Adapter pruning and determination in next generation sequencing data analysis

Abstract

Provided herein are system, apparatus, method, and / or computer program product embodiments, and / or combinations and subcombinations thereof, that enable adapter pruning and / or adapter determination during sequencing data analysis. Based on the plurality of match scores, one or more sequence alignments are selected. Each match score of the plurality of match scores may be based on a first number of matched bases and a second total number of bases. A first consensus location and a second consensus location are generated by the one or more sequencing alignments. A pruned location is determined based on the first consensus location and the second consensus location and the first consensus match score and the second consensus match score.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 350,290, filed on June 8, 2022, which is hereby incorporated by reference in its entirety. Technical Field

[0003] The present disclosure relates to adapter trimming in DNA sequencing reads, and in particular to adapter trimming / determination in paired-end DNA sequencing reads. Background Art

[0004] In next generation sequencing (NGS) or NGS-like applications (such as sequencing by synthesis, sequencing by binding, or affinity sequencing), trimming adapters (or equivalently adapters, primers, or joints) from read data is a preprocessing step during sequencing data analysis. Adapters are chemically synthesized single-stranded or double-stranded short oligonucleotides that are added to one or both ends of the sequencing read. Adapters can provide multiple functions, including identifying the ends of sequencing reads and tethering DNA fragments to flow cells. Untrimmed adapters in read data may look like errors for downstream data analysis. It is not known in advance whether the read has been sequenced into the adapter, and if so, it is also not known how many bases of the adapter are included in the read. An adapter trimming method that can accurately and efficiently determine the trimming location is needed so as to trim all bases from the adapter without accidentally trimming any bases in the actual sequencing data. Summary of the invention

[0005] Provided herein are system, apparatus, method, and / or computer program product embodiments, and / or combinations and sub-combinations thereof, that enable adapter trimming and / or adapter determination during sequencing data analysis.Sequencing reads may come from different sequencing technologies.

[0006] As a specific application in this regard, provided herein are embodiments of methods, systems, and media for performing adapter trimming and / or determination from sequencing reads in order to accurately and reliably generate sequencing results.

[0007] Other embodiments of these aspects include corresponding computer systems, devices, and computer program products recorded on computer storage devices, which are configured, alone or in combination, to perform the actions or operations of the method. For a computer system that has been configured or is to be configured to perform an operation or action, the computer system has installed thereon software, firmware, hardware, or a combination thereof that causes the computer system to perform the operation or action in operation. For a computer program product that has been configured or is to be configured to perform an operation or action, the computer program product includes instructions that, when executed by a hardware processor, cause the hardware processor to perform the operation or action.

[0008] Further embodiments, features, and advantages of the present disclosure, as well as the structure and operation of various embodiments of the present disclosure are described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The accompanying drawings, which are incorporated herein and form a part of this specification, illustrate embodiments of the present disclosure and, together with the description, further serve to explain the principles of the present disclosure and enable those skilled in the art to make and use the embodiments.

[0010] Figure 1 Shown is a block diagram of a system for DNA sequencing and generating sequencing reads, adapter trimming, and adapter determination according to some embodiments.

[0011] Figure 2 A schematic diagram of two example sequencing reads with adapters is shown.

[0012] Figure 3A-3B The sensitivity, specificity and Table of comparison of coefficients.

[0013] Figure 4 A block diagram of a computer system for performing adapter trimming and adapter determination according to some embodiments is shown.

[0014] Figure 5A A flowchart of a method for performing adapter trimming according to some embodiments is shown.

[0015] Figure 5B Shown is a flowchart of a method for performing adaptor determination according to some embodiments.

[0016] Figures 6A-6E A comparison of adapter trimming results using the methods disclosed herein and existing methods according to some embodiments is shown.

[0017] Figure 7 is a schematic diagram showing an example linear single-stranded library molecule.

[0018] Figure 8 is a schematic diagram showing an example linear single-stranded library molecule.

[0019] Fig. 9 is a schematic diagram of various example configurations of multivalent molecules.

[0020] Fig.10 is a schematic diagram of an example multivalent molecule comprising a universal core linked to multiple nucleotide arms.

[0021] Fig.11 is a schematic diagram of an example multivalent molecule comprising a dendrimer core attached to multiple nucleotide arms.

[0022] Fig.12 A schematic diagram of an example multivalent molecule comprising a core linked to a plurality of nucleotide arms is shown, wherein the nucleotide arms comprise biotin, a spacer, a linker, and nucleotide units.

[0023] Fig.13 is a schematic diagram of an exemplary nucleotide arm comprising a core linking portion, a spacer, a linker, and a nucleotide unit.

[0024] Fig.14 Shown are the chemical structures of example spacers (top), as well as the chemical structures of various example linkers, including an 11-atom linker, a 16-atom linker, a 23-atom linker, and an N3 linker (bottom).

[0025] Fig.15 The chemical structures of various example linkers, including Linkers 1-9, are shown.

[0026] Fig.16 The chemical structures of various exemplary linkers joined / linked to nucleotide units are shown.

[0027] Fig.17 The chemical structures of various exemplary linkers joined / linked to nucleotide units are shown.

[0028] Fig.18 The chemical structures of various exemplary linkers joined / linked to nucleotide units are shown.

[0029] Fig.19 The chemical structures of various exemplary linkers joined / linked to nucleotide units are shown.

[0030] Fig. 20 The chemical structure of an example biotinylated nucleotide arm is shown. In this example, the nucleotide unit is linked to the linker via a propargylamine attachment at the 5 position of a pyrimidine base or at the 7 position of a purine base.

[0031] Fig.21A schematic diagram of one embodiment of a low binding solid support of the present disclosure is provided.

[0032] In the drawings, like reference numbers generally refer to the same or similar elements. In addition, generally, the leftmost digit(s) of a reference number can identify the drawing in which the reference number first appears. DETAILED DESCRIPTION

[0033] Provided herein are systems, devices, methods and / or computer program product embodiments and / or combinations and sub-combinations thereof, which enable adapter pruning and / or adapter determination of sequencing reads to generate accurate sequencing results. The techniques disclosed herein can be used for sequencing reads obtained from various imaging and / or sequencing technologies. These techniques can be used for sequencing reads obtained from various sequencing samples including two-dimensional (2D) and / or three-dimensional (3D) samples. The techniques disclosed herein can be used to exclude adapters in sequencing read results in NGS, and NGS sequencing reads will be used herein as preliminary examples for describing the application of these techniques. However, such adapter pruning techniques may also be useful in other applications.

[0034] In DNA sequencing, identifying the center of a cluster or community (which is usually formed on a bead) is sometimes referred to as a preliminary analysis. The preliminary analysis may include base calls, in which bases in the sequencing reads are identified to form ordered sequences of different bases, such as adenine (A), cytosine (C), guanine (G), and thymine (T). After the preliminary analysis and more specifically, after the base calls, embodiments of the technology disclosed herein may be used for adapter trimming of sequencing reads. There are a variety of algorithms for adapter trimming. These existing algorithms have various defects. For example, existing algorithms are not suitable for directly processing sequencing reads output from a sequencer, and trimming adapters may take a long time, at least several hours. As another example, adapter trimming using alignment accuracy as a threshold may not provide reliable results, because an accuracy threshold of 0.8 may satisfy 4 matches in 5 bases, but cannot satisfy 32 matches in 64 bases. However, the probability of randomly matching 32 bases in 64 bases is lower than the probability of randomly matching 4 bases in 5 bases. Additionally, when sequencing data includes insertions and deletions (indels), existing methods rely on complex insertion and deletion processing and additional trimming operations. When insertions and deletions are present, the additional trimming operations will bring additional computational costs and time consumption to trimming adapters.

[0035] Embodiments of the technology disclosed herein utilize random matching and probability distribution (such as binomial distribution) to replace the accuracy threshold in the existing method, and determine the possibility that the matched base is not randomly occurring. Embodiments of the technology disclosed herein advantageously process the sequencing reads directly in binary format after they are output from the sequencer, thereby eliminating the need to process the output from the sequencer into other formats, and saving the computational time for binary operations in the adapter pruning operation. Embodiments of the adapter pruning technology disclosed herein utilize 2, 3 or 4 alignments obtained from the forward and reverse reads in paired end sequencing and do not require additional insertion and deletion processing, because the insertion and deletion processing is inherent to the pruning method, so that the insertion and deletion in the insert or adapter will only affect some but not all alignments used, and the pruning location can still be accurately identified. In this way, these technologies allow for improved accuracy that is superior to existing methods, and significantly reduce computational complexity and reduce computational time, for example, from several hours to less than 10 minutes or even seconds.

[0036] Embodiments of the technology disclosed herein also advantageously determine adapter sequences based on determining possible adapter positioning and similarity of candidate adapter sequences. Determining adapter sequences using embodiments of the methods disclosed herein can be used to facilitate sequencing applications that use different sequencing kits or chemistries that rely on different adapters. Before any subsequent analysis occurs, adapter sequences can be determined using embodiments of the methods disclosed herein to check the accuracy and reliability of adapter sequences (e.g., adapter sequences manually entered in sequencing parameters). Embodiments of the adapter determination methods disclosed herein can also advantageously facilitate accurate adapter trimming, thereby improving errors caused by adapters in secondary analysis.

[0037] Sequencing system

[0038] Figure 1 A block diagram of a computer-implemented system 100 for generating sequencing reads, performing adapter trimming and / or adapter determination according to one or more embodiments disclosed herein is shown. The system 100 has a sequencing system 110, which includes a flow cell 112, a sequencer 114, an imager 116, a data storage device 122, and a user interface 124. The sequencing system 110 can be connected to a cloud 130. The sequencing system 110 can include one or more of the following: a dedicated processor 118, a field programmable gate array (FPGA) 120, and a computer system 126.

[0039] In some embodiments, the flow cell 112 is configured to capture DNA fragments and form a DNA sequence for base calling on the flow cell. The flow cell 112 may include a carrier disclosed herein. The carrier may be a solid phase carrier. As disclosed herein, the carrier may include a surface coating thereon. The surface coating may be a polymer coating as disclosed herein.

[0040] The flow cell 112 may include a plurality of tiles or imaging areas thereon, and each tile may be divided into a grid of sub-tiles. Each sub-tile may include a plurality of clusters or communities thereon. As a non-limiting example, the flow cell may have 424 tiles, and each tile may be divided into a 6x 9 grid, so there are 54 sub-tiles. The flow cell image disclosed herein may be an image of signals including a plurality of clusters or communities. The flow cell image may include one or more signal tiles or one or more signal sub-tiles. In some embodiments, the flow cell image may be an image including all tiles and approximately all signals thereon. The flow cell image may be acquired from the channel using an imager 116 during imaging or sequencing cycles. In some embodiments, each tile may include millions of communities or clusters. As a non-limiting example, the tile may include approximately 1,000 to 10 million clusters or communities. Each community may be a collection of many copies of DNA fragments. In some embodiments, each tile or sub-tile may include millions of communities or clusters. As a non-limiting example, the tile may include 1,000 to 10 million clusters or communities. Each colony can be a collection of many copies of DNA fragments. In some embodiments, the flow cell image can be an image including all tiles and approximately all signals thereon. The flow cell image can be acquired from the channel using imager 116 during imaging or sequencing cycles.

[0041] In the case where the in-situ sample (e.g., cell or tissue) is fixed on a carrier or flow cell, the flow cell image can be at multiple z levels, which are orthogonal to the image plane of the flow cell image. Specifically, for three-dimensional (3D) samples, such as cells, tissues or other in-situ samples, the flow cell image can include multiple z levels to cover the entire sample in a 3D manner. The z axis can extend from the objective lens of the optical system disclosed herein to the carrier, such as a flow cell. The axial axis can be orthogonal to the image plane of the flow cell image. Each z level of the flow cell image can be separated from the adjacent z level by a predetermined distance, for example, about 0.1um to about 15um. Each z level of the flow cell image can be separated from the adjacent level by 1um to 10um. At each z level, a flow cell image can be obtained from one or more sequencing cycles and / or one or more channels. Each flow cell image can include at least a portion of one or more tiles or sub-tiles of the flow cell in its field of view. FIG. 3 shows a portion of a flow cell 112 having a plurality of tiles 290. The image plane is defined by an x-axis and a y-axis. And the z axis is orthogonal to the xy plane. Although the flow cell image, sample and axial axis are described in a Cartesian coordinate system as shown in FIG3 , any other coordinate system may be used to define the spatial positions and relationships herein. Other coordinate systems may include, but are not limited to, polar, cylindrical or spherical coordinate systems.

[0042] Sequencer 114 can be configured to flow a mixture of nucleotides onto flow cell 112, cut blockers from nucleotides between flow steps, and perform other steps for forming a DNA sequence on flow cell 112. Nucleotide can have a fluorescent element connected, which emits light or energy at a wavelength indicating the type of nucleotide. Each type of fluorescent element can correspond to a specific nucleotide base (e.g., A, G, C, T). The fluorescent element can emit light of visible wavelengths. In certain embodiments, sequencer 114 and flow cell 112 can be configured to perform various sequencing methods disclosed herein, e.g., affibody sequencing.

[0043] For example, each nucleotide base can be assigned a color. Different types of nucleotides can have different colors. For example, adenine (A) can be red, cytosine (C) can be blue, guanine (G) can be green, and thymine (T) can be yellow. The color or wavelength of the fluorescent element for each nucleotide can be selected so that the nucleotides can be distinguished from each other based on the wavelength of light emitted by the fluorescent element.

[0044] Imager 116 can be configured to capture images of flow cell 112 after each flow step. In one embodiment, imager 116 is a camera configured to capture digital images, such as an active pixel sensor (CMOS) or a charge coupled device (CCD) camera. The camera can be configured to capture images of the wavelengths of the fluorescent elements combined with nucleotides. These images can be referred to as flow cell images.

[0045] In some embodiments, imager 116 may include one or more optical systems disclosed herein. The optical system may be configured to capture optical signals from the flow cell and generate corresponding digital images. The digital images may then be used for base calling.

[0046] In one embodiment, images of the flow cell can be captured in groups, where each image in the group is taken at a wavelength or spectrum that matches or includes only one of the fluorescent elements. In another embodiment, the images can be captured as a single image that captures all wavelengths of the fluorescent elements.

[0047] The resolution of the imager 116 controls the level of detail in the flow cell image, including the pixel size. In existing systems, this resolution is very important because it controls the accuracy of the point finding algorithm in identifying the center of the colony. In some embodiments, the image resolution of the flow cell image disclosed herein can be about 10 nanometers (nm) to hundreds of nm or higher. One way to improve the accuracy of point finding is to improve the resolution of the imager 116 (for example, by merging a higher resolution camera), or to improve the processing of the image taken by the imager 116. Detection of the center of the colony in pixels other than those detected by the point finding algorithm can be performed. These methods can allow the accuracy of colony center detection to be improved without increasing the resolution of the imager 116. The resolution of the imager can even be lower than that of existing systems with comparable performance, which can reduce the cost of the sequencing system 110. In some aspects, the resolution of the imager may be the same as that of the existing system, but due to image processing, its performance is superior to that of the existing system.

[0048] The image quality of the flow cell image controls the base calling quality.One way to improve the accuracy of base calling is to improve the imager 116, or improve the processing of the images taken by the imager 116, to obtain better image quality.

[0049] After performing base calls, the sequencing reads can be output from the system to the cloud 130 or computer system 400, if certain processing is selected for the base call results. The sequencing reads herein can be forward reads (R1), reverse reads (R2), or both. The sequencing reads herein can be any ordered sequence of A, T, C, and G bases.

[0050] In some embodiments, sequencing reads may be transferred directly to computer system 126 for adapter trimming.

[0051] These adapter pruning methods can be advantageously performed in parallel in the computer system 400 without interfering with or delaying the existing sequencing workflow of the system 100. The results of the adapter pruning can be used to generate sequencing results for the user. Some or all of the operations disclosed herein can be advantageously performed by an FPGA, and data can be transferred between the CPU and the FPGA to reduce the total operation time of the method that does not use FPGA operations. In addition, the methods disclosed herein do not process alignments in standard formats such as A, T, C, G, but advantageously process sequencing data in a binary format, where each base is represented by several binary bits, to significantly speed up the adapter pruning process, so that depending on the size of the data, pruning can be completed within a time range of a few seconds to a few minutes.

[0052] The operations or actions disclosed herein may be performed by a dedicated processor 118, FPGA 120, computing system 126, or a combination thereof. One or more operations or actions in the methods 500, 600 disclosed herein may be performed by a dedicated processor 118, FPGA 120, computing system 126, or a combination thereof. In some embodiments, which operations or actions are to be performed by a dedicated processor 118, FPGA 120, computing system 126, or a combination thereof may be determined based on one or more of the following: computation time for a particular operation, complexity of computation in a particular operation, need for data transfer between hardware devices, or a combination thereof.

[0053] The computing system 126 may include one or more general-purpose computers that provide operating systems such as Windows TM or Linux TM An interface for running various programs in an operating system such as . Such an operating system typically provides users with great flexibility.

[0054] In some embodiments, a dedicated processor 118 may be configured to perform operations in the adapter pruning method. A dedicated processor may not be a general purpose processor, but a custom processor with specific hardware or instructions for performing these steps. A dedicated processor runs specific software directly without an operating system. The lack of an operating system reduces overhead, but at the expense of the flexibility that the processor can perform. A dedicated processor can use a custom programming language that can be designed to operate more efficiently than software running on a general purpose computer. This can increase the speed of executing steps and allow real-time processing.

[0055] In some embodiments, FPGA 120 can be configured to perform the operations of the adapter pruning method herein. FPGAs are programmed as hardware that will only perform specific tasks. Special programming languages ​​can be used to convert software steps into hardware components. Once the FPGA is programmed, the hardware directly processes the digital data provided to it without running software. In contrast, FPGAs use logic gates and registers to process digital data. Since the operating system does not require any overhead, FPGAs typically process data faster than general-purpose computers. Similar to special-purpose processors, this comes at the expense of flexibility.

[0056] The lack of software overhead may also allow FPGAs to operate faster than dedicated processors, although this will depend on the exact processing to be performed and the specific FPGA and dedicated processor.

[0057] A group of FPGAs 120 can be configured to perform these steps in parallel. For example, many FPGAs 120 can be configured to perform processing steps for selected areas in an image, a set of images, a sub-tile, or one or more images. Each FPGA 120 can perform its own portion of the processing steps simultaneously, thereby reducing the time required to process data. This can allow the processing steps to be completed in real time. Further discussion of the use of FPGAs is provided below.

[0058] Performing processing steps in real time can allow the system to use less storage because data can be processed as it is received. This is an improvement over conventional systems that may need to store data before processing it, which may require more storage or access to a computer system located in the cloud 130.

[0059] In some embodiments, the data storage device 122 is used to store information used in the adapter trimming method. This information may include sequencing reads and adapters themselves or information that can be used during the adapter trimming operation (e.g., pixel intensity, color, etc.). For example, a probability lookup table as disclosed herein can be stored in the data storage device 122. The DNA sequence determined after adapter trimming can be stored in the data storage device 122. Compressed and / or uncompressed sequencing data can be stored in the data storage device. FASTQ files can also be stored in the data storage device 122.

[0060] User interface 124 may be used by a user to operate the sequencing system or access data stored in data storage device 122 or computer system 126 .

[0061] The computer system 126 can control the general operation of the sequencing system and can be coupled to the user interface 124. The computer system can also perform steps in adapter trimming and its preceding and / or subsequent operations, such as base calling, demultiplexing, etc. In some embodiments, the computer system 126 is a computer system 400, such as Figure 4 Computer system 126 may store information about the operation of sequencing system 110, such as configuration information, instructions for operating sequencing system 110, or user information. Computer system 126 may be configured to transfer information between sequencing system 110 and cloud 130.

[0062] As discussed above, the sequencing system 110 can have a dedicated processor 118, an FPGA 120, or a computer system 126. The sequencing system can use one, two, or all of these elements to complete the necessary processing described above. In some embodiments, when these elements exist together, the processing tasks are divided between them. For example, the FPGA 120 can be used to perform some or all of the following: operations before adapter trimming, adapter trimming, and subsequent operations, while the computer system 126 can perform other processing functions for the sequencing system 110. Those skilled in the art will appreciate that various combinations of these elements will allow for various system embodiments that balance the efficiency and speed of processing with the cost of the processing elements.

[0063] Cloud 130 may be a network, a remote storage device, or some other remote computing system separate from sequencing system 110. Connection to cloud 130 may allow access to data stored external to sequencing system 110 or allow software in sequencing system 110 to be updated.

[0064] Adaptor trimming

[0065] Figure 5A A flowchart of an example embodiment of a computer-implemented method 500 for adapter trimming of sequencing reads is shown. The method 500 may include some or all of the operations disclosed herein. The operations may be performed in the order described herein, but not limited to.

[0066] Method 500 may be performed by one or more processors disclosed herein. In some embodiments, the processor may include one or more of the following: a processing unit, an integrated circuit, or a combination thereof. For example, the processing unit may include a central processing unit (CPU) and / or a graphics processing unit (GPU). The integrated circuit may include chips such as a field programmable gate array (FPGA). In some embodiments, the processor may include computing system 400.

