof.

[0327] 9. A method comprising:

[0328] selectively removing at least one independently removable coating of a plurality of independently removable coatings, respectively located across a substrate over each of the plurality of reactive regions, the plurality of reactive regions being spatially separated from one another, thereby exposing at least one reactive region of a plurality of reactive regions and reactive entities at the at least one reactive region of the plurality of reactive regions;

[0329] wherein each of the plurality of reactive regions comprises a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; and

[0330] wherein at least one of the plurality of independently removable coatings is a composite material comprising a thermoresponsive polymer and a photothermal additive; and

[0331] A reaction involving the reactive entity is initiated.

[0332] 10. The method of clause 9, wherein selectively removing at least one independently removable coating of the plurality of independently removable coatings comprises:

[0333] exposing at least one of the plurality of independently removable coatings to light, thereby rendering the at least one of the plurality of independently removable coatings that has been exposed to light readily removable with an aqueous solvent; and

[0334] At least one independently removable coating of the plurality of independently removable coatings is removed using an aqueous solvent.

[0335] 11. A method according to clause 9 or clause 10, wherein:

[0336] The base includes a plurality of recessed portions;

[0337] Each of the plurality of reactive regions is located within a corresponding one of the plurality of recessed portions; and

[0338] Each of the plurality of independently removable coatings covers a corresponding one of the plurality of reactive regions.

[0339] 12. A method according to clause 9 or clause 10, wherein:

[0340] The base includes a plurality of protrusions;

[0341] Each of the plurality of reactive regions is located at a corresponding one of the plurality of protrusions; and

[0342] Each of the plurality of independently removable coatings covers a corresponding one of the plurality of protrusions.

[0343] 13. A method according to any one of clauses 9 to 12, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer and combinations thereof.

[0344] 14. The method according to any one of clauses 9 to 13, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene and combinations thereof.

[0345] 15. A method according to any one of clauses 9 to 14, wherein the reactive entity in each reactive region of the plurality of reactive regions is a primer set.

[0346] 16. The method of claim 15, wherein the primer set is identical in each of the plurality of reactive regions.

[0347] 17. The method of claim 15, wherein the primer set of at least one reactive region in the plurality of reactive regions is different from the primer set of at least one other reactive region in the plurality of reactive regions.

[0348] Additional Notes

[0349] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0350] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0351] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A circulation cell, comprising: substrate; a plurality of reactive regions, the plurality of reactive regions being spatially separated from one another across the substrate, each of the plurality of reactive regions comprising: a polymer hydrogel layer; and a reactive entity attached to the polymer hydrogel layer; and a plurality of independently removable coatings, the plurality of independently removable coatings being respectively located over each of the plurality of reactive regions; Wherein at least one of the plurality of independently removable coatings is a composite material comprising a thermoresponsive polymer and a photothermal additive. 2 . The flow cell of claim 1 , wherein the reactive entity in each of the plurality of reactive regions is a primer set. 3 . The flow cell of claim 2 , wherein the primer set is the same in each of the plurality of reactive regions. 4 . The flow cell of claim 2 , wherein the primer set for at least one of the plurality of reactive regions is different from the primer set for at least one other of the plurality of reactive regions.

5. The flow cell according to claim 1, wherein: The base includes a plurality of recessed portions; Each of the plurality of reactive regions is located within a corresponding one of the plurality of recessed portions; and Each of the plurality of independently removable coatings covers a corresponding one of the plurality of reactive regions.

6. The flow cell according to claim 1, wherein: The base includes a plurality of protrusions; Each of the plurality of reactive regions is located at a corresponding one of the plurality of protrusions; and Each of the plurality of independently removable coatings covers a corresponding one of the plurality of protrusions.

7. A flow cell according to claim 1, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer and combinations thereof.

8. The flow cell of claim 1, wherein the photothermal filler is selected from the group consisting of: Gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene, and combinations thereof.

9. A method comprising: selectively removing at least one independently removable coating of a plurality of independently removable coatings, respectively located across a substrate over each of the plurality of reactive regions, the plurality of reactive regions being spatially separated from one another, thereby exposing at least one reactive region of a plurality of reactive regions and reactive entities at the at least one reactive region of the plurality of reactive regions; wherein each of the plurality of reactive regions comprises a polymer hydrogel layer and the reactive entity attached to the polymer hydrogel layer; and wherein at least one of the plurality of independently removable coatings is a composite material comprising a thermally responsive polymer and a photothermal additive; as well as A reaction involving the reactive entity is initiated.

10. The method of claim 9, wherein selectively removing the at least one independently removable coating of the plurality of independently removable coatings comprises: exposing the at least one independently removable coating of the plurality of independently removable coatings to light, thereby rendering the at least one independently removable coating of the plurality of independently removable coatings that has been exposed to the light readily removable with an aqueous solvent; as well as The at least one independently removable coating of the plurality of independently removable coatings is removed using the aqueous solvent.

11. The method according to claim 9, wherein: The base includes a plurality of recessed portions; Each of the plurality of reactive regions is located within a corresponding one of the plurality of recessed portions; and Each of the plurality of independently removable coatings covers a corresponding one of the plurality of reactive regions.

12. The method according to claim 9, wherein: The base includes a plurality of protrusions; Each of the plurality of reactive regions is located at a corresponding one of the plurality of protrusions; and Each of the plurality of independently removable coatings covers a corresponding one of the plurality of protrusions.

13. The method of claim 9, wherein the thermoresponsive polymer is selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.

14. The method of claim 9, wherein the photothermal filler is selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole, graphene, carbon nanotubes, carbon nanodots, black phosphorus, azobenzene, and combinations thereof.

15. The method of claim 9, wherein the reactive entity in each of the plurality of reactive regions is a primer set.

16. The method of claim 15, wherein the primer set is identical in each of the plurality of reactive regions.

17. The method of claim 15, wherein the primer set for at least one reactive region of the plurality of reactive regions is different from the primer set for at least one other reactive region of the plurality of reactive regions.

Images