[0067] In some embodiments, some or all of the operations in method 500 may be performed by an FPGA. In an embodiment, when some operations are performed by an FPGA, the data after the operations are performed by the FPGA may be transmitted by the FPGA to the CPU so that the CPU may use such data to perform subsequent operations in method 500. Similarly, data may also be transmitted from the CPU to the FPGA for processing by the FPGA. In some embodiments, all of the operations in method 500 may be performed by the CPU. Alternatively, the operations performed by the CPU may be performed by other processors (such as a dedicated processor) or a GPU. In some embodiments, all of the operations in method 500 may be performed by an FPGA.

[0068] In some embodiments, method 500 is configured to trim, clip, or otherwise remove adapters from sequencing reads. Sequencing reads can be determined by analyzing a flow cell image generated by system 100. In some embodiments, method 500 is performed after performing a preliminary analysis and generating sequencing reads from system 100. In some embodiments, method 500 is performed after demultiplexing. In some embodiments, method 500 is performed before demultiplexing.

[0069] In some embodiments, method 500 is performed after cycle N has been completed, and the sequencing and image acquisition of cycle N+1 have not been performed. In some embodiments, method 500 is performed after the entire sequence run is completed. In some embodiments, cycle N is the current cycle. N can be any non-zero integer. In some embodiments, cycle N is the cycle after the cycle corresponding to the adapter. In some embodiments, cycle N can be determined based on the adapter length and / or sequence insert length. The sequence insert is a portion containing the DNA fragment of interest from the sequencing sample. In some embodiments, if the insert length is within a certain range, for example, 100 to 150, cycle N can be determined. For example, N can be any integer from 30 to 300 or 20 to 400. In some embodiments, N is not the last cycle in the sequencing run. In some embodiments, N is the first half or the first third of the total number of sequencing cycles in the sequencing run. In some embodiments, method 500 is performed when the sequencing run is executed. In some embodiments, if the adapter length and / or sequence insert length are known in advance before cycle N, the results of method 500 and adapter trimming or adapter determination can be used to determine whether the ongoing sequencing run should be stopped.

[0070] The flow cell images can be acquired from one of 1, 2, 3, 4 or more channels of the imager 116 using the optical system disclosed herein. Each flow cell image can include one or more tiles (imaging areas), and each tile can be divided into multiple sub-tiles. Each sub-tile can include multiple colonies. Each sub-tile can include multiple regions, where each region includes several colonies. The flow cell images disclosed herein can be acquired using the optical system disclosed herein. Figure 1 An image acquired by the flow cell 112 is shown.

[0071] The flow cell 112 may include a sample fixed thereon. The sample may include a plurality of nucleic acid template molecules. The sample may include a 2D or 3D volume sample. The nucleic acid template molecules may be randomly or in various patterns distributed on the flow cell 112. In some embodiments, multiple colonies or clusters herein may be extracted from a specific region of a tile (e.g., each sub-tile). In the case of each sub-tile, a colony may be extracted in a predetermined pattern or randomly.

[0072] In certain embodiments, the colony or cluster sequenced in the flow cycle can have a certain nucleotide diversity. The nucleotide diversity of the nucleotide acid molecule population (for example, colony or cluster) can refer to the relative ratio of the nucleotide A, G, C and T / U present in each flow cycle. The best high or balanced diversity data can generally have the roughly equal ratio of all four nucleotides represented in each flow cycle of the sequencing run. Low or unbalanced diversity data can generally include some nucleotides of high proportion and other nucleotides of low proportion in some flow cycles of the sequencing run, for example, less than 10% of the total number of all 4 nucleotides. Therefore, compared with the image corresponding to some nucleotides of low proportion, the image corresponding to some nucleotides of high proportion can have more signal points (colony or cluster). As an example of low or unbalanced diversity data in the flow cycle, in a certain flow cycle, base A, T, C, G can be respectively about 1%, about 2%, about 1% and about 95% of the total number of colonies. As another example of low or unbalanced diversity data, base A, T, C, G in the colony in multiple flow cycles can be respectively about 2%, about 5%, about 10% and about 83%. In embodiments where low or unbalanced diversity data is present in a particular cycle and is imaged for sequencing analysis, base calls may be prone to errors and existing techniques for adaptor trimming or determination may fail because errors in base calls may cause insertions, deletions of nucleotide bases in the sequence reads.

[0073] In addition to base biases that affect diversity, complexity may also be a factor that affects image registration. Typically, complexity can indicate the source of the sample. A single sample may include DNA fragments or molecules from the same sample region or the same sample source in the genome. Multiple samples may include DNA fragments or molecules from different sample sources, such as liver, kidney, heart, cancer tissue, etc., or from one or more sample regions in the genome. When complexity is lower than a certain number (e.g., 8 or 16), the signal may be low diversity. For example, in a 2-cycle sequence, all communities are AT or TG or GC or CA. Each base accounts for 25% of the total number of bases in this cycle, but its complexity is less than 8, and the sequence is not completely random. Even if the sequencing read is generated by low-diversity data, method 500 can accurately trim and / or determine adapters.

[0074] In some embodiments, method 500 may include operation 510 of selecting one or more alignments from:

[0075] a first alignment resulting from (a) aligning a tail 212 of a first sequenced read with a head 221 of a second sequenced read at one or more first locations;

[0076] a second alignment resulting from (b) aligning the tail 222 of the second sequenced read with the head 211 of the first sequenced read at one or more second locations;

[0077] a third alignment resulting from (c) aligning the first adaptor 213 to the tail 212 of the first sequencing read at one or more third locations; and

[0078] A fourth alignment resulting from (d) aligning the second adaptor 223 to the tail 222 of the second sequencing read at one or more fourth locations.

[0079] Figure 2 Schematic diagram of example sequencing reads disclosed herein according to some embodiments is shown. Sequencing reads 200 can be generated by system 100 and transmitted to a processor within system 100. Alternatively, sequencing reads can be output by system 100 to a cloud or processor external to system 100, for example, computer system 400.

[0080] In some embodiments, each of the first sequencing read 210, the second sequencing read 220, the head 211 of the first sequencing read, the head 221 of the second sequencing read, the tail 212 of the first sequencing read, the tail 222 of the second sequencing read, the first adapter 213, and the second adapter 223 comprises a nucleotide base sequence. The nucleotide base sequence can be an ordered sequence, and each base can be one of four different bases, for example, A, G, C, T / U. The base sequence can be low diversity, so that one or more of the bases only appear at less than 10%, as disclosed herein.

[0081] The sequencing reads may be generated, for example, from a paired end sequencing run by preliminary analysis. The sequencing reads may not have been demultiplexed. In some embodiments, the sequencing reads may have been demultiplexed. Each run may include multiple paired sequencing reads 200. For example, a single run may include different numbers of sequencing reads, for example, 100 to 10 8 Sequencing reads. The amount of sequencing data, e.g., 100,000 paired-end sequencing reads, each of which has a length ranging from about 30 bases to about 300 bases, and its processing, handling, and recording require computationally efficient and time-efficient methods such as the methods disclosed herein to facilitate sequencing analysis, e.g., secondary analysis. In some embodiments, some or all of the sequencing reads 200 in a sequence run can be processed using the methods 500 herein for adapter trimming.

[0082] The sequencing read 200 may include a forward read (R1) 210 and a reverse read (R2) 220. The forward read 210 and the reverse read 220 may include an insert having a head portion 211, 221 and a tail portion 212, 222. The reads 210, 220 may have adapters 213, 223 connected to or otherwise connected to the tails 212, 222. The insert is a base sequence of interest. In some embodiments, the reads 210, 220 may have adapters connected to or otherwise connected to the heads 212, 222 (not shown). In some embodiments, the reads 210, 220 may have adapters connected to or otherwise connected to both the heads 211, 221 and the tails 212, 222 (not shown). The first adapter 213 may be a 3' adapter, and the second adapter 223 may be a 5' adapter.

[0083] In some embodiments, the inserts in the reads 210, 220 may have different numbers of A, G, C, T / U bases, ranging from about 8 bases to about 500 bases. In some embodiments, the inserts in the reads 210, 220 may have any base number ranging from about 16 bases to about 500 bases. In some embodiments, the inserts in the reads 210, 220 may have any base number ranging from about 16 bases to about 500 bases. In some embodiments, the inserts in the reads 210, 220 may have any base number ranging from about 32 bases to about 400 bases. In some embodiments, the inserts in the reads 210, 220 may have any base number ranging from about 64 bases to about 250 bases. In some embodiments, the inserts in the forward reads 210 and the inserts in the reverse reads 220 may be of the same length. In some embodiments, the inserts in the forward reads 210 and the inserts in the reverse reads 220 may be of different lengths.

[0084] In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 8 bases to about 200 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 16 bases to about 150 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 16 bases to about 80 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 16 bases to about 64 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 is in the range of about 16 bases to about 32 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 has at least 16 bases. In some embodiments, the number of bases of each of the header 211, 221 and the tail 212, 222 may be different. In some embodiments, the number of bases of two or more of the header 211, 221 and the tail 212, 222 may be the same.

[0085] In some embodiments, the first adaptor 213 and / or the second adaptor 223 have about 4 bases to about 100 bases. In some embodiments, the first adaptor 213 and / or the second adaptor 223 have about 4 bases to about 64 bases. The first adaptor or the second adaptor may have about 16 bases to about 64 bases. The first adaptor or the second adaptor may have about 16 bases to about 40 bases. In some embodiments, the first adaptor 213 and / or the second adaptor 223 have about 30, about 31, about 32, about 33 or about 34 bases. In some embodiments, the first adaptor 213 and / or the second adaptor 223 have 30, 31, 32, 33 or 34 bases. The first adaptor 213 and / or the second adaptor 223 may have at least 16 bases. The first adaptor 213 and the second adaptor 223 may have the same number of bases. In some embodiments, the first adaptor 213 and the second adaptor 223 can have different numbers of bases. For example, the first adaptor can have more bases than the second adaptor 223.

[0086] In some embodiments, operation 510 may include selecting all four alignments, ie, the first alignment from (a), the second alignment from (b), the third alignment from (c), and the fourth alignment from (d) disclosed herein.

[0087] In some embodiments, selecting the first alignment from (a) aligning the tail 212 of the first sequencing read with the head 221 of the second sequencing read at one or more first locations includes an operation of obtaining the reverse complementary base of the head of the second sequencing read. Subsequently, method 500 may include an operation of aligning the reverse complementary base of the head of the second sequencing read with the tail of the first sequencing read at a certain location and calculating the matching score at the location, and then moving the reverse complementary base of the head of the second sequencing read relative to the tail of the first sequencing read by one base to the next location, and repeatedly calculating the matching score at the next location. Such movement relative to each other and calculation of matching scores can be repeated to cover all locations from aligning 1 base to aligning all possible bases from the tail of the first sequencing read to the head of the second sequencing read. Subsequently, the first alignment can be selected based on the matching score at one or more first alignment locations.

[0088] For example, in the sequencing read of 2x 20 bases, R1 is CCTCGATCCCAGATCGGAGA, and R2 is CCGATCTGTGATCGAGGAGA, which is the reverse complement of R1 with 1 sequencing error. The last 3 bases are bases from adapters. In this embodiment, the head of the R2 read is the reverse complement of the first 10 bases of R2. Therefore, the R2 head is CACAGATCGG. The R2 head is aligned with the tail of R1, and moves towards the head of R1 (moving from right to left) by base at different alignments such as 1 base alignment, 2 base alignments. When there are 10 base alignments, there will be multiple alignments, because the R2 head can continue to move to the left, so as to align with all the different options of the 10 bases in R1. As the R2 head continues to move by base, the matching score is calculated at each different alignment. When the R2 head moves towards the head of R1 by base, a total of 20 or more matching scores can be calculated. When the R2 head is aligned with bases 8 to 17 in R1, the first alignment is determined as follows:

[0089] R1 read segment: CCTCGATCCCAGATCGGAGA

[0090] R2 head: CACAGATCGG

[0091] The first alignment is determined based on the match scores at all possible alignment positions. In the case of the first alignment, there are 10 aligned bases, 9 of the 10 are matching bases, so n=10, M=9.

[0092] The match score is based on the first number of matched bases in the first alignment and the second total number of aligned bases. In this example, there are 9 matched bases out of a total of 10 aligned bases. In some embodiments, the match score is based on the probability that the first number of matched bases is not a random occurrence. In some embodiments, the match score is based on the probability that the first number of matched bases in the total number of aligned bases is not a random occurrence.

[0093] In some embodiments, the match score includes probability, i.e., a constant minus the cumulative distribution function (CDF) of the variable m. The variable m can have different distributions, such as binomial distribution. The binomial distribution can be determined by the total number n of aligned bases and the probability p of randomly matching bases in the alignment. In this particular example, p is to make the base randomly match 4 different bases, so p is 0.25, and the distribution is binomial (n, 0.25). The CDF of variable m is P (m> = M), where M is the number of matching bases. In some embodiments, the match score is CP (m> = M), where C is a constant, M is the first matching base number, m is a variable with a binomial distribution, i.e., binomial (n, p), n is the total number of aligned bases, and p is the probability of making the base randomly match a certain number of different bases. When the constant is set to 1 and the match score is greater than about 0.99000, about 0.99900, about 0.99990 or about 0.99999. In some embodiments, the match score is greater than 0.99000, 0.99900, 0.99990, or 0.99999.

[0094] In some embodiments, the variable m can have a binomial distribution. In some embodiments, the base composition can be estimated and a multinomial distribution can be used. In some embodiments, a different binomial can be used in each cycle so that the binomial distribution is scaled by the expected or learned error rate per cycle. When the distribution of m is different from the binomial distribution disclosed herein, the match score and consensus match score disclosed herein can also be similarly determined by replacing the binomial distribution with other distributions.

[0095] In some embodiments, the match score may be selected as the highest match score among all match scores at the possible alignment. In some embodiments, the match score may be selected as a score above a predetermined threshold. In some embodiments, the match score may be the highest of all match scores and also meets the predetermined threshold. In this particular example, at the possible alignment of the tail of the R1 read and the head of the R2 read, the match score of the first alignment is the highest of all match scores. The match score is calculated as 1-P(m>=9), where the distribution of m is Binom(10,0.25), and the value of the score is 0.999970436.

[0096] Similarly, as with the first alignment, a second alignment can also be determined. The R1 header can be similarly defined as the reverse complement of the first 10 bases of R1. In this particular example, the R1 header is GGGATCGAGG. The second alignment with the highest match score is to align the R1 header from the 8th base to the 17th base of the R2 read as follows:

[0097] R2 read segment: CCGATCTGTGATCGAGGAGA

[0098] R1 head: GGGATCGAGG

[0099] The matching score is calculated as 1-P(m>=9), where m~Binom(10,0.25), and the value of the score is 0.999970436.

[0100] Similarly, the third alignment can be selected from (c) aligning the first adaptor 213 to the tail 212 of the first sequencing read at one or more third locations. In this particular example, the third alignment with the highest match score is aligning the first adaptor from the 10th base to the 20th base of the R1 read as follows:

[0101] R1 read segment: CCTCGATCCCAGATCGGAGA

[0102] First adapter: AGATCGGAAG

[0103] The match score is calculated as 1-P(m>=8), where m~Binom(10,0.25), and the value of the score is 0.999584197. The third alignment is spurious and does not indicate trim positioning.

[0104] The fourth alignment comes from (d) aligning the second adaptor 223 to the tail 222 of the second sequencing read. In this particular example, the fourth alignment with the highest match score is aligning the second adaptor from base 17 to base 20 of the R2 read as follows:

[0105] R2 read segment: CCGATCTGTGATCGAGGAGA

[0106] Second adapter: AGATCGGAAG

[0107] The match score is calculated as 1-P(m>=3), where m~Binom(3,0.25), and the value of the score is 0.984375. The fourth alignment indicates the correct trim positioning.

[0108] In some embodiments, method 500 may include operations for obtaining a first sequencing read having a first adapter and a second sequencing read having a second adapter. The reads may be obtained from sequencing system 110. More specifically, the reads may come directly from sequencer 114, data storage device 122, or any processor, such as 120, 118, and / or 126. Alternatively, the reads may be obtained from cloud 130 external to sequencing system 110.

[0109] In some embodiments, sequencing reads are obtained directly, so the format of the bases in the reads does not require additional formatting or preprocessing. For example, the reads can be obtained directly in binary format. Each base in one or more of the following: the head of the first sequencing read; the head of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adapter; and the second adapter can be represented as an integer. Such integers can be bitwise integers with a number of binary bits. For example, each base can be represented as a 4-bit binary number.

[0110] In some embodiments, in the case where the base is a binary number with multiple bits, the reverse complement, the alignment of the base, and the determination of the matching base in the operation disclosed herein can all be advantageously performed using bitwise operations. Compared with the operation disclosed herein using different base formats, bitwise operations can significantly speed up the speed of the same operation. Compared with existing adapter trimming methods, bitwise operations can also significantly reduce computing time. For example, the operation here takes a few seconds to a few minutes to perform adapter trimming, while the existing method may take several hours to trim the adapter, and its accuracy is also lower than the accuracy of the method disclosed herein. In some embodiments, method 500 may include operation 520, that is, using the first alignment and the third alignment to generate a first consensus positioning and using the second alignment and the fourth alignment to generate a second consensus positioning.

[0111] In some embodiments, operation 520 comprises determining a first adapter location according to the first alignment and determining a second adapter location according to the third alignment. The first adapter location or the second adapter location can indicate the ending location of the insert of the read and the starting location of the adapter base. For example, the first adapter location can be that the adapter starts at the 17th base of the R1 read.

[0112] In response to determining that the first adaptor location is consistent with the second adaptor location, operation 520 includes determining the first consensus location as the first adaptor location.

[0113] In response to determining that the first adapter positioning is inconsistent with the second adapter positioning, the first adapter positioning or the second adapter positioning can be used as the first consensus positioning. In this particular example, the first adapter positioning indicates that the last 3 bases of the R1 read are from the adapter. The second adapter positioning indicates that the 10 bases at the end of the R1 read are from the adapter. The two adapter positionings from the first alignment and the third alignment are inconsistent with each other. The first consensus positioning can be the first adapter positioning or the second adapter positioning. Additional steps described herein can be taken to determine which of the first adapter positioning or the second adapter positioning can be used as the first consensus positioning.

[0114] The method 500 may include an operation of determining a first consensus match score based on the first alignment and the third alignment.

[0115] In response to determining that the first alignment and the third alignment are consistent in the positioning of the adapter, the method of determining the first consensus match score may include determining the first consensus match score as 1-P(m>=M1+M3) based on the first matching base sum from the first alignment and the third alignment and the second total base sum, where m has a binomial distribution (n1+n3,p). For example, the match score is considered to be the sum of the matching bases and the total number of aligned bases, so that if there are 3 matches out of 3 bases in the first alignment and 9 matches out of 10 bases, respectively, the match score can be 1-P(m>=12), where m~binomial (13,p) indicates that there are a total of 12 matches out of 13 total aligned bases.

[0116] In response to determining that the first alignment and the third alignment do not agree on the adapter positioning, the operation of determining a first consensus match score may include: determining a first candidate match score based on (1) the first adapter positioning obtained from the first alignment and (2) a first sum of matched bases and a second sum of total bases aligning the first adapter with the tail of the first sequencing read at the first adapter positioning indicated in the first alignment assuming that the first adapter positioning is valid. Continuing with the example above, according to (1) the first adapter positioning, there are 9 out of 10 matching bases. According to (2), the first adapter is aligned with the tail of the first sequencing read as follows:

[0117] R1 read segment: CCTCGATCCCAGATCGGAGA

[0118] First adapter: AGATCGGAAG

[0119] There are 3 matching bases out of 3 bases. The first candidate match score can be determined based on 9+3 matching bases out of 10+3 bases. In this example, the first candidate match score is 1-P(m>=12), where the distribution of m is Binom(13,0.25). The first candidate match score is 0.9999994039535522.

[0120] The operation of determining a first consensus match score may include determining a second candidate match score based on (1) a second adapter location obtained from the third alignment and (2) assuming that the third alignment is valid, aligning the tail of the first sequencing read with the head of the second sequencing read at the second adapter location and the first total base sum. Continuing with the example above, according to (1) the second adapter location, 8 out of 10 matching bases. According to (2), the tail of the first sequencing read is aligned with the head of the second sequencing read at the second adapter location as follows:

[0121] R1 read segment: CCTCGATCCCAGATCGGAGA

[0122] R2 head: CACAGATCGG

[0123] Thus, as indicated in Figure (1), there are 10 bases from the adaptor. It is seen that 5 of the 10 bases match at this second adaptor location. The second candidate match score can be determined based on 8+5 matching bases out of 10+10 bases. In this example, the first candidate match score is 1-P(m>=13), where the distribution of m is Binom(20,0.25). The second candidate match score is 0.9998162959418551.

[0124] The operation of determining a first consensus match score may include selecting a score from the first candidate match score and the second candidate match score as the first consensus score. The selected score may be a higher score. The selected score may be a score that is higher and meets a predetermined threshold. Continuing with the example above, the first candidate score is higher than the second candidate score, so the first consensus score is the first candidate score.

[0125] In some embodiments, operation 520 includes generating a second consensus position using the second alignment and the fourth alignment. In some embodiments, operation 520 includes generating a third adaptor position based on the second alignment and generating a fourth adaptor position based on the fourth alignment. The third adaptor position or the fourth adaptor position can indicate the ending position of the insert of the read and the starting position of the adaptor base. For example, the third adaptor position can be that the adaptor starts at the 15th base of the R1 read.

[0126] In response to determining that the third adaptor location is consistent with the fourth adaptor location, operation 520 includes determining the second consensus location as the third adaptor location.

[0127] In response to determining that the second alignment and the fourth alignment are consistent in the adapter positioning, operation 520 includes determining a second consensus match score based on the third sum of matched bases from the second alignment and the fourth alignment and the fourth total sum of bases. Continuing with the example above, the third sum of matched bases from the second alignment and the fourth alignment is 3+9, and the total number of bases is 10+30, so the second consensus match score is 0.9999994039535522.

[0128] In response to determining that the second alignment and the fourth alignment are consistent in the adapter positioning, operation 520 includes determining a third candidate match score based on the third adapter positioning obtained from (1) the second alignment and (s) the third sum of matched bases and the fourth total sum of bases from aligning the second adapter with the tail of the second sequencing read at the third adapter positioning assuming that the third adapter positioning is valid. Operation 520 may further include determining a fourth candidate match score based on the fourth adapter positioning obtained from (1) the fourth alignment and (2) the third sum of matched bases and the fourth total sum of bases from aligning the tail of the second sequencing read with the head of the first sequencing read at the fourth adapter positioning by assuming that the fourth adapter positioning is valid. In some embodiments, operation 520 may further include selecting a score from the third candidate match score and the fourth candidate match score as the second consensus score. The selected score can be a higher score from the third candidate match score and the fourth candidate match score. The selected score can also meet a predetermined threshold.

[0129] In some embodiments, method 500 includes an operation of determining a trimmed position based on a first consensus position, a second consensus position, a first consensus match score, and a second consensus match score. If the first consensus position and the second consensus position are consistent with each other, the trimmed position can be determined as a consistent position. In response to determining that the first consensus position and the second consensus position are different, the position with a higher consensus score can be selected as the trimmed position. In the example above, the first consensus position and the second consensus position indicate that the last 3 bases of the R1 read and the R2 read are from the adapter, and the consensus match score is the same, so the trimmed position is at the last 3 bases. In this way, the trimmed sequencing read becomes:

[0130] R1 read segment: CCTCGATCCCAGATCGG

[0131] R2 read segment: CCGATCTGTGATCGAGG

[0132] In some embodiments, the probability P(m>M) can be pre-calculated, where m has a binomial distribution as Binom(n,p). For each M in the range [0,n] and each m in the range [0,M], P(m>M) or P(m>=M) can be pre-calculated and saved, for example, in a table. The table can be used as a lookup table, so that for each pair of M and n, there is a unique table element corresponding to it, namely the value of P(m>M). For example, the lookup table can have column numbers corresponding to the value of M, and row numbers corresponding to the value of n. Pre-calculating the lookup table can save computation time during adapter trimming and can be conveniently reused in adapter trimming within a run or across different runs. In some embodiments, P(m>=M) is the probability of randomly observing at least M matches out of a total of n bases (the maximum possible number of matches). P(m>M) is the probability of randomly observing greater than M matches out of a total of n bases (the maximum possible number of matches).

[0133] In some embodiments, the computer-implemented method 500 may include an operation of performing one or more pre-processing steps prior to operation 510 .

[0134] In some embodiments, the operation of performing one or more pre-processing steps can be performed by FPGA. In some embodiments, the data after the operation can be transmitted by FPGA to CPU so that CPU can use such data to perform subsequent operations in method 500.

[0135] One or more pre-processing steps may include background subtraction. Background subtraction is configured to remove at least some background signals that may interfere with the signal of interest, i.e., the image intensity of the colony. Background signals may be noise caused by multiple sources, including flow cell 112, imager 115, sequencer 114, and other sources. Background subtraction may be adjusted to avoid excessive subtraction.

[0136] One or more pre-processing steps may include image sharpening to optimize the image intensity of the colonies in view of their surroundings in the flow cell image. For example, sharpening may be performed using a Laplacian of Gaussian (LoG) filter.

[0137] One or more pre-processing steps may include image registration so that the image intensities of the populations are registered relative to each other. For example, the image intensities may be registered with a template as described herein.

[0138] One or more pre-processing steps may include intensity offset adjustment, which may remove intensity offset that was not removed during background subtraction.

[0139] One or more pre-processing steps may include color correction to remove interference to one channel from other channels or colors.

[0140] One or more pre-processing steps may include lag and lead corrections configured to correct image intensity within a particular cycle by eliminating intensity bias caused by sequencing of DNA fragments that are out of sync with other fragments due to lagging or leading.

[0141] One or more pre-processing steps may include intensity normalization to normalize image intensities of populations from different channels to be within a predetermined range.

[0142] One or more pre-processing steps may include quality score estimation so that the quality of base calls made using flow cell images acquired by imager 116 can be estimated before the actual base calls are performed.

[0143] One or more pre-processing steps may include base calling using various base calling algorithms.After base calling, each community may have multiple DNA fragments as multiple base sequences.

[0144] One or more pre-processing steps may include saving the sequencing reads to a sequencing system or an external data storage device (such as a cloud). In some embodiments, the sequencing reads may be saved directly in a binary format. In some embodiments, after base calling, the sequencing reads are generated in a binary format and saved directly in the same binary format. The method 500 disclosed herein can advantageously obtain sequencing reads and perform the adapter trimming operations disclosed herein directly in a binary format without the need for additional processing to convert the binary format to a different format as is typically done by existing adapter trimmers.

[0145] In some embodiments, prior to operation 510, method 500 includes an operation of obtaining, by a processor herein, a plurality of sequencing reads. Such an obtaining operation may include actively retrieving or passively receiving a plurality of sequencing reads after generating and recording base calls. The sequencing reads may be from a completed or ongoing sequencing run. Each sequencing read may be a paired end sequencing read.

[0146] In some embodiments, method 500 includes an operation of trimming the first sequenced read, the second sequenced read, or both at a trim location.

[0147] In some embodiments, method 500 includes an operation of converting the pruned first sequencing reads, the pruned second sequencing reads, or both, to a predetermined format that is not a binary format.

[0148] In some embodiments, method 500 includes an operation of recording the pruned first sequencing reads, the pruned second sequencing reads, or both in a predetermined format in a data storage device, which may be part of the sequencing system 100 or located external to the sequencing system 100. For example, the pruned sequencing reads may be saved to a data storage device on a user's computer system 400 external to the sequencing system 100.

[0149] In some embodiments, method 500 includes transmitting the pruned first sequencing read, pruned second sequencing read, or both in a predetermined format to a processing unit. In some embodiments, the pruned sequencing read can be transmitted to the user's computer system 400. In some embodiments, the processing unit is a central processing unit (CPU). In some embodiments, the processing unit (e.g., the user's computer 400) is configured to generate sequencing results based on the pruned first sequencing read, pruned second sequencing read, or both in a predetermined format to display to the user. In some embodiments, method 500 includes generating or outputting sequencing results (including multiple sequencing reads), and the user can rely on the results to perform genetic determination without errors caused by adapters. The predetermined format is a format that is not binary, but a displayable format, and is more easily perceived by the user than a binary format.

[0150] Figure 3A-3B A simulation of the results of adapter trimming using the methods disclosed herein and existing adapter trimmers in a simulated sequencing run is shown. "b2f(PE)" indicates the method disclosed herein, using the 4 alignments selected from (a)-(d) in operation 510. "b2f(original)" indicates "original " method, which uses the 4 alignments selected from (a)-(d) in operation 510 and has an accuracy threshold, for example, 90% matching bases are higher than 70% matching bases, without using random matching and binomial distribution. "cutadapt" and "fastp" are two existing adapter trimming methods. Table 1 shows that in a simulated sequencing run using about 20k paired-end reads, the method disclosed herein has the highest sensitivity and The highest coefficient. The coefficient is a parameter that can indicate the parameters of the pruning quality calculated based on the confusion matrix (including true positives, true negatives, false positives and false negatives). The specificity of the method disclosed in this article is the second highest. However, the calculation time or running time of the method of the present invention is faster, only a few seconds to less than 10 minutes, while "cutadapt" and "fastp" may take at least several hours.

[0151] The methods disclosed herein advantageously eliminate the need for additional indel processing for adapter trimming. Indel processing can be inherent to the methods disclosed herein. For example, if there is an indel in the adapter, the third alignment and the fourth alignment from (c) and (d) may be affected, and thus the corresponding match scores may deteriorate. However, the first alignment (a) and the second alignment (b) are not affected and can produce higher match scores, thereby producing an accurate estimate of the adapter positioning. When there is an indel in the insert rather than the adapter, the first alignment (a) and the second alignment (b) may be affected by the indel, but the other alignments can still produce an accurate estimate of the adapter positioning. Table 2 ( Figure 3A Figure 3 (middle) shows the quality of adapter trimming in the presence of indels (i.e., insertions and / or deletions in adapters and inserts) in a simulated sequencing run with approximately 100k paired-end reads. Among the four methods compared, the method disclosed herein has the highest sensitivity and the highest The computation time or running time of the method of the present invention is faster, taking only a few seconds to less than 10 minutes, while "cutadapt" and "fastp" may take at least several hours.

[0152] The methods disclosed herein advantageously work with asymmetric read lengths when indels may occur anywhere in a read. In a simulated sequencing run with about 100k paired-end reads, the length of the read (or number of sequencing cycles) can vary from about 70 bases to about 180 bases. Table 3 (in Figure 3B The method disclosed in this paper has the highest sensitivity and the highest The coefficient and specificity are the second highest among the four different methods.

[0153] Fig. 6AReceiver operating characteristic (ROC) curves of the methods disclosed herein compared with other existing methods when analyzing the same adapter trimmed data set are shown. The ROC curve is generated by plotting the true positive rate relative to the false positive rate under various threshold settings. The ROC curve can show the change of sensitivity or recall rate with the false alarm rate (fall-out). Different simulation runs are performed using different matching score thresholds. The "b2f-PE" accuracy thresholds are: 0.995, 0.999, 0.9995, 0.9999, 0.99995, 0.99999, 0.999999, 0.9999999, and 0.99999999, each for a separate simulated sequencing run. The "b2f-original" accuracy thresholds are: 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, and 0.95. The maximum error of "cutadapt" was set to: 0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.15, 0.1 and 0.05. There was no accuracy threshold available for "fastp". Among all 4 methods, the method disclosed herein, labeled "bases2fastq-PE", had the best ROC curve, indicating that the method disclosed herein outperformed existing methods in terms of accuracy and sensitivity.

[0154] Figure 6B-6E Figure 2 shows the sensitivity comparison of the four different methods in simulation runs when different insert sizes were present indel scenarios, including: deletions in the adapter ( Figure 6B ), insertion in the adapter ( Figure 6C ), deletions in insertions ( Fig.6D ), Insertion in Insertion ( Fig. 6E ). The method disclosed herein, i.e., the "b2f_PE" method, has the highest sensitivity among all the methods across different insertion sizes in different indel scenarios.

[0155] The embodiments disclosed herein focus on adapters attached to the tail or 3' end of a sequencing read. However, it is worth noting that in embodiments in which the adapter is attached to the head or 5' end of a sequencing read, operations can be similarly performed by aligning the adapter to the head of the sequencing read to correspondingly change the third alignment and the fourth alignment, so that in operation 510, the third alignment is selected from (c) aligning the first adapter to the head of the first sequencing read at one or more third locations; and the fourth alignment is selected from (d) aligning the second adapter to the head of the second sequencing read at one or more fourth locations.

[0156] In some embodiments, operation 510 may include selecting all four alignments, ie, the first alignment from (a), the second alignment from (b), the third alignment from (c), and the fourth alignment from (d) disclosed herein.

[0157] In some embodiments, operation 510 may be simplified to include selecting less than 4 alignments, such as 3 alignments. In some embodiments, the 3 alignments may be:

[0158] The first alignment from (a), the second alignment from (b), and the third alignment from (c);

[0159] The first alignment from (a), the third alignment from (c), and the fourth alignment from (d);

[0160] a first alignment from (a), a second alignment from (b), and a fourth alignment from (d); or

[0161] The second alignment from (b), the third alignment from (c), and the fourth alignment from (d).

[0162] In an embodiment using three alignments, if only one alignment is available instead of two alignments, the operation 520 of generating a first consensus location or a second consensus location can be simplified so that the sum of matched bases and the sum of total bases are replaced by the matched bases and the total bases from the available single alignment. For example, if the first consensus location is calculated based on the first alignment and the third alignment, and the third alignment is not used, then the bases determined according to the first alignment are used instead of the sum of bases. Similarly, the operation of determining the first consensus match score and / or the second consensus match score is equivalent to determining the match score of the available single alignment instead of using two alignments. Other operations using three alignments can remain the same as the method using four alignments.

[0163] Using 2 or 3 alignments instead of 4 can simplify the method and reduce the computational burden and time to perform the adapter trimming operation. However, this may be more error-prone and may not provide results as accurate as using 4 alignments.

[0164] Adaptor determination

[0165] Figure 5B A flow chart of a computer-implemented method 600 for adaptor determination after base calls have been generated during sequencing analysis according to some embodiments is shown. The method 600 may include some or all of the operations disclosed herein. The operations may be performed in the order described herein, but not limited to.

[0166] Method 600 may be performed by one or more processors disclosed herein. In some embodiments, the processor may include one or more of the following: a processing unit, an integrated circuit, or a combination thereof. For example, the processing unit may include a central processing unit (CPU) and / or a graphics processing unit (GPU). The integrated circuit may include chips such as a field programmable gate array (FPGA). In some embodiments, the processor may include computing system 400.

[0167] In some embodiments, some or all of the operations in method 600 may be performed by an FPGA. In an embodiment, when some operations are performed by an FPGA, the data after the operations are performed by the FPGA may be transmitted by the FPGA to the CPU so that the CPU may use such data to perform subsequent operations in method 600. Similarly, data may also be transmitted from the CPU to the FPGA for processing by the FPGA. In some embodiments, all of the operations in method 600 may be performed by the CPU. Alternatively, the operations performed by the CPU may be performed by other processors (such as a dedicated processor) or a GPU. In some embodiments, all of the operations in method 600 may be performed by an FPGA.

[0168] In some embodiments, method 600 is performed after cycle N has been completed, and the sequencing and image acquisition of cycle N+1 have not yet been performed. Method 600 is performed after the entire sequence run is completed. In some embodiments, cycle N is the current cycle. N can be any non-zero integer. In some embodiments, cycle N can be determined based on the length of the adapter and / or the length of the sequence insert. In some embodiments, cycle N is the cycle after the cycle corresponding to the adapter. In some embodiments, if the insert length is within a certain range, for example, 100 to 150, cycle N can be determined. For example, N can be any integer from 30 to 300 or 20 to 400. In some embodiments, N is not the last cycle in the sequencing run. In some embodiments, N is the first half or the first third of the total number of sequencing cycles in the sequencing run. In some embodiments, method 600 is performed when the sequencing run is performed. In some embodiments, if the adapter length or the insert length is known in advance before cycle N, method 600 is performed and the result of the adapter trimming or adapter determination is used to determine whether the ongoing sequencing run should be stopped.

[0169] Method 600 may include operation 610, i.e., obtaining a plurality of sequencing reads by a processor herein. The sequencing reads may be from a completed or ongoing sequencing run. Each sequencing read may be a paired-end sequencing read. Each paired-end sequencing read may include a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read includes a nucleotide base sequence. Figure 2Example paired-end sequencing reads are shown, namely, read 1 (R1) and read 2 (R2).

[0170] The sequence reads may be generated by the system 100 and transmitted to a processor within the system 100. Alternatively, the sequence reads may be output by the system 100 to a cloud or processor external to the system 100, such as the computer system 400.

[0171] Sequencing reads can be generated, for example, from a paired end sequencing run by preliminary analysis. The sequencing reads may not have been demultiplexed. In some embodiments, the sequencing reads may have been demultiplexed. Each sequence run may include multiple paired sequencing reads. For example, a single run may include different numbers of sequencing reads, for example, 100 to 10 8 The amount of sequencing data, e.g., 100,000 paired-end sequencing reads, where each read is in the range of about 30 bases to about 300 bases in length, and its processing, handling, and recording require computationally efficient and time-efficient methods, such as those disclosed herein, to facilitate sequencing analysis, e.g., secondary analysis.

[0172] Figure 2 A schematic diagram of paired end sequencing reads according to an embodiment disclosed herein is shown. In some embodiments, each of the first sequencing read 210, the second sequencing read 220, the head 211 of the first sequencing read, the head 221 of the second sequencing read, the tail 212 of the first sequencing read, the tail 222 of the second sequencing read, the first adapter 213, and the second adapter 223 comprises a nucleotide base sequence. The base sequence can be an ordered sequence, and each base can be one of four different bases, i.e., A, C, G, and T / U. Each sequence read can include one base per cycle per community or cluster. In one or more cycles, the diversity of the base sequence may be low or unbalanced, so that one or more types of bases are less than 10%, 8%, 5%, or 2% of the total number of bases in this cycle.

[0173] Sequencing reads 200 can come from paired end sequencing runs. Each run can include multiple paired sequencing reads 200. For example, a single run can include about 100k paired end sequencing reads. The amount of sequencing data, for example, 100k paired end sequencing reads, wherein the length of each read is in the range of about 50 bases to about 400 bases, and its processing (processing), processing (handling) and recording require computationally efficient and time-effective methods such as the methods disclosed herein. Sequencing reads 200 can include forward reads (R1) 210 and reverse reads (R2) 220. Forward reads 210 and reverse reads 220 can include inserts having head portions 211, 221 and tail portions 212, 222. Reads 210, 220 can have adapters 213, 223 connected to tails 212, 222 or otherwise connected. Inserts are base sequences of interest. In some embodiments, the reads 210, 220 can have adapters connected or otherwise connected to the heads 212, 222 (not shown). In some embodiments, the reads 210, 220 can have adapters connected or otherwise connected to both the heads 211, 221 and the tails 212, 222 (not shown). The first adapter 213 can be a 3' adapter, and the second adapter 223 can be a 5' adapter.

[0174] In some embodiments, the insert in the reads 210, 220 may have any base number ranging from about 8 bases to about 400 bases. In some embodiments, the insert in the reads 210, 220 may have any base number ranging from about 16 bases to about 400 bases. In some embodiments, the insert in the reads 210, 220 may have any base number ranging from about 16 bases to about 300 bases. In some embodiments, the insert in the reads 210, 220 may have any base number ranging from about 32 bases to about 200 bases. In some embodiments, the insert in the reads 210, 220 may have any base number ranging from about 64 bases to about 150 bases. In some embodiments, the insert in the forward read 210 and the insert in the reverse read 220 may be of the same length. In some embodiments, the insert in the forward read 210 and the insert in the reverse read 220 may be of different lengths.

[0175] In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 8 bases to about 200 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 16 bases to about 150 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 16 bases to about 80 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 can be in the range of about 16 bases to about 64 bases. In some embodiments, the number of bases of the head 211, 221 and / or the tail 212, 222 is in the range of about 16 bases to about 32 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 has at least 16 bases. In some embodiments, the number of bases of each of the header 211, 221 and the tail 212, 222 may be different. In some embodiments, the number of bases of two or more of the header 211, 221 and the tail 212, 222 may be the same.

[0176] In some embodiments, the first adaptor 213 and / or the second adaptor 223 have about 4 bases to about 100 bases. In some embodiments, the first adaptor 213 and / or the second adaptor 223 have about 4 bases to about 64 bases. The first adaptor or the second adaptor may have about 16 bases to about 64 bases. The first adaptor or the second adaptor may have about 16 bases to about 40 bases. In some embodiments, the first adaptor 213 and / or the second adaptor 223 have about 30, about 31, about 32, about 33 or about 34 bases. In some embodiments, the first adaptor 213 and / or the second adaptor 223 have 30, 31, 32, 33 or 34 bases. The first adaptor 213 and / or the second adaptor 223 may have at least 16 bases. The first adaptor 213 and the second adaptor 223 may have the same number of bases. In some embodiments, the first adaptor 213 and the second adaptor 223 can have different numbers of bases. For example, the first adaptor can have more bases than the second adaptor 223.

[0177] Exemplary first and second sequenced reads are shown as R1 reads and R2 reads with respect to method 500 herein.

[0178] In some embodiments, method 600 may include operation 620 of selecting one or more alignments from:

[0179] a first alignment resulting from (a) aligning the tail 212 of the first sequenced read with the head 221 of the second sequenced read at one or more first locations; and

[0180] A second alignment, the second alignment resulting from (b) aligning the tail 222 of the second sequenced read with the head 211 of the first sequenced read at one or more second locations.

[0181] In some embodiments, operation 620 may include selecting two alignments, a first alignment from (a) and a second alignment from (b).

[0182] In some embodiments, selecting the first alignment from (a) aligning the tail 212 of the first sequencing read with the head 221 of the second sequencing read at one or more first locations includes: obtaining the reverse complementary base of the head of the second sequencing read. Subsequently, selecting the first alignment from (a) may include aligning the reverse complement of the head of the second sequencing read with the tail of the first sequencing read at a certain location and calculating the matching score at the location, and then moving the reverse complementary base of the head of the second sequencing read relative to the tail of the first sequencing read by one base to the next location, and repeating the calculation of the matching score at the next location. Such movement of two sequences relative to each other and calculation of matching scores can be repeated to cover all possible different locations from a single base on one end of the alignment to aligning all possible bases of the tail of the first sequencing read with the head of the second sequencing read, and then to a single base on the other end of the sequence of aligned nucleotide bases. Subsequently, the first alignment can be selected based on the matching score at one or more first alignment locations.

[0183] In some embodiments, operation 620 comprises determining, by a processor, an adapter location based on a plurality of match scores, each match score being calculated based on a first number of matched bases and a second total number of bases at one or more first locations and one or more second locations. The adapter location can be a nucleotide base location, where the adapter begins and the inserted portion of the sequence read ends. The adapter location is estimated using operation 620. In some embodiments, operation 620 comprises determining, by a processor, an adapter location based on a maximum match score from a plurality of match scores. In some embodiments, operation 620 comprises determining, by a processor, an adapter location based on one or more match scores from a plurality of match scores that meet a predetermined threshold.

[0184] For example, in the sequencing read of 2x 20 bases, R1 is CCTCGATCCCAGATCGGAGA, and R2 is CCGATCTGTGATCGAGGAGA, which is the reverse complement of R1 with 1 sequencing error. The last 3 bases of R1 and R2 are used as bases from adapters. In this embodiment, the head of the R2 read is the reverse complement of the first 10 bases of R2. Therefore, the R2 head is CACAGATCGG. Then, the determined R2 head is aligned with the tail of R1, and moves towards the head of R1 (moving from right to left) by base at different alignments such as 1 base alignment, 2 base alignments. When there are 10 base alignments, there will be multiple alignments, because the R2 head can continue to move to the left, so as to align with all the different options of the 10 bases in R1. As the R2 head continues to move by base, the matching score is calculated at each different alignment. When the R2 head is aligned with bases 8 to 17 in R1, the first alignment is determined as follows:

[0185] R1 read segment: CCTCGATCCCAGATCGGAGA

[0186] R2 head: CACAGATCGG

[0187] The first alignment is determined based on the match scores at all possible alignment positions. There are 10 aligned bases in total, and the maximum match score is 9 out of 10 matching bases, so n=10, M=9.

[0188] The match score is based on the first number of matched bases in the first alignment and the second total number of aligned bases. In this example, there are 9 matched bases out of a total of 10 aligned bases. In some embodiments, the match score is based on the probability that the first number of matched bases is not a random occurrence. In some embodiments, the match score is based on the probability that the first number of matched bases in the total number of aligned bases is not a random occurrence.

[0189] In some embodiments, the match scores herein are calculated similarly using the methods disclosed with respect to method 500 .

[0190] Similarly, as with the first alignment, a second alignment can also be determined. The R1 header can be similarly defined as the reverse complement of the first 10 bases of R1. In this particular example, the R1 header is GGGATCGAGG. The second alignment with the highest match score is to align the R1 header from the 8th base to the 17th base of the R2 read as follows:

[0191] R2 read segment: CCGATCTGTGATCGAGGAGA

[0192] R1 head: GGGATCGAGG

[0193] Based on the first alignment with the highest score and the second alignment with the highest match score, the adapter is located from base 18 to base 20 of the R1 read and the R2 read. Therefore, the insert length determined from both the first alignment and the second alignment is consistent and is 17 bases.

[0194] The method 600 may include an operation 630 of obtaining, by a processor, a plurality of adapter sequences from the plurality of paired-end sequencing reads based on the determined adapter locations in operation 620. At the 18th base of the R1 and R2 reads, the adapter sequence begins with 3 bases AGA for both the 3' and 5' adapter sequences. The adapter sequence may be any base sequence that is trimmed at the determined adapter location in operation 620.

[0195] In some embodiments, the first sequence read and the second sequence read comprise only one adaptor, e.g., a 3' or 5' adaptor. In some embodiments, the first sequence read and the second sequence read comprise two or more different adaptors. In some embodiments, the first sequence read and the second sequence read comprise two or more identical adaptors. In some embodiments, the adaptor herein comprises 4 to 96 bases. In some embodiments, the adaptor comprises 6 to 48 bases.

[0196] In some embodiments, method 600 includes operation 640, i.e., repeatedly performing one or more operations to determine what the adapter sequence obtained from operation 630 is, until a stop criterion is met. Operation 640 may include: operation 641, i.e., selecting a seed adapter sequence from a plurality of adapter sequences; operation 642, i.e., determining one or more adapter sequences from the plurality of adapter sequences that meet a similarity threshold compared to the seed adapter sequence; operation 643, i.e., determining the A, G, C, or T / U base of each base position based on the corresponding counts of different bases at the corresponding base positions of the one or more determined adapter sequences and a predetermined threshold, thereby generating a separate candidate adapter; and operation 644, i.e., removing the seed adapter sequence and the one or more determined adapter sequences from the plurality of adapter sequences.

[0197] In some embodiments, method 600 may further include an operation of forwarding, by the processor, the individual candidate adapters to a memory device, a display, or both.

[0198] The user can define a stop criterion. For example, the stop criterion can be that all adapter sequences have passed through operations 641 to 644 at least once and there are no other sequences in the adapter sequence pool obtained in operation 630.

[0199] The similarity of two sequences can be determined using various methods. For example, the similarity threshold is determined by one or more of the following: Hamming distance, Smith-Waterman algorithm, and Needleman-Wunsch algorithm. In embodiments where the similarity is determined by the Hamming distance, a Hamming distance of 3 or 4 can be a similarity threshold for an adapter sequence of 30 to 40 bases.

[0200] Method 600 may further include operation 643 of determining an A, G, C, or T / U base of one or more base locations based on corresponding counts of different bases at corresponding base locations of one or more determined adapter sequences and a predetermined threshold.

[0201] In response to determining that n base mappings out of the total number of mappings do not meet a predetermined threshold, the seed adapter sequence and one or more determined adapter sequences are removed from the plurality of adapter sequences without generating a candidate adapter.

[0202] In some embodiments, the predetermined threshold comprises a consistency of greater than 50%, 55%, 60% or more in the total number of bases at the corresponding base location. In some embodiments, the predetermined threshold further comprises that one or more adapter sequences comprise at least 30, 40, 50, 60, 80, 100 or more sequences. In some embodiments, the predetermined threshold further comprises that one or more adapter sequences comprise at least 30, 40, 50, 60, 80, 100 or more identical base counts in a specific base location. For example, at the first base location, 55 of the 60 total observations are A, and 5 of the observations are the other three bases, satisfying the predetermined threshold, i.e., the count of 50 identical bases, and the first base location is A. As another example, in the first base location, 100 of the 300 total observations are G, and since the consistency of greater than 50% is not met, method 600 cannot determine that the first base is G. When there are more than a predetermined number of base locations, for example, 5, 6 or more base locations that cannot be determined of the adapter, the seed adapter sequence and one or more determined adapter sequences can be removed from multiple adapter sequences without generating candidate adapters. When there are less than a predetermined number of base locations, for example, only 1 or 2 base locations that cannot be determined of the adapter, the seed adapter sequence and one or more determined adapter sequences can be removed from multiple adapter sequences and can still generate candidate adapter sequences with 1 or 2 undetermined base locations. The predetermined number of undetermined bases can be 1, 2, 3, 4, 5 or more. The predetermined number of undetermined bases can be the percentage of undetermined bases. For example, the percentage of undetermined bases is less than 20%. 15%, 10%, 5%, 2% or 1% of the total number of bases. For example, there are 2 undetermined bases in a total of 20 bases, and the percentage of undetermined bases is 10%.

[0203] In some embodiments, method 600 further comprises selecting a second seed adapter sequence from the plurality of adapter sequences; and determining one or more second adapter sequences in the plurality of adapter sequences that satisfy a similarity threshold compared to the second seed adapter sequence, and then repeating operations 643-644 for the second seed adapter sequence.

[0204] In some embodiments, method 600 includes the operations of selecting a second seed adapter sequence from a plurality of adapter sequences; and in response to determining that no adapter sequence in the plurality of adapter sequences satisfies a similarity threshold compared to the second seed adapter sequence, removing the second seed adapter sequence from the plurality of adapter sequences without generating a candidate adapter.

[0205] Exemplary adapter determination repeat operations 641-644

[0206] In this particular example, consider a sequencing run performed using the following two adapter sequences: AAAA and TTTT.

[0207] Using operations 610-630, the following adapter sequences are found: 1) AAAG; 2) AATA; 3) AAAA; 4) TGCT; 5) TTTT; 6) TATT; 7) TTTT; 8) AAAA; 9) AAAA; 10) AAAA; 11) TTTT; 12) CTTT; 13) ACAG; and 14) TGTA. In the first iteration of operations 641-644, the first sequence AAAG is considered a seed sequence. The first seed sequence can be randomly selected from the pool of adapter sequences. Using a similarity metric (e.g., Hamming distance), all other sequences in the pool are processed, and the following 6 sequences match the seed sequence and meet the similarity threshold: AAAG; AATA; AAAA; AAAA; AAAA; and AAAA. For each sequence that meets the similarity threshold compared to the seed sequence (e.g., within a Hamming distance of 1 of the seed sequence), the base count at each base position for each of the 4 different types of bases is determined. In this example, base counts are determined using a base frequency matrix, i.e., [number of base locations x different bases] (4 x 4 in this example), where the bases are ordered as C, A, G, T. For 6 sequences similar to the seed, the matrix is: [0,6,0,0; 0,6,0,0; 0,5,0,1; 0,5,1,0]. The first row "0,6,0,0" means that for the first base location, there are 0 C, 6 A, 0 G, and 0 T. For each base location or row, the base is determined when there are at least 4 observations and at least 75% agreement. Therefore, the detected adapter is AAAA.

[0208] After determining the first adapter sequence, all sequences matching the seed AAAG and seed sequence are removed from the sequence pool. After removal, the sequence now includes: TTCT; TTTT; TATT; TTTT; TTTT; CTTT; ACAG; and TGTA.

[0209] Repeat operations 641-644, TTCT is the next seed sequence. The sequences that meet the similarity threshold include: TTCT; TTTT; TATT; TTTT; TTTT; and CTTT.

[0210] The base counts for each base mapping were: [1,0,0,5; 0,1,0,5; 1,0,0,5; 0,0,0,6]. Using the same predetermined thresholds (at least 4 occurrences and 75% identity), the detected adapter was TTTT.

[0211] After removing all sequences that match the previous seed, the list of observations is reduced to two: ACAG; and TGTA. ACAG is set as the next seed sequence. No other sequence matches ACAG that meets the similarity threshold, so ACAG is removed from the list. And a new repetition begins. TGTA is now set as the seed sequence. But there are no more sequences in the pool, so TGTA can also be removed from the pool. And operation 640 is completed, and the stopping criterion is that there are no more sequences in the pool that have not undergone 641-644. Two different sequences are detected: AAAA and TTTT. These two different sequences can be forwarded to the user and / or used for adapter trimming of sequencing reads.

[0212] In some embodiments, method 600 further includes the following operations: a processor trims a separate candidate adapter from a plurality of paired end sequencing reads, thereby generating a plurality of pruned sequencing reads. In some embodiments, since the candidate adapter sequence has been determined, the trimming operation can be accurate and reliable, and the trimming is performed only when a complete match is found at the trimming location with one of the candidate adapter sequences determined in operation 640. In some embodiments, the trimming operation can be performed with optional fault tolerance. The optional fault tolerance rate can be customized based on the adapter sequence length, sequencing kit, or various other factors. For example, the optional fault tolerance rate can be 1 mismatched base, 1 deletion, 1 insertion, or a combination thereof.

[0213] In some embodiments, method 600 further comprises: performing, by the processor, a secondary analysis on the plurality of pruned sequencing reads. In some embodiments, method 600 further comprises: forwarding, by the processor, the plurality of pruned sequencing reads to a remote processor for secondary analysis. In some embodiments, method 600 further comprises: forwarding, by the processor, the plurality of pruned sequencing reads to a local FPGA within system 100 for secondary analysis.

[0214] In some embodiments, method 600 further includes: trimming the first sequencing read, the second sequencing read, or both at the trimming location; converting the trimmed first sequencing read, the trimmed second sequencing read, or both to a predetermined format by a processor; and recording the trimmed first sequencing read, the trimmed second sequencing read, or both in the predetermined format by the processor. In some embodiments, method 600 further includes: transmitting the trimmed first sequencing read, the trimmed second sequencing read, or both in the predetermined format to a processing unit by the processor. The processing unit can be located within system 100 or remote from the system.

[0215] In some embodiments, before operation 610, method 600 further includes: generating the first sequencing read, the second sequencing read, or both by performing one or more preliminary analysis steps on the flow cell image by the processor. The one or more preliminary analysis steps performed on the flow cell image include: background subtraction; image sharpening; intensity offset adjustment; color correction; intensity normalization; lag and lead correction; image registration; intensity normalization; quality score estimation; or a combination thereof.

[0216] In some embodiments, to reduce computational complexity and / or increase computational speed, each base in one or more of the following: the head of the first sequencing read; the head of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adapter; and the second adapter are represented as an integer, a bitwise integer, or a binary number with a fixed number of bits (e.g., 4 bits or 8 bits).

[0217] In some embodiments, methods 500, 600 herein may include providing an operation of providing a plurality of nucleic acid template molecules fixed on a carrier (e.g., a flow cell). Each nucleic acid template molecule may contain an insertion sequence of interest. The insertion sequences in different template molecules may be different. Each template molecule may correspond to an optical signal community in a flow cell image.

[0218] In certain embodiments, methods 500, 600 may include the operation of generating a flow cell image by carrying out one or more cycles of sequencing reactions to a plurality of nucleic acid template molecules fixed on a carrier. The flow cell image may be generated or obtained by a sequencing system disclosed herein. The sequencing reactions carried out in one or more cycles may include: contacting a plurality of nucleic acid template molecules using a variety of nucleotide reagents, the mixtures of the various nucleotide reagents comprising different types of nucleotide bases A, G, C and T / U. Independent nucleotide reagents may include different detectable color labels corresponding to each different type of nucleotide bases.

[0219] In some embodiments, performing one or more cycles of sequencing reactions may include: contacting a plurality of nucleotide acid template molecules with a mixture of a plurality of sequencing primers, a plurality of polymerases, and different types of affimers. A single affimer in the mixture may include a core connected to a plurality of nucleotide arms, and each arm of the single affimer includes a nucleotide base of the same type. In some embodiments, performing one or more cycles of sequencing reactions may include: imaging an optical color signal emitted by a nucleotide reagent bound to a plurality of template molecules in each of the one or more cycles. Imaging the optical signal may be performed by an optical system, such as the imager 116 disclosed herein. In some embodiments, performing one or more cycles of sequencing reactions may include: acquiring a flow cell image in each of the one or more cycles, the flow cell image including an optical color signal emitted by a nucleotide reagent bound to a plurality of template molecules.

[0220] In some embodiments, the flow cell image comprises optical signals emitted from nucleotide reagents that bind to an unbalanced diversity of nucleotide bases A, G, C, and T / U in a plurality of nucleic acid template molecules immobilized on a support in one or more cycles. In some embodiments, the plurality of populations comprises an unbalanced diversity of nucleotide bases A, G, C, and T / U, and wherein the unbalanced diversity comprises: (1) a percentage of the number of one or more types of nucleotide bases relative to (2) a total number of nucleotide bases, and in said cycle N, said percentage is less than 20%, 15%, 10%, or 5%.

[0221] In some embodiments, methods 500, 600 may include providing a cell sample having a plurality of concatemer molecules immobilized on a carrier, wherein each concatemer molecule corresponds to a target RNA of the cell sample.

[0222] In some embodiments, methods 500, 600 may include generating a flow cell image by a sequencing system by performing one or more cycles of sequencing reactions on a plurality of concatemer molecules fixed on a carrier. Performing one or more cycles of sequencing reactions may include: contacting a plurality of concatemer molecules with a plurality of nucleotide reagents, the plurality of nucleotide reagents comprising a mixture of different types of nucleotide bases A, G, C and T / U. Performing one or more cycles of sequencing reactions may include: contacting a plurality of concatemer molecules with a mixture of a plurality of sequencing primers, a plurality of polymerases and different types of affimers. A single affimer in the mixture comprises a core connected to a plurality of nucleotide arms, and each arm of the single affimer comprises a nucleotide base of the same type. Performing one or more cycles of sequencing reactions may include: in each of the one or more cycles, imaging an optical color signal emitted from a nucleotide reagent bound to a plurality of concatemer molecules by an optical system. In some embodiments, performing one or more cycles of sequencing reactions may include: in each of the one or more cycles, acquiring a flow cell image by an optical system, the flow cell image comprising an optical color signal emitted from a nucleotide reagent bound to a plurality of concatemer molecules.

[0223] Computer Systems

[0224] Various embodiments of the method may be implemented, for example, using one or more computer systems (such as Figure 4 For example, one or more computer systems 400 may be used to implement any of the various embodiments discussed herein, as well as combinations and sub-combinations thereof.

[0225] Computer system 400 may include one or more hardware processors 404. Hardware processor 404 may be a central processing unit (CPU), a graphics processing unit (GPU), or a combination thereof. Processor 404 may be connected to a bus or communication infrastructure 406.

[0226] The computer system 400 may also include a user input / output device 403, such as a display, a keyboard, a pointing device, etc. The computer system may communicate with a communication infrastructure 406 via a user input / output interface 402. The user input / output device 403 may be coupled to Figure 1 The user interface 124 in FIG.

[0227] One or more of the processors 404 may be a graphics processing unit (GPU). In one embodiment, a GPU may be a processor that is a dedicated electronic circuit designed to process mathematically intensive applications. The GPU may have a parallel structure that is effective for processing large blocks of data in parallel, such as common mathematically intensive data such as computer graphics applications, images, videos, vector processing, array processing, and cryptography (including brute-force cracking), generating cryptographic hashes or hash sequences, solving partial hash reversal problems, and / or generating results of other proof-of-work calculations for some applications such as blockchain-based applications. With the power of general-purpose computing on a graphics processing unit (GPGPU), a GPU may be particularly useful at least in the image recognition and machine learning embodiments described herein.

[0228] Additionally, one or more of the processors 404 may include a coprocessor or other logic implementation for accelerating cryptographic calculations or other specialized mathematical functions, including a hardware-accelerated cryptographic coprocessor. Such an accelerated processor may further include an instruction set for accelerating using the coprocessor and / or other logic to facilitate such acceleration.

[0229] The computer system 400 may also include data storage devices, such as a main memory (primary memory) 408, for example, a random access memory (RAM). The main memory 408 may include one or more levels of cache. The main memory 408 may store control logic (i.e., computer software) and / or data therein.

[0230] The computer system 400 may also include one or more secondary data storage devices or secondary memories 410. The secondary memories 410 may include, for example, a primary storage drive 412 and / or a removable storage device or drive 414. The primary storage drive 412 may be, for example, a hard disk drive or a solid state drive. The removable storage drive 414 may be a floppy disk drive, a tape drive, an optical disk drive, an optical storage device, a tape backup device, and / or any other storage device / drive.

[0231] Removable storage drive 414 may interact with removable storage unit 418 .

[0232] The removable storage unit 418 may include a computer-usable or readable storage device having computer software and / or data stored thereon. The software may include control logic. The software may include instructions that may be executed by the hardware processor 404. These instructions, when executed by the hardware processor 404, may cause the hardware processor 404 to perform operations in accordance with the instructions. The removable storage unit 418 may be a floppy disk, a magnetic tape, an optical disk, a DVD, an optical storage disk, and / or any other computer data storage device. The removable storage drive 414 may read from and / or write to the removable storage unit 418.

[0233] Secondary storage 410 may include other means, devices, components, tools, or other methods for allowing computer system 400 to access computer programs and / or other instructions and / or data. Such means, devices, components, tools, or other methods may include, for example, a removable storage unit 422 and an interface 420. Examples of removable storage unit 422 and interface 420 may include a program cartridge and cartridge interface (such as those found in video game devices), a removable memory chip (such as an EPROM or PROM) and an associated socket, a memory stick and USB port, a memory card and an associated memory card slot, and / or any other removable storage unit and associated interface.

[0234] The computer system 400 may further include a communication or network interface 424. The communication interface 424 may enable the computer system 400 to communicate and interact with any combination of external devices, external networks, external entities, etc. (individually and collectively referenced by reference numeral 428). For example, the communication interface 424 may allow the computer system 400 to communicate with an external or remote device 428 via a communication path 426, which may be wired and / or wireless (or a combination thereof) and may include any combination of a LAN, a WAN, the Internet, etc. Control logic and / or data may be transmitted to and from the computer system 400 via the communication path 426. In some embodiments, the communication path 426 is a connection to the cloud 130, such as Figure 1 The external device or the like indicated by reference numeral 428 may be a device, a network, an entity, or the like in the cloud 130 .

[0235] The computer system 400 may also be any one or any combination of the following: a personal digital assistant (PDA), a desktop workstation, a laptop or notebook computer, a netbook, a tablet computer, a smart phone, a smart watch or other wearable device, an appliance, a part of the Internet of Things (IoT), and / or an embedded system, to name a few non-limiting examples.

[0236] It should be understood that the framework described herein can be implemented as a method, process, apparatus, system, or article of manufacture, such as a non-transitory computer-readable medium or device. For illustrative purposes, the present framework may be described in the context of a distributed ledger that is publicly available or at least available to untrusted third parties. An example of a modern use case is a blockchain-based system. However, it should be understood that the present framework may also be applied to other settings where sensitive or confidential information may need to pass through the hands of an untrusted third party, and this technology is by no means limited to distributed ledger or blockchain use.

[0237] The computer system 400 can be a client or server that accesses or hosts any application and / or data through any delivery paradigm, including but not limited to: remote or distributed cloud computing solutions; local or on-premises software (e.g., "on-premises" cloud-based solutions); "as a service" models (e.g., content as a service (CaaS), digital content as a service (DCaaS), software as a service (SaaS), hosted software as a service (MSaaS), platform as a service (PaaS), desktop as a service (DaaS), framework as a service (FaaS), backend as a service (BaaS), mobile backend as a service (MBaaS), infrastructure as a service (IaaS), database as a service (DBaaS), etc.); and / or a hybrid model including any combination of the foregoing examples or other services or delivery paradigms.

[0238] Any applicable data structures, file formats, and schemas may be derived from standards including, but not limited to, JavaScript Object Notation (JSON), Extensible Markup Language (XML), Yet Another Markup Language (YAML), Extensible Hypertext Markup Language (XHTML), Wireless Markup Language (WML), MessagePack, XML User Interface Language (XUL), or any other functionally similar representations alone or in combination. Alternatively, proprietary data structures, formats, or schemas may be used alone or in combination with known or open standards.

[0239] Any relevant data, files and / or databases may be stored, retrieved, accessed and / or transmitted in a human-readable format (such as digital, textual, graphic or multimedia format, further including various types of markup languages ​​and other possible formats). Alternatively or in combination with the above formats, data, files and / or databases may be stored, retrieved, accessed and / or transmitted in a binary, encoded, compressed and / or encrypted format or any other machine-readable format.

[0240] The interface connections or interconnections between the various systems and layers may employ any number of mechanisms, such as any number of protocols, programming frameworks, layout plans, or application programming interfaces (APIs), including but not limited to Document Object Model (DOM), Discovery Service (DS), NSUserDefaults, Web Services Description Language (WSDL), Message Exchange Pattern (MEP), Web Distributed Data Exchange (WDDX), Web Hypertext Application Technology Working Group (WHATWG) HTML5 web messaging, Representational State Transfer (REST or RESTful web services), Extensible User Interface Protocol (XUP), Simple Object Access Protocol (SOAP), XML Schema Definition (XSD), XML Remote Procedure Call (XML-RPC), or any other open or proprietary mechanism that can achieve similar functions and results.

[0241] Such an interface connection or interconnection can also utilize a uniform resource identifier (URI), which can further include a uniform resource locator (URL) or a uniform resource name (URN). Other forms of uniform and / or unique identifiers, locators or names can be used, used alone or in combination with those forms as described above.

[0242] Any of the above protocols or APIs can be interfaced with or implemented in any programming language (procedural, functional or object-oriented), and can be compiled or interpreted. Non-limiting examples include C, C++, C#, Objective-C, Java, Scala, Clojure, Elixir, Swift, Go, Perl, PHP, Python, Ruby, JavaScript, WebAssembly, or nearly any other language, as well as any other library or pattern in any type of framework, runtime environment, virtual machine, interpreter, stack, engine, or similar mechanism, including but not limited to Node.js, V8, Knockout, jQuery, Dojo, Dijit, OpenUI5, AngularJS, Expressjs, Backbone.js, Ember.js, DHTMLX, Vue, React, Electron, etc., and many other non-limiting examples.

[0243] In some embodiments, a tangible non-transitory device or article of manufacture containing a tangible non-transitory computer usable or readable medium having control logic (software) stored thereon may also be referred to herein as a computer program product or program storage device. This includes, but is not limited to, computer system 400, main memory 408, auxiliary memory 410, and removable storage units 418 and 422, and tangible articles of manufacture embodying any combination of the foregoing. When executed by one or more data processing devices (such as computer system 400), such control logic may cause such data processing devices to operate as described herein.

[0244] Based on the teachings contained in this disclosure, it is obvious to a person skilled in the relevant art how to use different Figure 4 It will be apparent that the data processing devices, computer systems, and / or computer architectures shown can be used to make and use the embodiments of the present disclosure. Specifically, the embodiments can operate with software, hardware, and / or operating system implementations other than those described herein.

[0245] Optical system

[0246] Figure 1 The imager 116 in may include one or more optical systems. Further disclosed herein are optical system design guidelines and high-performance fluorescence imaging methods and systems that provide improved optical resolution and image quality for genomics applications based on fluorescence imaging. The disclosed optical imaging system design provides a larger field of view, increased spatial resolution, improved modulation transfer, contrast-to-noise ratio and image quality, higher spatial sampling frequency, faster transitions between image captures when repositioning the sample plane to capture a series of images (e.g., images of different fields of view), and improved imaging system duty cycle, and thus achieves higher throughput image acquisition and analysis.

[0247] In some cases, improvements in imaging performance, such as for dual-sided (flow cell) imaging applications, can be achieved by using an electro-optic phase plate in conjunction with an objective to compensate for optical aberrations caused by the fluid layer separating the upper (near) and lower (far) inner surfaces of the flow cell. In some cases, this design approach can also compensate for vibrations introduced by, for example, motion-actuated compensators that move in or out of the optical path depending on which surface of the flow cell is being imaged.

[0248] In some cases, improvements in imaging performance, such as for dual-sided (flow cell) imaging applications involving the use of thick flow cell walls (e.g., wall (or coverslip) thickness >700 μm) and fluid channels (e.g., fluid channel height or thickness of 50-200 μm), can be achieved even when using commercially available off-the-shelf objectives by using a tube lens design that corrects for optical aberrations caused by the thick flow cell walls and / or intervening fluid layers in combination with the objectives.

[0249] In some cases, improvements in imaging performance, such as for multi-channel (e.g., two-color or four-color) imaging applications, can be achieved by using multiple tube lenses (one tube lens for each imaging channel), where each tube lens design is optimized for a specific wavelength range used in that imaging channel.

[0250] Exemplary embodiments disclosed herein may include a fluorescence imaging system, the system comprising: a) at least one light source configured to provide excitation light within one or more specified wavelength ranges; b) an objective lens configured to collect fluorescence generated within a specified field of view of the sample plane when the sample plane is exposed to the excitation light, wherein the numerical aperture of the objective lens is at least 0.1, at least 0.2, at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8 or at least 0.9 or a numerical aperture falling within the range defined by any two of the above; wherein the working distance of the objective lens is at least 400 μm, at least 500 μm, at least 600 μm, at least 700 μm, at least 800 μm, at least 900 μm, at least 1000 μm or a working distance falling within the range defined by any two of the above; and wherein the area of ​​the field of view is at least 0.1 mm 2 , at least 0.2mm 2 , at least 0.5mm 2 , at least 0.7mm 2 , at least 1mm 2 , at least 2mm 2 , at least 3mm 2 , at least 5mm 2 or at least 10mm 2 or a field of view falling within the range defined by any two of the above; and c) at least one image sensor, wherein the fluorescence collected by the objective is imaged onto the image sensor, and wherein the pixel size of the image sensor is selected so that the spatial sampling frequency of the fluorescence imaging system is at least twice the optical resolution of the fluorescence imaging system.

[0251] In some embodiments, the numerical aperture may be at least 0.75. In some embodiments, the numerical aperture is at least 1.0. In some embodiments, the working distance is at least 850 μm. In some embodiments, the working distance is at least 1,000 μm. In some embodiments, the area of ​​the field of view may be at least 2.5 mm2. In some embodiments, the area of ​​the field of view may be at least 3 mm2. In some embodiments, the spatial sampling frequency may be at least 2.5 times the optical resolution of the fluorescence imaging system. In some embodiments, the spatial sampling frequency may be at least 3 times the optical resolution of the fluorescence imaging system. In some embodiments, the system may further include an XYZ translation stage, such that the system is configured to acquire a series of two or more fluorescence images in an automated manner, wherein each image in the series is or may be acquired for a different field of view. In some embodiments, the positioning of the sample plane may be adjusted simultaneously in the X direction, the Y direction, and the Z direction to match the positioning of the objective focal plane between acquiring images of different fields of view. In some embodiments, the time required for simultaneous adjustment in the X direction, the Y direction, and the Z direction may be less than 0.3 seconds, less than 0.4 seconds, less than 0.5 seconds, less than 0.7 seconds, or less than 1 second, or a time falling within the range defined by any two of the foregoing. In some embodiments, the system further comprises an autofocus mechanism, the autofocus mechanism being configured to adjust the focal plane positioning before acquiring images of different fields of view if the error signal indicates that the positioning difference between the focal plane and the sample plane in the Z direction is greater than a specified error threshold. In some embodiments, the specified error threshold is 100nm or greater. In some embodiments, the specified error threshold is 50nm or less. In some embodiments, the system comprises three or more image sensors, and wherein the system is configured to image the fluorescence in each wavelength range in three or more wavelength ranges onto different image sensors. In some embodiments, the positioning difference between the focal plane of each image sensor in the three or more image sensors and the sample plane is less than 100nm. In some embodiments, the positioning difference between the focal plane of each image sensor in the three or more image sensors and the sample plane is less than 50nm. In some embodiments, the total time required to reposition the sample plane, adjust the focus (if necessary), and acquire the image is less than 0.4 seconds per field of view. In some embodiments, the total time required to reposition the sample plane, adjust the focus (if necessary), and acquire the image is less than 0.3 seconds per field of view.

[0252] The present invention also discloses a fluorescence imaging system for dual-sided imaging of a flow cell, the fluorescence imaging system comprising: a) an objective lens configured to collect fluorescence generated within a specified field of view of a sample plane in the flow cell; b) at least one tube lens positioned between the objective lens and at least one image sensor, wherein the at least one tube lens is configured to correct an imaging performance metric of a combination of the objective lens, at least two tube lenses, and at least one image sensor when imaging the inner surface of the flow cell, and wherein the wall thickness of the flow cell is at least 700 μm, and the gap between the upper inner surface and the lower inner surface is at least 50 μm; wherein the imaging performance metric is substantially the same for imaging the upper inner surface or the lower inner surface of the flow cell without moving an optical compensator into or out of an optical path between the flow cell and the at least one image sensor, without moving one or more optical elements of the tube lens along the optical path, and without moving one or more optical elements of the tube lens into or out of the optical path.

[0253] In some embodiments, the objective lens may be a commercially available microscope objective lens. In some embodiments, the numerical aperture of the commercially available microscope objective lens may be at least 0.3. In some embodiments, the working distance of the objective lens may be at least 700 μm. In some embodiments, the objective lens may be corrected to compensate for a cover glass thickness (or flow cell wall thickness) of 0.17 mm or a thickness greater than or less than 0.17 mm. In some embodiments, the optical system may be corrected to compensate for the cover glass thickness, the flow cell thickness, or the distance between the desired focal planes. In some embodiments, the correction may be performed by inserting a correction optical device such as a lens or an optical assembly into the optical path of the optical system. In some embodiments, the correction may be performed without inserting a correction optical device such as a lens or an optical assembly into the optical path of the optical system. In some embodiments, the fluorescence imaging system may further include an electro-optical phase plate positioned adjacent to the objective lens and positioned between the objective lens and the tube lens, wherein the electro-optical phase plate may provide correction of optical aberrations caused by a fluid filling the gap between the upper inner surface and the lower inner surface of the flow cell. In some embodiments, at least one tube lens may be a composite lens comprising three or more optical components. In some embodiments, at least one tube lens is a composite lens comprising four optical components, which may include one or more of the following: a first asymmetric convex-convex lens, a second convex-plano lens, a third asymmetric concave-concave lens, and a fourth asymmetric convex-concave lens, which may be present in the order listed above or in any alternative order. In some embodiments, at least one tube lens is configured to correct the imaging performance metric of the combination of the objective lens, at least one tube lens, and at least one image sensor when imaging the inner surface of a flow cell having a wall thickness of at least 1 mm. In some embodiments, at least one tube lens is configured to correct the imaging performance metric of the combination of the objective lens, at least one tube lens, and at least one image sensor when imaging the inner surface of a flow cell having a gap of at least 100 μm. In some embodiments, at least one tube lens is configured to correct the imaging performance metric of the combination of the objective lens, at least one tube lens, and at least one image sensor when imaging the inner surface of a flow cell having a gap of at least 200 μm. In some embodiments, the system comprises a single objective lens, two tube lenses, and two image sensors, and each of the two tube lenses is designed to provide optimal imaging performance at different fluorescence wavelengths. In some embodiments, the system comprises a single objective lens, three tube lenses, and three image sensors, and each of the three tube lenses is designed to provide optimal imaging performance at a different fluorescence wavelength. In some embodiments, the system comprises a single objective lens, four tube lenses, and four image sensors, and each of the four tube lenses is designed to provide optimal imaging performance at a different fluorescence wavelength.In some embodiments, the design of the objective lens or at least one tube lens is configured to optimize the modulation transfer function in the medium to high spatial frequency range. In some embodiments, the imaging performance metric comprises a measurement of the modulation transfer function (MTF), defocus, spherical aberration, chromatic aberration, coma, astigmatism, field curvature, image distortion, contrast-to-noise ratio (CNR), or any combination thereof at one or more specified spatial frequencies. In some embodiments, the difference in the imaging performance metric for imaging the upper and lower inner surfaces of the flow cell is less than 10%. In some embodiments, the difference in the imaging performance metric for imaging the upper and lower inner surfaces of the flow cell is less than 5%. In some embodiments, the use of at least one tube lens provides at least equivalent or better improvements in imaging performance metrics for dual-sided imaging compared to conventional systems including an objective lens, a motion-actuated compensator, and an image sensor. In some embodiments, the use of at least one tube lens provides at least a 10% improvement in imaging performance metrics for dual-sided imaging compared to conventional systems including an objective lens, a motion-actuated compensator, and an image sensor.

[0254] Disclosed herein is an illumination system for imaging-based solid phase genotyping and sequencing applications, the illumination system comprising: a) a light source; and b) a liquid light guide configured to collect light emitted by the light source and deliver the light to a designated illumination field on a carrier surface comprising tethered biomacromolecules.

[0255] In some embodiments, the illumination system further comprises a condenser lens. In some embodiments, the area of ​​the designated illumination field is at least 2 mm2. In some embodiments, the light delivered to the designated illumination field has uniform intensity across a designated field of view of an imaging system used to acquire an image of the carrier surface. In some embodiments, the area of ​​the designated field of view is at least 2 mm2. In some embodiments, the light delivered to the designated illumination field has uniform intensity across the designated field of view when the coefficient of variation (CV) of the light intensity is less than 10%. In some embodiments, the light delivered to the designated illumination field has uniform intensity across the designated field of view when the coefficient of variation (CV) of the light intensity is less than 5%. In some embodiments, the speckle contrast value of the light delivered to the designated illumination field is less than 0.1. In some embodiments, the speckle contrast value of the light delivered to the designated illumination field is less than 0.05.

[0256] Imaging modules and systems: Those skilled in the art will appreciate that, in some cases, the disclosed optical systems, imaging systems or modules may be independent optical systems designed for imaging a sample or substrate surface. In some cases, they may include one or more processors or computers. In some cases, they may include one or more software packages that provide instrument control functions and / or image processing functions. In some cases, in addition to optical components such as light sources (e.g., solid-state lasers, dye lasers, diode lasers, arc lamps, halogen lamps, etc.), lenses, prisms, mirrors, dichroic reflectors, optical filters, optical bandpass filters, apertures, and image sensors (e.g., complementary metal oxide semiconductor (CMOS) image sensors and cameras, charge coupled devices (CCD) image sensors and cameras, etc.), they may also include mechanical and / or optical mechanical components such as XY translation stages, XYZ translation stages, piezoelectric focusing mechanisms, etc. In some cases, they may serve as modules, components, subassemblies, or subsystems of larger systems designed for genomics applications (e.g., genetic testing and / or nucleic acid sequencing applications). For example, in some cases, they can act as modules, components, subassemblies, or subsystems of a larger system, which further includes a light-tight and / or other environmental control housing, a temperature control module, a fluid control module, a fluid dispensing robot, a pick and place robot, one or more processors or computers, one or more local and / or cloud-based software packages (e.g., instrument / system control software packages, image processing software packages, data analysis software packages), data storage modules, data communication modules (e.g., Bluetooth, WiFi, intranet or Internet communication hardware and associated software), a display module, or any combination thereof.

[0257] Methods used for sequencing

[0258] Embodiments of the present disclosure provide methods for sequencing fixed or non-fixed template molecules. The method can be operated in system 100, for example, in a sequencer 114. In some embodiments, the fixed template molecule comprises a plurality of nucleic acid template molecules having a copy of a target sequence of interest. In some embodiments, the nucleic acid template molecule having a copy of a target sequence of interest can be generated by bridge amplification using a linear library molecule. In some embodiments, the fixed template molecule comprises a plurality of nucleic acid template molecules, each nucleic acid template molecule having two or more tandem copies (e.g., concatemers) of a target sequence of interest. In some embodiments, the nucleic acid template molecule comprising a concatemer molecule can be generated by rolling circle amplification of a circularized linear library molecule. In some embodiments, the non-fixed template molecule comprises a circular molecule. In some embodiments, the method for sequencing employs a soluble (e.g., non-fixed) sequencing polymerase or a sequencing polymerase fixed to a carrier.

[0259] In some embodiments, the sequencing reaction uses detectably labeled nucleotide analogs. In some embodiments, the sequencing reaction uses a two-stage sequencing reaction, including binding to a detectably labeled multivalent molecule and incorporation of nucleotide analogs. In some embodiments, the sequencing reaction uses unlabeled nucleotide analogs. In some embodiments, the sequencing reaction uses phosphate-tagged nucleotides.

[0260] Library molecules

[0261] In some embodiments, each of the fixed concatemers comprises a tandem repeat unit (e.g., an insertion region) of a sequence of interest and any adapter sequence. For example, the tandem repeat unit comprises: (i) a left universal adapter sequence having a binding sequence for a first surface primer (720) (e.g., a surface pinning primer), (ii) a left universal adapter sequence having a binding sequence for a first sequencing primer (740) (e.g., a forward sequencing primer), (iii) a sequence of interest (710), (iv) a right universal adapter sequence having a binding sequence for a second sequencing primer (750) (e.g., a reverse sequencing primer), (v) a right universal adapter sequence having a binding sequence for a second surface primer (730) (e.g., a surface capture primer), and (vii) a left sample index sequence (760) and / or a right sample index sequence (770). In some embodiments, the tandem repeat unit further comprises a left unique identifier sequence (780) and / or a right unique identifier sequence (790). In some embodiments, the tandem repeat unit further comprises a binding sequence for at least one compaction oligonucleotide. In some embodiments, Figure 7 and 8 Linear library molecules or concatemer molecule units are shown.

[0262] Figure 7 An example linear single-stranded library molecule (700) is shown, which includes: a surface pinning primer binding site (720); an optional left unique identification sequence (780); a left index sequence (760); a forward sequencing primer binding site (740); an insert region (710) having a sequence of interest; a reverse sequencing primer binding site (750); a right index sequence (770); and a surface capture primer binding site (730).

[0263] Figure 8An example linear single-stranded library molecule (700) is shown, which includes: a surface pinning primer binding site (720); a left index sequence (760); a forward sequencing primer binding site (740); an insert region having a sequence of interest (710); a reverse sequencing primer binding site (750); a right index sequence (770); an optional right unique identifier sequence (790); and a surface capture primer binding site (730).

[0264] The fixed concatemer can be collapsed into a compact nucleic acid nanoball by itself. The size and / or shape of the nanoball can be further compacted by including one or more compacting oligonucleotides during the RCA reaction. The increase of the number of tandem repeat units in a given concatemer increases the number of sites along the concatemer for hybridization with a variety of sequencing primers (e.g., sequencing primers with a universal sequence), and the sequencing primers serve as a plurality of starting sites for the sequencing reaction catalyzed by a polymerase. When the sequencing reaction adopts detectably labeled nucleotides and / or detectably labeled multivalent molecules (e.g., with nucleotide units), the signal emitted by the nucleotides or nucleotide units participating in the parallel sequencing reactions along the concatemer produces an increased signal intensity for each concatemer. A plurality of parts of a given concatemer can be sequenced simultaneously. In addition, a plurality of binding complexes can be formed along a specific concatemer molecule, and each binding complex comprises a sequencing polymerase that is combined with a template / primer duplex and combined with a multivalent molecule, wherein the plurality of binding complexes remain stable and do not dissociate, resulting in an increased retention time, which increases signal intensity and reduces imaging time.

[0265] Methods for sequencing using nucleotide analogs

[0266] Embodiments of the present disclosure provide methods for sequencing any immobilized template molecule described herein, the method comprising step (a): contacting a sequencing polymerase with (i) a nucleic acid template molecule and (ii) a nucleic acid sequencing primer, wherein the contact is performed under conditions suitable for binding the sequencing polymerase to the nucleic acid template molecule hybridized to the nucleic acid primer, wherein the nucleic acid template molecule hybridized to the nucleic acid primer forms a nucleic acid duplex. In some embodiments, the sequencing polymerase comprises a recombinant mutant sequencing polymerase that can bind and incorporate nucleotide analogs.

[0267] In some embodiments, in a method for sequencing a template molecule, a sequencing primer comprises a 3' extendable end or a 3' non-extendable end. In some embodiments, a plurality of nucleic acid template molecules comprise amplified template molecules (e.g., clonally amplified template molecules). In some embodiments, a plurality of nucleic acid template molecules comprise a copy of a target sequence of interest. In some embodiments, a plurality of nucleic acid molecules comprise two or more tandem copies of a target sequence of interest (e.g., concatemers). In some embodiments, a plurality of nucleic acid template molecules comprise the same target sequence of interest or different target sequences of interest. In some embodiments, a plurality of nucleic acid primers are in solution or fixed to a carrier. In some embodiments, when a plurality of nucleic acid template molecules and / or a plurality of nucleic acid primers are fixed to a carrier, a plurality of fixed first composite polymerases are produced in combination with a first sequencing polymerase. In some embodiments, a plurality of nucleic acid template molecules and / or nucleic acid primers are fixed to 10 2 -10 15 In some embodiments, the combination of multiple template molecules and nucleic acid primers with multiple first sequencing polymerases produces 10 2 -10 15 In some embodiments, the plurality of fixed first composite polymerases on the carrier are fixed to predetermined sites or random sites on the carrier. In some embodiments, the plurality of fixed first composite polymerases are fluidically connected to each other to allow a reagent solution (e.g., an enzyme including a sequencing polymerase, a multivalent molecule, a nucleotide, and / or a divalent cation) to flow onto the carrier, so that the plurality of fixed composite polymerases on the carrier react with the reagent solution in a massively parallel manner.

[0268] In some embodiments, the method for sequencing further comprises step (b): contacting a sequencing polymerase with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to a sequencing polymerase bound to a nucleic acid duplex and suitable for incorporating a nucleotide catalyzed by the polymerase, incorporating the nucleotide catalyzed by the polymerase to extend the sequencing primer by one nucleotide. In some embodiments, the sequencing polymerase is contacted with a plurality of nucleotides in the presence of at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, a plurality of nucleotides comprises at least one nucleotide analog having a chain termination portion at a sugar 2' or 3' location. In some embodiments, the chain termination portion can be removed from the sugar 2' or 3' location to convert the chain termination portion into an OH or H group. In some embodiments, a plurality of nucleotides comprises at least one nucleotide lacking a chain termination portion. In some embodiments, at least one nucleotide is labeled with a detectable reporter gene portion (e.g., a fluorophore) that emits a detectable signal. The detectable reporter gene portion comprises a fluorophore. In some embodiments, the fluorophore is connected to a nucleobase. In some embodiments, the fluorophore is connected to a nucleobase with a joint that can be cut / removed from a base. In some embodiments, at least one nucleotide in a plurality of nucleotides is not labeled with a detectable reporter gene portion. In some embodiments, the specific detectable reporter moiety (e.g., a fluorophore) attached to the nucleotide can correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) to allow detection and identification of the nucleobase. When the incorporated chain-terminating nucleotide is detectably labeled, step (b) further comprises detecting a signal emitted from the incorporated chain-terminating nucleotide. In some embodiments, step (b) further comprises identifying the nucleobase of the incorporated chain-terminating nucleotide.

[0269] In some embodiments, the method for sequencing further comprises step (c): removing the chain terminating moiety from the incorporated chain terminating nucleotide to generate an extendable 3'OH group. In some embodiments, step (c) further comprises removing the detectable label from the incorporated chain terminating nucleotide. In some embodiments, the sequencing polymerase remains bound to the template molecule, which is hybridized to the sequencing primer extended by one nucleobase.

[0270] In some embodiments, the method for sequencing further comprises step (d): repeating steps (b) and (c) at least once.

[0271] Two-stage method for sequencing nucleic acids

[0272] Embodiments of the present disclosure provide a two-stage method for sequencing any immobilized template molecule described herein. In some embodiments, the first stage generally comprises combining a multivalent molecule with a composite polymerase to form a multivalent composite polymerase, and detecting the multivalent composite polymerase.

[0273] In some embodiments, the first stage comprises step (a): contacting a plurality of first sequencing polymerases with (i) a plurality of nucleic acid template molecules and (ii) a plurality of nucleic acid sequencing primers, wherein the contacting is performed under conditions suitable for binding the plurality of first sequencing polymerases to the plurality of nucleic acid template molecules and the plurality of nucleic acid primers, thereby forming a plurality of first composite polymerases, each of which comprises a first sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises a nucleic acid template molecule hybridized to a nucleic acid primer. In some embodiments, the first polymerase comprises a recombinant mutant sequencing polymerase.

[0274] In some embodiments, in a method for sequencing a template molecule, a sequencing primer comprises an oligonucleotide having a 3' extendable end or a 3' non-extendable end. In some embodiments, a plurality of nucleic acid template molecules comprise amplified template molecules (e.g., clonally amplified template molecules). In some embodiments, a plurality of nucleic acid template molecules comprise a copy of a target sequence of interest. In some embodiments, a plurality of nucleic acid molecules comprise two or more tandem copies of a target sequence of interest (e.g., concatemers). In some embodiments, the nucleic acid template molecules in a plurality of nucleic acid template molecules comprise the same target sequence of interest or different target sequences of interest. In some embodiments, a plurality of nucleic acid template molecules and / or a plurality of nucleic acid primers are in a solution or fixed to a carrier. In some embodiments, when a plurality of nucleic acid template molecules and / or a plurality of nucleic acid primers are fixed to a carrier, a plurality of fixed first composite polymerases are produced in combination with a first sequencing polymerase. In some embodiments, a plurality of nucleic acid template molecules and / or nucleic acid primers are fixed to 10 2 -10 15 In some embodiments, the combination of multiple template molecules and nucleic acid primers with multiple first sequencing polymerases produces 10 2 -10 15 In some embodiments, the plurality of fixed first composite polymerases on the carrier are fixed to predetermined sites or random sites on the carrier. In some embodiments, the plurality of fixed first composite polymerases are fluidically connected to each other to allow a reagent solution (e.g., an enzyme including a sequencing polymerase, a multivalent molecule, a nucleotide, and / or a divalent cation) to flow onto the carrier, so that the plurality of fixed composite polymerases on the carrier react with the reagent solution in a massively parallel manner.

[0275] In some embodiments, the method for sequencing further comprises step (b): contacting the plurality of first composite polymerases with the plurality of multivalent molecules to form a plurality of multivalent composite polymerases (e.g., binding complexes). In some embodiments, a single multivalent molecule in the plurality of multivalent molecules comprises a core connected to a plurality of nucleotide arms, and each nucleotide arm is connected to a nucleotide (e.g., a nucleotide unit) (e.g., Figure 9-13 In some embodiments, the contacting of step (b) is performed under conditions suitable for binding the complementary nucleotide units of the multivalent molecule to at least two of the plurality of first composite polymerases, thereby forming a plurality of multivalent composite polymerases. In some embodiments, the conditions are suitable for inhibiting polymerase-catalytic incorporation of complementary nucleotide units into primers of the plurality of multivalent composite polymerases. In some embodiments, the plurality of multivalent molecules comprises at least one multivalent molecule having a plurality of nucleotide arms (e.g., Figure 9-12 ), each nucleotide arm is connected to a nucleotide analog (e.g., a nucleotide analog unit), wherein the nucleotide analog includes a chain termination portion at the sugar 2' and / or 3' location. In some embodiments, a plurality of multivalent molecules comprises at least one multivalent molecule comprising a plurality of nucleotide arms, each nucleotide arm being attached with a nucleotide unit lacking a chain termination portion. In some embodiments, at least one of the multivalent molecules in the plurality of multivalent molecules is labeled with a detectable reporter gene portion that emits a signal. In some embodiments, the detectable reporter gene portion comprises a fluorophore. In some embodiments, the contacting of step (b) is performed in the presence of at least one non-catalytic cation comprising strontium, barium and / or calcium.

[0276] In some embodiments, the method for sequencing further comprises step (c): detecting a plurality of multivalent composite polymerases. In some embodiments, the detection comprises detecting a signal emitted by a multivalent molecule bound to the composite polymerase, wherein the complementary nucleotide unit of the multivalent molecule binds to the primer but inhibits the incorporation of the complementary nucleotide unit. In some embodiments, the multivalent molecule is labeled with a detectable reporter moiety to allow detection. In some embodiments, the labeled multivalent molecule comprises a fluorophore attached to the core, linker, and / or nucleotide unit of the multivalent molecule.

[0277] In some embodiments, the method for sequencing further comprises step (d): identifying the nucleobases of the complementary nucleotide units bound to the plurality of first composite polymerases, thereby determining the sequence of the template molecule. In some embodiments, the multivalent molecule is labeled with a detectable reporter moiety corresponding to a specific nucleotide unit attached to the nucleotide arm to allow identification of the complementary nucleotide units (e.g., nucleotide bases adenine, guanine, cytosine, thymine, or uracil) bound to the plurality of first composite polymerases.

[0278] In some embodiments, the method for sequencing further comprises step (e): dissociating the plurality of multivalent complex polymerases and removing the plurality of first sequencing polymerases and the multivalent molecules bound thereto, and retaining the plurality of nucleic acid duplexes.

[0279] In some embodiments, the second stage of the two-stage sequencing method generally comprises nucleotide incorporation. In some embodiments, the method for sequencing further comprises step (f): contacting the plurality of retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contacting is performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second composite polymerases each comprising a second sequencing polymerase bound to the nucleic acid duplexes. In some embodiments, the second sequencing polymerase comprises a recombinant mutant sequencing polymerase.

[0280] In some embodiments, the plurality of first sequencing polymerases of step (a) have an amino acid sequence that is 100% identical to the amino acid sequence of the plurality of second sequencing polymerases of step (f). In some embodiments, the plurality of first sequencing polymerases of step (a) have an amino acid sequence that is different from the amino acid sequence of the plurality of second sequencing polymerases of step (f).

[0281] In some embodiments, the method for sequencing further comprises step (g): contacting a plurality of second composite polymerases with a plurality of nucleotides, wherein the contact is carried out under conditions suitable for combining complementary nucleotides from a plurality of nucleotides with at least two second composite polymerases in the second composite polymerase, thereby forming a plurality of nucleotide composite polymerases. In some embodiments, the contact of step (g) is carried out under conditions suitable for promoting the catalytic incorporation of the bound complementary nucleotide polymerase into the primer of the nucleotide composite polymerase, thereby extending the sequencing primer by one nucleobase. In some embodiments, the incorporation of nucleotides into the 3' end of the sequencing primer in step (g) comprises a primer extension reaction. In some embodiments, the contact of step (g) is carried out in the presence of at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, a plurality of nucleotides comprises natural nucleotides (e.g., non-analog nucleotides) or nucleotide analogs. In some embodiments, a plurality of nucleotides comprises removable or non-removable 2' and / or 3' chain termination portions. In some embodiments, at least one nucleotide in a plurality of nucleotides is not labeled with a detectable reporter gene portion. In some embodiments, a plurality of nucleotides are unlabeled. In some embodiments, a plurality of nucleotides comprises a plurality of nucleotides labeled with a detectable reporter gene portion. The detectable reporter gene portion comprises a fluorophore. In some embodiments, the fluorophore is linked to a nucleotide base. In some embodiments, the fluorophore is linked to a nucleotide base with a linker that may or may not be cleavable / removable from the base. In some embodiments, a specific detectable reporter gene moiety (e.g., a fluorophore) linked to a nucleotide may correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) to allow detection and identification of the nucleotide base.

[0282] In some embodiments, when the plurality of nucleotides in step (g) are detectably labeled, the method for sequencing further comprises step (h): detecting complementary nucleotides incorporated into the primer of the nucleotide composite polymerase. In some embodiments, the plurality of nucleotides are labeled with a detectable reporter gene moiety to allow detection. In some embodiments, when the plurality of nucleotides in step (g) are not labeled, the detection of step (h) is omitted.

[0283] In some embodiments, when the plurality of nucleotides in step (g) are detectably labeled, the method for sequencing further comprises step (i): identifying the base of the complementary nucleotide incorporated into the primer of the nucleotide composite polymerase. In some embodiments, the identification of the incorporated complementary nucleotide in step (i) can be used to confirm the identity of the complementary nucleotide of the multivalent molecule bound to the plurality of first composite polymerases in step (d). In some embodiments, the identification of step (i) can be used to determine the sequence of the nucleic acid template molecule. In some embodiments, when the plurality of nucleotides in step (g) are not labeled, the identification of step (i) is omitted.

[0284] In some embodiments, the method for sequencing further comprises step (j): removing the chain terminating moiety from the incorporated nucleotides when step (g) is performed by contacting a plurality of second composite polymerases with a plurality of nucleotides comprising at least one nucleotide having a 2' and / or 3' chain terminating moiety.

[0285] In some embodiments, the method for sequencing further comprises step (k): repeating steps (a) to (j) at least once. In some embodiments, the sequence of the nucleic acid template molecule can be determined by detecting and identifying the multivalent molecule that binds to the sequencing polymerase but is not incorporated into the 3' end of the primer at steps (c) and (d). In some embodiments, the sequence of the nucleic acid template molecule can be determined (or confirmed) by detecting and identifying the nucleotide incorporated into the 3' end of the primer at steps (h) and (i).

[0286] In some embodiments, in any method for sequencing a nucleic acid molecule, the combination of a plurality of first complex polymerases and a plurality of multivalent molecules forms at least one affinity complex, the method comprising the following steps: (a) combining a first nucleic acid primer, a first sequencing polymerase, and a first multivalent molecule with a first portion of a concatemer template molecule, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first sequencing polymerase; and (b) combining a second nucleic acid primer, a second sequencing polymerase, and the first multivalent molecule with a second portion of the same concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, wherein the first binding complex and the second binding complex comprising the same multivalent molecule form an affinity complex. In some embodiments, the first sequencing polymerase comprises any wild-type or mutant polymerase described herein. In some embodiments, the second sequencing polymerase comprises any wild-type or mutant polymerase described herein. The concatemer template molecule comprises a tandem repeat sequence of a sequence of interest and at least one universal sequencing primer binding site. The first nucleic acid primer and the second nucleic acid primer can bind to the sequencing primer binding site along the concatemer template molecule. Exemplary multivalent molecules are shown in Figure 9-12 middle.

[0287] In some embodiments, in any method for sequencing a nucleic acid molecule, wherein the method comprises combining a plurality of first composite polymerases with a plurality of multivalent molecules to form at least one affinity complex, the method comprises the following steps: (a) contacting a plurality of sequencing polymerases and a plurality of nucleic acid primers with different portions of a concatemer nucleic acid concatemer molecule to form at least a first composite polymerase and a second composite polymerase on the same concatemer template molecule; (b) contacting the plurality of multivalent molecules with the at least first composite polymerase and the second composite polymerase on the same concatemer template molecule under conditions suitable for combining a single multivalent molecule from the plurality of multivalent molecules with the first composite polymerase and the second composite polymerase, wherein at least a first nucleotide unit of the single multivalent molecule is combined with the first composite polymerase, the first composite polymerase comprising a first primer, the first primer hybridizing to a first portion of the concatemer template molecule, thereby forming a first binding complex (e.g., a first ternary complex), and wherein the At least the second nucleotide unit of the single multivalent molecule is bound to the second composite polymerase, the second composite polymerase comprising a second primer, the second primer hybridizing to the second portion of the concatemer template molecule, thereby forming a second binding complex (e.g., a second ternary complex), wherein the contacting is performed under conditions suitable for inhibiting the polymerase-catalytic incorporation of the bound first and second nucleotide units into the first and second binding complexes, and wherein the first and second binding complexes bound to the same multivalent molecule form an affinity complex; and (c) detecting the first and second binding complexes on the same concatemer template molecule; and (d) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule. In some embodiments, the plurality of sequencing polymerases comprises any wild-type or mutant sequencing polymerase described herein. The concatemer template molecule comprises a tandem repeat sequence of a sequence of interest and at least one universal sequencing primer binding site. A plurality of nucleic acid primers can bind to the sequencing primer binding sites along the concatemer template molecule. Exemplary multivalent molecules are shown in Figure 9-12 middle.

[0288] exist Fig. 9In the figure, the left panel (class I) is a schematic diagram of a multivalent molecule with a "starburst" or "helter-skelter" configuration. The middle panel (class II): a schematic diagram of a multivalent molecule with a dendrimer configuration. The right panel (class III): a schematic diagram of multiple multivalent molecules formed by reacting streptavidin with a 4-arm or 8-arm PEG-NHS with biotin and dNTPs. The nucleotide unit is designated as 'N', biotin is designated as 'B', and streptavidin is designated as 'SA'.

[0289] Sequencing by Binding

[0290] Embodiments of the present disclosure provide methods for sequencing any of the immobilized template molecules described herein, wherein the sequencing method comprises a sequencing by binding (SBB) procedure using unlabeled chain terminating nucleotides. In some embodiments, a sequencing by binding (SBB) method comprises the following steps: (a) sequentially contacting a primed template nucleic acid with at least two separate mixtures under ternary complex stabilizing conditions, wherein each of the at least two separate mixtures comprises a polymerase and nucleotides, whereby the sequential contacting in the primed template nucleic acid results in contact with nucleotide homologs of a first, second, and third base type in the template under the ternary complex stabilizing conditions; (b) examining the at least two separate mixtures to determine whether a ternary complex is formed; and (c) identifying the next correct nucleotide of the primed template nucleic acid molecule, wherein if a ternary complex is detected in step (b), the next correct nucleotide is identified as a homolog of the first, second, or third base type, and wherein the next correct nucleotide is estimated to be a nucleotide homolog of a fourth base type based on the absence of a ternary complex in step (b); (d) after step (b), adding the next correct nucleotide to a primer of the primed template nucleic acid, thereby generating an extended primer; and (e) repeating steps (a) to (d) at least once for the primed template nucleic acid comprising the extended primer. Exemplary sequencing-by-binding methods are described in U.S. Pat. Nos. 10,246,744 and 10,731,141 (the contents of both patents are hereby incorporated by reference in their entireties).

[0291] Method for sequencing using nucleotides labeled with phosphate chains

[0292] Embodiments of the present disclosure provide methods for sequencing using an immobilized sequencing polymerase bound to an unimmobilized template molecule, wherein a sequencing reaction is performed with nucleotides labeled with a phosphate chain. In some embodiments, the sequencing method comprises step (a): providing a carrier on which a plurality of sequencing polymerases are immobilized. In some embodiments, the sequencing polymerase comprises a processive DNA polymerase. In some embodiments, the sequencing polymerase comprises a wild-type or mutant DNA polymerase, including, for example, a Phi29 DNA polymerase. In some embodiments, the carrier comprises a plurality of separate compartments, and the sequencing polymerase is fixed to the bottom of the compartment. In some embodiments, the separate compartments comprise a silica bottom through which light can penetrate. In some embodiments, the separate compartments comprise a silica bottom configured with a nanophotonic confinement structure comprising a hole in a metal coating (e.g., an aluminum coating). In some embodiments, the small aperture of the hole in the metal coating is, for example, about 70 nm. In some embodiments, the height of the nanophotonic confinement structure is about 100 nm. In some embodiments, the nanophotonic confinement structure comprises a zero mode waveguide (ZMW). In some embodiments, the nanophotonic confinement structure contains a liquid.

[0293] In some embodiments, the sequencing method further comprises step (b): contacting a plurality of immobilized sequencing polymerases with a plurality of single-stranded circular nucleic acid template molecules and a plurality of oligonucleotide sequencing primers under conditions suitable for a single immobilized sequencing polymerase to bind to a single-stranded circular template molecule and suitable for a single sequencing primer to hybridize to a single single-stranded circular template molecule, thereby generating a plurality of polymerase / template / primer complexes. In some embodiments, a single sequencing primer hybridizes to a universal sequencing primer binding site on a single-stranded circular template molecule.

[0294] In some embodiments, the sequencing method further comprises step (c): contacting a plurality of polymerase / template / primer complexes with a plurality of nucleotides labeled with phosphate chains, each nucleotide labeled with a phosphate chain comprising an aromatic base, a pentose (e.g., ribose or deoxyribose) and a phosphate chain comprising 3-20 phosphate groups, wherein the terminal phosphate group is connected to a detectable reporter gene portion (e.g., a fluorophore). The first phosphate group, the second phosphate group, and the third phosphate group may be referred to as α, β, and γ phosphate groups. In some embodiments, the specific detectable reporter gene portion connected to the terminal phosphate group corresponds to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) to allow detection and identification of the nucleobase. In some embodiments, under conditions suitable for polymerase-catalyzed nucleotide incorporation, contacting a plurality of polymerase / template / primer complexes with a plurality of nucleotides labeled with phosphate chains. In some embodiments, the sequencing polymerase is capable of binding to nucleotides labeled with complementary phosphate chains and incorporating complementary nucleotides relative to the nucleotides in the template molecule. In some embodiments, the polymerase catalyzed nucleotide incorporation reaction cleaves between the alpha phosphate group and the beta phosphate group, thereby releasing the polyphosphate chain attached to the fluorophore.

[0295] In some embodiments, the sequencing method further comprises step (d): detecting a fluorescent signal emitted by a nucleotide labeled with a phosphate chain, which is bound by a sequencing polymerase and incorporated into the end of a sequencing primer. In some embodiments, step (d) further comprises identifying the nucleotide labeled with a phosphate chain bound by a sequencing polymerase and incorporated into the end of a sequencing primer.

[0296] In some embodiments, the sequencing method further comprises step (d): repeating steps (c)-(d) at least once. In some embodiments, the sequencing method using nucleotides labeled with phosphate chains can be performed according to the methods described in U.S. Patent Nos. 7,170,050; 7,302,146; and / or 7,405,281.

[0297] Sequencing polymerase

[0298] Embodiments of the present disclosure provide methods for sequencing nucleic acid molecules, wherein any sequencing method described herein employs at least one type of sequencing polymerase and a plurality of nucleotides, or employs at least one type of sequencing polymerase and a plurality of nucleotides and a plurality of multivalent molecules. In some embodiments, the sequencing polymerase is capable of incorporating complementary nucleotides relative to the nucleotides in the template molecule. In some embodiments, the sequencing polymerase is capable of binding to complementary nucleotide units of multivalent molecules relative to the nucleotides in the template molecule. In some embodiments, a plurality of sequencing polymerases comprises a recombinant mutant polymerase.

[0299] Examples of suitable polymerases for sequencing with nucleotides and / or multivalent molecules include, but are not limited to, Klenow DNA polymerase; Thermus aquaticus DNA polymerase I (Taq polymerase); KlenTaq polymerase; Candidatus altiarchaeales archaeon; Candidatus Hadarchaeum Yellowstonense; Hadesarchaea archaeon; Euryarchaeota archaeon; Thermoplasmata archaeon; Thermococcus polymerases, such as Thermococcus litoralis, bacteriophage T7 DNA polymerase; human alpha, delta, and epsilon DNA polymerases; bacteriophage polymerases, such as T4, RB69, and phi29 phage DNA polymerases; Pyrococcus furiosus furiosus DNA polymerase (Pfu polymerase); Bacillus subtilis DNA polymerase III; Escherichia coli (E. coli) DNA polymerase III alpha and epsilon; 9 degree N polymerase; reverse transcriptase, such as HIV type M or type O reverse transcriptase; avian myeloblastosis virus reverse transcriptase; Moloney Murine Leukemia Virus (MMLV) reverse transcriptase; or telomerase. Additional non-limiting examples of DNA polymerases include those from various Archaea (e.g., Aeropyrum, Archaeoglobus, Desulfurococcus, Pyrobaculum, Pyrococcus, Pyrolobus, Pyrodictium, Staphylothermus, Stetteria, Sulfolobus, Thermococcus, and Vulcanisaeta, etc., or variants thereof), including such polymerases as are known in the art, such as 9 degrees N, VENT, DEEP VENT, THERMINATOR, Pfu, KOD, Pfx, Tgo, and RB69 polymerases.

[0300] Nucleotides

[0301] Embodiments of the present disclosure provide methods for sequencing nucleic acid molecules, wherein any sequencing method described herein uses at least one nucleotide. Nucleotide comprises a base, a sugar and at least one phosphate group. In certain embodiments, at least one nucleotide in a plurality of nucleotides comprises an aromatic base, a pentose (e.g., ribose or deoxyribose) and one or more phosphate groups (e.g., 1-10 phosphate groups). A plurality of nucleotides may comprise at least one type of nucleotide selected from the group consisting of: dATP, dGTP, dCTP, dTTP and dUTP. A plurality of nucleotides may comprise a mixture of any combination of two or more types of nucleotides selected from the group consisting of: dATP, dGTP, dCTP, dTTP and / or dUTP. In certain embodiments, at least one nucleotide in a plurality of nucleotides is not a nucleotide analog. In certain embodiments, at least one nucleotide in a plurality of nucleotides comprises a nucleotide analog.

[0302] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, at least one of the plurality of nucleotides comprises a chain of one, two or three phosphorus atoms, wherein the chain is typically connected to the 5' carbon of the sugar moiety by an ester or phosphoramide bond. In some embodiments, at least one of the plurality of nucleotides is an analog with a phosphorus chain, wherein the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups (including O, S or BH3). In some embodiments, the chain includes a phosphate group substituted with an analog, including phosphoramide, phosphorothioate, phosphorodithioate and O-methylphosphoramidite groups.

[0303] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, at least one of the multiple nucleotides is included in a terminator nucleotide analog with a chain termination portion (e.g., a blocking portion) at a sugar 2' location, at a sugar 3' location, or at a sugar 2' and 3' location. In some embodiments, the chain termination portion can inhibit the polymerase-catalyzed incorporation of subsequent nucleotide units or free nucleotides in the nascent chain during the primer extension reaction. In some embodiments, the chain termination portion is connected to the 3' sugar location, wherein the sugar comprises a ribose or deoxyribose moiety. In some embodiments, the chain termination portion can be removed / cut from the 3' sugar location to produce a nucleotide with a 3'OH sugar group, which can be extended with subsequent nucleotides in a polymerase-catalyzed nucleotide incorporation reaction. In some embodiments, the chain termination portion comprises an alkyl, alkenyl, alkynyl, allyl, aryl, benzyl, an azide group, an amine group, an amide group, a ketone group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, a silyl group, or an acetal group. In some embodiments, the chain-terminating moiety can be cleaved / removed from the nucleotide, for example, by reacting the chain-terminating moiety with a chemical agent, a pH change, light or heat. In some embodiments, the chain-terminating moiety alkyl, alkenyl, alkynyl and allyl groups can be cleaved with tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4), with piperidine or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the chain-terminating moiety aryl and benzyl groups can be cleaved with H2Pd / C. In some embodiments, the chain-terminating moiety amine, amide, ketone, isocyanate, phosphate, thio, disulfide can be cleaved with a phosphine or thiol group (including β-mercaptoethanol or dithiothreitol (DTT)). In some embodiments, the chain-terminating moiety carbonate can be cleaved with MeOH containing potassium carbonate (K2CO3), with pyridine containing triethylamine or with acetic acid (AcOH) containing Zn. In some embodiments, the chain-terminating moieties urea and silyl groups can be cleaved with tetrabutylammonium fluoride, pyridine-HF, with ammonium fluoride, or with triethylamine trihydrofluoride. In some embodiments, the chain-terminating moieties can be cleaved / removed with nitrous acid. In some embodiments, the chain-terminating moieties can be cleaved / removed using a solution comprising a nitrite (e.g., a combination of a nitrite and an acid such as acetic acid, sulfuric acid, or nitric acid). In some further embodiments, the solution can comprise an organic acid.

[0304] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, at least one of the plurality of nucleotides comprises a terminator nucleotide analog having a chain termination moiety (e.g., a blocking moiety) at the sugar 2' position, at the sugar 3' position, or at the sugar 2' and 3' positions. In some embodiments, the chain termination moiety comprises an azide, an azido, or an azidomethyl group. In some embodiments, the chain termination moiety comprises a 3'-O-azido or a 3'-O-azidomethyl group. In some embodiments, the chain termination moiety azide, an azido, and an azidomethyl group can be cleaved / removed with a phosphine compound. In some embodiments, the phosphine compound comprises a derived trialkylphosphine moiety or a derived triarylphosphine moiety. In some embodiments, the phosphine compound comprises tris(2-carboxyethyl)phosphine (TCEP), or bissulfotriphenylphosphine (BS-TPP) or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP). In some embodiments, the chain-terminating portion comprising one or more of 3'-O-amino, 3'-O-aminomethyl, 3'-O-methylamino or derivatives thereof can be cut with nitrous acid by a mechanism utilizing nitrous acid or using a solution comprising nitrous acid. In some embodiments, the chain-terminating portion comprising one or more of 3'-O-amino, 3'-O-aminomethyl, 3'-O-methylamino or derivatives thereof can be cut using a solution comprising nitrite. In some embodiments, for example, nitrite can be combined or contacted with an acid such as acetic acid, sulfuric acid or nitric acid. In some further embodiments, for example, nitrite can be combined or contacted with an organic acid (e.g., formic acid, acetic acid, propionic acid, butyric acid, isobutyric acid, etc.). In some embodiments, the chain-terminating portion comprises a 3'-acetal portion that can be cut with a palladium deblocking reagent (e.g., Pd(0)).

[0305] In some embodiments, in any of the methods described herein for sequencing a nucleic acid molecule, the nucleotide comprises a chain terminating portion selected from the group consisting of: 3'-deoxynucleotide, 2',3'-dideoxynucleotide, 3'-methyl, 3'-azido, 3'-azidomethyl, 3'-O-azidoalkyl, 3'-O-ethynyl, 3'-O-aminoalkyl, 3'-O-fluoroalkyl, 3'-fluoromethyl, 3'-difluoromethyl, 3'-trifluoromethyl, 3'-sulfonyl, 3'-malonyl, 3'-amino, 3'-O-amino, 3'-thiol, 3'-aminomethyl, 3'-ethyl, 3'butyl, 3'-tert-butyl, 3'-fluorenylmethyloxycarbonyl, 3'-tert-butoxycarbonyl, 3'-O-alkylhydroxyamino, 3'-phosphorothioate, 3-O-benzyl and 3'-O-benzyl, 3-acetal moiety or a derivative thereof.

[0306] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, a plurality of nucleotides include a plurality of nucleotides labeled with a detectable reporter gene moiety. The detectable reporter gene moiety includes a fluorophore. In some embodiments, the fluorophore is connected to a nucleotide base. In some embodiments, the fluorophore is connected to a nucleotide base with a joint that can be cut / removed from a base. In some embodiments, at least one nucleotide in a plurality of nucleotides is not labeled with a detectable reporter gene moiety. In some embodiments, a specific detectable reporter gene moiety (e.g., a fluorophore) connected to a nucleotide can correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP or dUTP) to allow detection and identification of nucleotide bases.

[0307] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, the cleavable linker on the nucleotide base comprises a cleavable portion comprising an alkyl, alkenyl, alkynyl, allyl, aryl, benzyl, an azide group, an amine group, an amide group, a ketone group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group or a silyl group. In some embodiments, the cleavable linker on the base can be cleaved / removed from the base by reacting the cleavable portion with a chemical agent, a pH change, light or heat. In some embodiments, the cleavable portion of alkyl, alkenyl, alkynyl and allyl can be cleaved with tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4), with piperidine or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the cleavable portion of aryl and benzyl can be cleaved with H2 Pd / C. In some embodiments, the cleavable moiety amine, amide, ketone, isocyanate, phosphate, thio, disulfide can be cleaved with a phosphine or thiol group (including β-mercaptoethanol or dithiothreitol (DTT)). In some embodiments, the cleavable moiety carbonate can be cleaved with MeOH containing potassium carbonate (K2CO3), with pyridine containing triethylamine, or with acetic acid (AcOH) containing Zn. In some embodiments, the cleavable moiety urea and silyl can be cleaved with tetrabutylammonium fluoride, pyridine-HF, with ammonium fluoride, or with triethylamine trihydrofluoride.

[0308] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, the cleavable linker on the nucleotide base comprises a cleavable portion comprising an azide, an azido or an azidomethyl. In some embodiments, the cleavable portion azide, an azido and an azidomethyl can be cleaved / removed with a phosphine compound. In some embodiments, the phosphine compound comprises a derived trialkylphosphine moiety or a derived triarylphosphine moiety. In some embodiments, the phosphine compound comprises tris(2-carboxyethyl)phosphine (TCEP), or bissulfotriphenylphosphine (BS-TPP) or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP).

[0309] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, the chain termination moiety (e.g., at the sugar 2' and / or sugar 3' location) and the cleavable linker on the nucleotide base have the same or different cleavable moieties. In some embodiments, the chain termination moiety (e.g., at the sugar 2' and / or sugar 3' location) and the detectable reporter moiety attached to the base can be chemically cleaved / removed with the same chemical agent. In some embodiments, the chain termination moiety (e.g., at the sugar 2' and / or sugar 3' location) and the detectable reporter moiety attached to the base can be chemically cleaved / removed with different chemical agents.

[0310] Multivalent molecules

[0311] Embodiments of the present disclosure provide methods for sequencing nucleic acid molecules, wherein any of the sequencing methods described herein employ at least one multivalent molecule. In some embodiments, the multivalent molecule comprises a plurality of nucleotide arms attached to a core and has any configuration, including a starburst, a scrambled, or a bottle brush configuration (e.g., Fig. 9 ). The multivalent molecule comprises: (1) a core; and (2) a plurality of nucleotide arms, the plurality of nucleotide arms comprising (i) a core linking portion, (ii) a spacer, the spacer comprising a PEG portion, (iii) a linker, and (iv) a nucleotide unit, wherein the core is linked to the plurality of nucleotide arms, wherein the spacer is connected to the linker, wherein the linker is connected to the nucleotide unit. In some embodiments, the nucleotide unit comprises a base, a sugar, and at least one phosphate group, and the linker is connected to the nucleotide unit via the base. In some embodiments, the linker comprises an aliphatic chain or an oligoethylene glycol chain, wherein both linker chains have 2-6 subunits. In some embodiments, the linker further comprises an aromatic portion. Example nucleotide arms are shown in Fig.13 Exemplary multivalent molecules are shown in Figure 9-12 Example spacers are shown in Fig.14(top) and example joints are shown in Figures (bottom) and Fig.15 Exemplary nucleotides linked to the linker are shown in Figure 16-19 An example biotinylated nucleotide arm is shown in Fig. 20 middle.

[0312] In some embodiments, the multivalent molecule comprises a core linked to a plurality of nucleotide arms, and wherein the plurality of nucleotide arms have the same type of nucleotide units selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0313] In certain embodiments, the multivalent molecule comprises a core connected to a plurality of nucleotide arms, wherein each arm comprises a nucleotide unit. The nucleotide unit comprises an aromatic base, a pentose (e.g., ribose or deoxyribose) and one or more phosphate groups (e.g., 1-10 phosphate groups). A plurality of multivalent molecules can comprise a type of multivalent molecule having a type of nucleotide unit selected from the group consisting of: dATP, dGTP, dCTP, dTTP and dUTP. A plurality of multivalent molecules can comprise a mixture of any combination of two or more types of multivalent molecules, wherein the independent multivalent molecule in the mixture comprises a nucleotide unit selected from the group consisting of: dATP, dGTP, dCTP, dTTP and / or dUTP.

[0314] In some embodiments, the nucleotide unit comprises a chain of one, two or three phosphorus atoms, wherein the chain is generally connected to the 5' carbon of the sugar moiety by an ester or phosphoramide bond. In some embodiments, at least one nucleotide unit is a nucleotide analog with a phosphorus chain, wherein the phosphorus atoms are linked together with an intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups (including O, S or BH3). In some embodiments, the chain includes a phosphate group substituted with an analog, including phosphoramide, phosphorothioate, phosphorodithioate and O-methylphosphoramidite groups.

[0315] In some embodiments, the multivalent molecule comprises a core connected to a plurality of nucleotide arms, and wherein the individual nucleotide arms comprise nucleotide units, which are nucleotide analogs having a chain termination portion (e.g., a blocking portion) at a sugar 2' position, at a sugar 3' position, or at a sugar 2' and 3' position. In some embodiments, the nucleotide unit comprises a chain termination portion (e.g., a blocking portion) at a sugar 2' position, at a sugar 3' position, or at a sugar 2' and 3' position. In some embodiments, the chain termination portion can inhibit the polymerase-catalyzed incorporation of subsequent nucleotide units or free nucleotides in the nascent chain during a primer extension reaction. In some embodiments, the chain termination portion is connected to a 3' sugar position, wherein the sugar comprises a ribose or deoxyribose portion. In some embodiments, the chain termination portion can be removed / cut from the 3' sugar position to produce a nucleotide having a 3'OH sugar group, which can be extended with subsequent nucleotides in a polymerase-catalyzed nucleotide incorporation reaction. In some embodiments, the chain termination portion comprises an alkyl, alkenyl, alkynyl, allyl, aryl, benzyl, an azide group, an amine group, an amide group, a ketone group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group or a silyl group. In some embodiments, the chain termination portion can be cut / removed from the nucleotide unit, for example, by reacting the chain termination portion with a chemical agent, a pH change, light or heat. In some embodiments, the chain termination portion alkyl, alkenyl, alkynyl and allyl groups can be cut with tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4), with piperidine or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the chain termination portion aryl and benzyl groups can be cut with H2Pd / C. In some embodiments, the chain termination portion amine, amide, ketone, isocyanate, phosphate, thio, disulfide can be cut with a phosphine or thiol group (including β-mercaptoethanol or dithiothreitol (DTT)). In some embodiments, the chain-terminating moiety carbonate can be cleaved with MeOH containing potassium carbonate (K2CO3), with pyridine containing triethylamine, or with acetic acid (AcOH) containing Zn. In some embodiments, the chain-terminating moieties urea and silyl can be cleaved with tetrabutylammonium fluoride, pyridine-HF, with ammonium fluoride, or with triethylamine trihydrofluoride.

[0316] In some embodiments, the nucleotide unit comprises a chain terminating portion (e.g., a blocking portion) at the sugar 2' position, at the sugar 3' position, or at the sugar 2' and 3' positions. In some embodiments, the chain terminating portion comprises an azide, an azido, or an azidomethyl. In some embodiments, the chain terminating portion comprises a 3'-O-azido or a 3'-O-azidomethyl. In some embodiments, the chain terminating portion azide, an azido, and an azidomethyl can be cleaved / removed with a phosphine compound. In some embodiments, the phosphine compound comprises a derived trialkylphosphine portion or a derived triarylphosphine portion. In some embodiments, the phosphine compound comprises tris(2-carboxyethyl)phosphine (TCEP), or bissulfotriphenylphosphine (BS-TPP) or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP).

[0317] In some embodiments, the nucleotide unit comprises a chain terminating portion selected from the group consisting of: 3'-deoxynucleotide, 2',3'-dideoxynucleotide, 3'-methyl, 3'-azido, 3'-azidomethyl, 3'-O-azidoalkyl, 3'-O-ethynyl, 3'-O-aminoalkyl, 3'-O-fluoroalkyl, 3'-fluoromethyl, 3'-difluoromethyl, 3'-trifluoromethyl, 3'-sulfonyl, 3'-malonyl, 3'-amino, 3'-O-amino, 3'-thiol, 3'-aminomethyl, 3'-ethyl, 3'butyl, 3'-tert-butyl, 3'-fluorenylmethyloxycarbonyl, 3'-tert-butoxycarbonyl, 3'-O-alkylhydroxyamino, 3'-phosphorothioate, and 3-O-benzyl or a derivative thereof.

[0318] In some embodiments, the multivalent molecule comprises a core connected to a plurality of nucleotide arms, wherein the nucleotide arms comprise spacers, joints and nucleotide units, and wherein the core, joints and / or nucleotide units are labeled with detectable reporter gene moieties. In some embodiments, the detectable reporter gene moieties comprise fluorophores. In some embodiments, the specific detectable reporter gene moieties (e.g., fluorophores) connected to the multivalent molecule can correspond to the bases (e.g., dATP, dGTP, dCTP, dTTP or dUTP) of the nucleotide units to allow detection and identification of nucleotide bases.

[0319] In some embodiments, at least one nucleotide arm of the multivalent molecule has a nucleotide unit connected to a detectable reporter gene portion. In some embodiments, the detectable reporter gene portion is connected to a nucleotide base. In some embodiments, the detectable reporter gene portion comprises a fluorophore. In some embodiments, the specific detectable reporter gene portion (e.g., a fluorophore) connected to the multivalent molecule can correspond to the base (e.g., dATP, dGTP, dCTP, dTTP or dUTP) of the nucleotide unit to allow detection and identification of the nucleotide base.

[0320] In some embodiments, the core of the multivalent molecule comprises an avidin-like or streptavidin-like portion and the core-linked portion comprises biotin. In some embodiments, the core comprises a streptavidin-type or avidin-type portion (including avidin protein), and any derivatives, analogs, and other non-natural forms of avidin that can be bound to at least one biotin portion. Other forms of avidin moieties include natural and recombinant avidin and streptavidin and derived molecules, such as non-glycosylated avidin and truncated streptavidin. For example, avidin moieties include deglycosylated forms of avidin, bacterial streptavidin produced by Streptomyces (Streptomyces) (e.g., Streptomyces avidinii) and derived forms, such as N-acyl avidin, such as N-acetyl, N-phthaloyl, and N-succinyl avidin, and commercially available products EXTRAVIDIN, CAPTAVIDIN, NEUTRAVIDIN, and NEUTRALIITEAVIDIN.

[0321] In some embodiments, any of the methods described herein for sequencing nucleic acid molecules may include forming a binding complex, wherein the binding complex comprises (i) a polymerase, a nucleic acid template molecule duplexed with a primer, and nucleotides, or the binding complex comprises (ii) a polymerase, a nucleic acid template molecule duplexed with a primer, and a nucleotide unit of a multivalent molecule. In some embodiments, the residence time of the binding complex is greater than about 0.1 seconds, 0.2 seconds, 0.3 seconds, 0.4 seconds, 0.5 seconds, 0.6 seconds, 0.7 seconds, 0.8 seconds, 0.9 seconds, or 1 second. The residence time of the binding complex is greater than about 0.1-0.25 seconds, or about 0.25-0.5 seconds, or about 0.5-0.75 seconds, or about 0.75-1 seconds, or about 1-2 seconds, or about 2-3 seconds, or about 3-4 seconds, or about 4-5 seconds, and / or wherein the method is or can be performed at a temperature of at or above 15°C, at or above 20°C, at or above 25°C, at or above 35°C, at or above 37°C, at or above 42°C, at or above 55°C, at or above 60°C, or at or above 72°C, or at or above 80°C, or within a range defined by any of the foregoing. The binding complex (e.g., ternary complex) remains stable until subjected to conditions that result in dissociation of the interaction between any of the polymerase, template molecule, primer, and / or nucleotide units or nucleotides. For example, the dissociation conditions include contacting the binding complex with any one of a detergent, EDTA and / or water or any combination thereof. In some embodiments, the disclosure provides the method, wherein the binding complex is deposited onto a surface, or attached or hybridized to the surface, and the surface shows a contrast-to-noise ratio greater than 20 in the detection step. In some embodiments, the disclosure provides the method, wherein the contacting is performed under conditions that stabilize the binding complex when the nucleotide or nucleotide unit is complementary to the next base of the template nucleic acid, and destabilize the binding complex when the nucleotide or nucleotide unit is not complementary to the next base of the template nucleic acid.

[0322] Compacted oligonucleotides

[0323] The compaction oligonucleotide comprises a single-stranded linear oligonucleotide and a compaction oligonucleotide, the single-stranded linear oligonucleotide having a 5' region that can be hybridized with the first part of the concatemer molecule, and the compaction oligonucleotide having a 3' region that can be hybridized with the second part of the concatemer molecule (e.g., identical concatemer molecule). In certain embodiments, the hybridization of the compaction oligonucleotide and the individual concatemer molecule causes the concatemer molecule to collapse or fold into a DNA nanoball, which is more compact in shape and size compared to the non-collapsed DNA molecule. The point image of the DNA nanoball can be represented as a Gaussian spot, and the size can be measured as a half-maximum full width (FWHM). The smaller point size as indicated by the smaller FWHM is generally associated with the improved image of the point. In certain embodiments, the FWHM of the DNA nanoball point can be about 10um or less. The DNA nanoball can be a compact nucleic acid structure, which has a smaller half-maximum full width (FWHM) compared to the concatemer that is not collapsed / folded into the DNA nanoball.

[0324] In some embodiments, the compacted oligonucleotide comprises a single-stranded oligonucleotide comprising DNA, RNA, or a combination of DNA and RNA. The compacted oligonucleotide can be any length, including 20-150 nucleotides, or 30-100 nucleotides, or 40-80 nucleotides in length.

[0325] In some embodiments, the compacted oligonucleotide comprises a 5' region and a 3' region, and optionally an intermediate region between the 5' region and the 3' region. The intermediate region can be any length, for example, a length of about 2-20 nucleotides. The intermediate region comprises a homopolymer with continuous identical bases (e.g., AAA, GGG, CCC, TTT or UUU). The intermediate region comprises a non-homopolymer sequence.

[0326] The 5' region of the compacted oligonucleotide can be fully complementary or partially complementary to the first portion of the concatemer molecule along its length. The 3' region of the compacted oligonucleotide can be fully complementary or partially complementary to the second portion of the concatemer molecule along its length. The 5' region of the compacted oligonucleotide can hybridize with the first universal sequence portion of the concatemer molecule. The 3' region of the compacted oligonucleotide can hybridize with the second universal sequence portion of the concatemer molecule. The 5' and 3' regions of the compacted oligonucleotide can hybridize with the concatemer to pull the distal portion of the concatemer together, thereby compacting the concatemer to form a DNA nanoball.

[0327] The 5' region of the compacted oligonucleotide may have the same sequence as the 3' region. The 5' region of the compacted oligonucleotide may have a different sequence than the 3' region. The 3' region of the compacted oligonucleotide may have the opposite sequence than the 5' region.

[0328] In some embodiments, sequence data can be obtained by nanopore sequencing, which comprises sequencing nucleic acids by translocating the nucleic acids across a membrane (such as through a hole), and wherein sequence reading or base calling is performed by measuring one or more signals (such as impedance, current, voltage, or capacitance) during the translocation event. In some embodiments, the identity of the nucleotide can be determined by a unique electrical feature, such as the timing, duration, degree, or linearity of a current block, impedance change, voltage change, or capacitance change. Sequencing nucleic acids by translocation across a membrane and / or through a hole does not exclude alternative detection methods, such as optical, chemical, biochemical, fluorescent, luminescent, magnetic, electromagnetic, acoustic, or electroacoustic detection.

[0329] Supports and low non-specific coatings

[0330] In some embodiments, Figure 1 The flow cell 112 in can include a carrier, for example, a solid phase carrier as disclosed herein. The present disclosure provides paired sequencing compositions and methods, which use carriers containing multiple oligonucleotide surface primers fixed thereon. In some embodiments, the carrier is passivated with a low non-specific binding coating. The surface coating described herein exhibits very low non-specific binding to reagents (such as dyes, nucleotides, enzymes and nucleic acid primers) commonly used in nucleic acid capture, amplification and sequencing workflows. Compared with conventional surface coatings, the surface coating exhibits low background fluorescence signals or high contrast to noise (CNR) ratios.

[0331] The low nonspecific binding coating comprises one or more layers ( Fig.21 ).like Fig.21 As shown, in some embodiments, the support comprises alternating layers of a glass substrate and a hydrophilic coating covalently or non-covalently attached to the glass, and the support further comprises chemically reactive functional groups that serve as attachment sites for oligonucleotide primers.

[0332] In some embodiments, a variety of surface primers are fixed to low non-specific binding coatings. In some embodiments, at least one surface primer is embedded in the low non-specific binding coating. Low non-specific binding coatings enable to improve nucleic acid hybridization and amplification performance. Typically, the carrier comprises a substrate (or carrier structure), one or more layers (e.g., silane layer, polymer film) of a low binding chemical modification layer covalently or non-covalently attached, and one or more surface primers that can be used to tether single-stranded nucleic acid library molecules to the covalent or non-covalent attachment of the carrier. In some embodiments, the deployment of the coating (e.g., the chemical composition of one or more layers, the total number of coupling chemistry and layers for cross-linking one or more layers to the carrier and / or cross-linking each other) can vary so that the non-specific binding of proteins, nucleic acid molecules and other hybridization and amplification reaction components to the coating is minimized or reduced relative to a comparable monolayer. The deployment of the coating described herein can vary so that the non-specific hybridization on the coating is minimized or reduced relative to a comparable monolayer. The deployment of the coating can vary so that the non-specific amplification on the coating is minimized or reduced relative to a comparable monolayer. The deployment of the coating can vary so that the specific amplification rate and / or the yield on the coating are maximized. In some cases disclosed herein, amplification levels suitable for detection are achieved in no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, or more than 30 cycles of amplification.

[0333] The support structure comprising one or more chemically modified layers (e.g., a layer of a low non-specific binding polymer) can be independent or can be integrated into another structure or component. For example, in some embodiments, the support structure can comprise one or more surfaces within an integrated or assembled microfluidic flow cell. The support structure can comprise one or more surfaces within a microplate format (e.g., the bottom surface of a hole in a microplate). In some embodiments, the support structure comprises the inner surface of a capillary (e.g., the lumen surface). In some embodiments, the support structure comprises the inner surface of a capillary etched into a planar chip (e.g., the lumen surface).

[0334] The attachment chemistry for grafting the first chemically modified layer to the surface of the carrier will generally depend on both the material of the manufacturing surface and the chemical properties of the layer. In some embodiments, the first layer can be covalently attached to the surface. In some embodiments, the first layer can be non-covalently attached to the carrier (e.g., adsorbed to the carrier) by non-covalent interactions (such as electrostatic interactions, hydrogen bonding, or van der Waals interactions) between the molecular components of the carrier and the first layer. In either case, the carrier can be treated before the connection or deposition of the first layer. Any of the surface preparation techniques known to those skilled in the art can be used to clean or treat the surface. For example, a glass or silicon surface can be pickled using a Piranha solution (a mixture of sulfuric acid (H2SO4) and hydrogen peroxide (H2O2), alkaline treatment in KOH and NaOH, and / or cleaned using an oxygen plasma treatment method.

[0335] Silane chemistry constitutes a non-limiting method for covalently modifying silanol groups on glass or silicon surfaces to attach more reactive functional groups (such as amines or carboxyls), which can then be used to couple linker molecules (e.g., linear hydrocarbon molecules of various lengths, such as C6, C12, C18 hydrocarbons or linear polyethylene glycol (PEG) molecules) or layer molecules (e.g., branched PEG molecules or other polymers) to the surface. Examples of suitable silanes that can be used to produce any of the disclosed low binding coatings include, but are not limited to: (3-aminopropyl) trimethoxysilane (APTMS), (3-aminopropyl) triethoxysilane (APTES), any of a variety of PEG-silanes (e.g., containing molecular weights of 1K, 2K, 5K, 10K, 20K, etc.), amino-PEG silanes (i.e., containing free amino functional groups), maleimide-PEG silanes, biotin-PEG silanes, and the like.

[0336] Any of a variety of molecules known to those skilled in the art (including but not limited to amino acids, peptides, nucleotides, oligonucleotides, other monomers or polymers, or combinations thereof) can be used to produce one or more chemically modified layers on a support, wherein the selection of components used can be varied to alter one or more properties of the layer (e.g., surface density of functional groups and / or tethered oligonucleotide primers, hydrophilicity / hydrophobicity of the layer, or three-dimensional properties of the layer (i.e., "thickness")). Examples of polymers that can be used to produce one or more layers of low nonspecific binding material in any disclosed coating include, but are not limited to, polyethylene glycol (PEG) of various molecular weights and branched structures, streptavidin, polyacrylamide, polyesters, dextran, polylysine and polylysine copolymers, or any combination thereof. Examples of conjugation chemistries that can be used to graft one or more layers of material (e.g., polymer layers) to a surface and / or cross-link layers to each other include, but are not limited to: biotin-streptavidin interaction (or variants thereof), his tag-Ni / NTA conjugation chemistry, methoxy ether conjugation chemistry, carboxylate conjugation chemistry, amine conjugation chemistry, NHS esters, maleimides, thiols, epoxies, azides, hydrazides, alkynes, isocyanates, and silanes.

[0337] The low non-specific binding surface coating can be applied uniformly across the carrier. Alternatively, the surface coating can be patterned so that the chemically modified layer is confined to one or more discrete regions of the carrier. For example, photolithography can be used to pattern the coating to produce an ordered array or random pattern of chemically modified regions on the carrier. Alternatively or in combination, contact printing and / or inkjet printing techniques can be used, for example, to pattern the coating. In some embodiments, the ordered array or random pattern of chemically modified regions may comprise at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10,000 or more discrete regions.

[0338] In certain embodiments, the low non-specific binding coating comprises a hydrophilic polymer that is non-specifically adsorbed or covalently grafted to a carrier. Typically, poly(ethylene glycol) (PEG, also referred to as polyethylene oxide (PEO) or polyoxyethylene) or other hydrophilic polymers with different molecular weights and end groups connected to the carrier using, for example, silane chemistry are used to perform passivation. End groups away from the surface may include, but are not limited to, biotin, methoxy ethers, carboxylates, amines, NHS esters, maleimides, and disilanes. In certain embodiments, two or more layers of a hydrophilic polymer (e.g., a linear polymer, a branched polymer, or a multi-branched polymer) may be deposited on the surface. In certain embodiments, two or more layers may be covalently coupled to each other or internally cross-linked to improve the stability of the resulting coating. In certain embodiments, surface primers (or other biomolecules, e.g., enzymes or antibodies) with different nucleotide sequences and / or base modifications may be tethered to the resulting layer with various surface densities. In certain embodiments, for example, both surface functional group density and surface primer concentration may vary to obtain a desired surface primer density range. Additionally, the surface primer density can be controlled by diluting the surface primer with other molecules carrying the same functional group. For example, the surface primer labeled with an amine can be diluted with polyethylene glycol labeled with an amine in the reaction with the surface coated with NHS-ester to reduce the final primer density. The surface primer with a joint of different lengths between the hybridization zone and the surface connection functional group can also be applied to control the surface density. The example of a suitable joint includes poly-T and poly-A chains (for example, 0 to 20 bases), PEG joints (for example, 3 to 20 monomer units) and carbon chains (for example, C6, C12, C18, etc.) at the 5' end of the primer. In order to measure the primer density, the primer labeled with a fluorescent mode can be tethered to the surface, and then the fluorescence reading is compared with the fluorescence reading of the dye solution of known concentration.

[0339] In some embodiments, the low nonspecific binding coating comprises a functionalized polymer coating covalently bound to at least a portion of the support via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water-soluble protective coating and the functionalized polymer coating on the primer. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM).

[0340] In order to scale the primer surface density and add additional dimensions to the hydrophilic or amphiphilic coating, a carrier containing a multilayer coating of PEG and other hydrophilic polymers has been developed. By using hydrophilic and amphiphilic surface layering methods (including but not limited to polymer / copolymer materials described below), the primer loading density on the carrier can be significantly increased. The traditional PEG coating method uses a monolayer primer deposition, which is generally reported for single molecule applications, but does not produce high copy numbers for nucleic acid amplification applications. As described herein, "layering" can be achieved using traditional cross-linking methods with any compatible polymer or monomer subunit, so that a surface containing two or more highly cross-linked layers can be sequentially constructed. Examples of suitable polymers include but are not limited to streptavidin, polyacrylamide, polyester, dextran, polylysine, and copolymers of polylysine and PEG. In certain embodiments, different layers can be connected to each other by any of a variety of conjugation reactions (including but not limited to: biotin-streptavidin binding, azide-alkyne click reaction, amine-NHS ester reaction, thiol-maleimide reaction, and ionic interactions between positively charged polymers and negatively charged polymers). In some embodiments, high primer density materials can be constructed in solution and then layered onto a surface in multiple steps.

[0341] Examples of materials from which the support structure may be made include, but are not limited to, glass, fused silica, silicon, polymers (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethyl methacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)), or any combination thereof. Various compositions of both glass and plastic support structures are contemplated.

[0342] The support structure can be presented in any of a variety of geometric shapes and sizes known to those skilled in the art, and can include any of a variety of materials known to those skilled in the art. For example, the support structure can be locally planar (e.g., a surface comprising a microscope slide or a microscope slide). In general, the support structure can be cylindrical (e.g., an inner surface comprising a capillary or a capillary), spherical (e.g., an outer surface comprising a non-porous bead) or irregular (e.g., an outer surface comprising an irregularly shaped non-porous bead or particle). In certain embodiments, the surface of the support structure for nucleic acid hybridization and amplification can be a solid non-porous surface. In certain embodiments, the surface of the support structure for nucleic acid hybridization and amplification can be porous, so that the coating described herein penetrates the porous surface, and the nucleic acid hybridization and amplification reactions performed thereon can occur in the hole.

[0343] The support structure comprising one or more chemically modified layers (e.g., a layer of a low non-specific binding polymer) can be independent or can be integrated into another structure or component. For example, the support structure can comprise one or more surfaces within an integrated or assembled microfluidic flow cell. The support structure can comprise one or more surfaces within a microwell plate format (e.g., the bottom surface of a hole in a microwell plate). In some embodiments, the support structure comprises the inner surface of a capillary (e.g., the lumen surface). In some embodiments, the support structure comprises the inner surface of a capillary etched into a planar chip (e.g., the lumen surface).

[0344] As noted, low non-specific binding carriers of the present disclosure show non-specific binding of the reduction of other components of proteins, nucleic acids and hybridization and / or amplification preparations for solid phase nucleic acid amplification. The degree of non-specific binding shown by a given carrier surface can be assessed in a qualitative manner or in a quantitative manner. For example, under a set of standardized conditions, the surface is exposed to a fluorescent dye (for example, cyanine (such as Cy3 or Cy5, etc.), fluorescein, coumarin, rhodamine, etc. or other dye disclosed herein), through fluorescently labeled nucleotides, through fluorescently labeled oligonucleotides and / or through fluorescently labeled proteins (for example, polymerase), then the specified flushing scheme and fluorescence imaging can be used as a qualitative tool to compare the non-specific binding on the carrier comprising different surface preparations. In some embodiments, in some aspects, the surface is exposed to fluorescent dyes, fluorescently labeled nucleotides, fluorescently labeled oligonucleotides and / or fluorescently labeled proteins (e.g., polymerases) under a standardized set of conditions, and then a specified wash scheme and fluorescence imaging can be used as a quantitative tool to compare nonspecific binding on carriers containing different surface preparations-provided that care has been taken to ensure that the fluorescence imaging is linearly related (or predictably related) to the number of fluorophores on the carrier surface and that suitable calibration standards are used (e.g., under conditions where signal saturation and / or self-quenching of fluorophores is not a problem). In some embodiments, other techniques known to those skilled in the art (e.g., radioisotope labeling and counting methods) can be used to quantitatively assess the degree of nonspecific binding exhibited by different carrier surface preparations of the present disclosure.

[0345] Some surfaces disclosed herein exhibit a ratio of specific binding to non-specific binding of a fluorophore (such as Cy3) of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or greater than 100, or any intermediate value encompassed by ranges herein. Some surfaces disclosed herein exhibit a ratio of specific fluorescence to non-specific fluorescence of a fluorophore (such as Cy3) of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or greater than 100, or any intermediate value encompassed by ranges herein.

[0346] The degree of non-specific binding exhibited by the disclosed low binding carrier can be assessed using a standardized protocol for the following: contact the surface with a labeled protein (e.g., bovine serum albumin (BSA), streptavidin, DNA polymerase, reverse transcriptase, helicase, single-stranded binding protein (SSB), etc., or any combination thereof), labeled nucleotides, labeled oligonucleotides, etc., under a standardized set of incubation and flushing conditions, followed by detection of the amount of labeling remaining on the surface and comparing the signal obtained therefrom with an appropriate calibration standard. In some embodiments, the labeling can include a fluorescent label. In some embodiments, the labeling can include a radioactive isotope. In some embodiments, the labeling can include any other detectable labeling known to those skilled in the art. In some embodiments, the degree of non-specific binding exhibited by a given carrier surface preparation can therefore be assessed based on the number of non-specifically bound protein molecules (or nucleic acid molecules or other molecules) / unit area. In some embodiments, the low binding carrier of the present disclosure may exhibit the following non-specific protein binding (or non-specific binding of other specified molecules (e.g., cyanine (such as Cy3 or Cy5, etc.), fluorescein, coumarin, rhodamine, etc. or other dyes disclosed herein)): less than 0.001 molecules / μm 2 , less than 0.01 molecule / μm 2 , less than 0.1 molecule / μm 2 , less than 0.25 molecules / μm 2 , less than 0.5 molecules / μm 2 , less than 1 molecule / μm 2 , less than 10 molecules / μm 2 , less than 100 molecules / μm 2 or less than 1,000 molecules / μm 2 Those skilled in the art will recognize that a given support surface of the present disclosure may exhibit a density anywhere within this range (e.g., less than 86 molecules / μm2 ) non-specific binding. For example, after contact with 1 μM Cy3-labeled streptavidin (GE Amersham) in phosphate buffered saline (PBS) buffer for 15 minutes, followed by rinsing with deionized water three times, some of the modified surfaces disclosed herein exhibited less than 0.5 molecules / μm 2 Some of the modified surfaces disclosed herein exhibit less than 0.25 molecules / μm 2In a separate nonspecific binding assay, 1 μM labeled Cy3 SA (ThermoFisher), 1 μM Cy5 SA dye (ThermoFisher), 10 μM aminoallyl-dUTP-ATTO-647N (Jena Biosciences), 10 μM aminoallyl-dUTP-ATTO-Rhol 1 (Jena Biosciences), 10 μM aminoallyl-dUTP-ATTO-Rhol 1 (Jena Biosciences), 10 μM 7-propargylamino-7-deaza-dGTP-Cy5 (Jena Biosciences), and 10 μM 7-propargylamino-7-deaza-dGTP-Cy3 (Jena Biosciences) were incubated on low-binding coated supports in a 384-well plate format at 37°C for 15 minutes. Each well is rinsed 2-3 times with 50ul deionized RNase / DNase-free water, and rinsed 2-3 times with 25mMACES buffer (pH 7.4).Use Cy3, AF555 or Cy5 filter set (according to the dye test performed) as specified by the manufacturer with 800 PMT gain setting and 50-100 μ m resolution on GE Typhoon instrument to image 384 well plates. For higher resolution imaging, images were collected on an Olympus IX83 microscope (e.g., an inverted fluorescence microscope) (Olympus Corp., Center Valley, Pa.) with a total internal reflection fluorescence (TIRF) objective (100×, 1.5 NA, Olympus), a CCD camera (e.g., an Olympus EM-CCD monochrome camera, an Olympus XM-10 monochrome camera, or an Olympus DP80 color and monochrome camera), an illumination source (e.g., an Olympus 100 W mercury lamp, an Olympus 75 W xenon lamp, or an Olympus U-HGLGPS fluorescence light source), and an excitation wavelength of 532 nm or 635 nm. Dichroic mirrors were purchased from Semrock (IDEX Health & Science, LLC, Rochester, NY), such as 405 nm, 488 nm, 532 nm, or 633 nm dichroic mirrors / beam splitters, and the bandpass filter was selected to be a 532LP or 645LP integrated with the appropriate excitation wavelength. Some modified surfaces disclosed herein exhibit less than 0.25 molecules / μm 2 In some embodiments, the coated support is immersed in a buffer (e.g., 25 mM CAES, pH 7.4) while acquiring an image.

[0347] In some embodiments, some surfaces disclosed herein exhibit a ratio of specific binding to non-specific binding of a fluorophore (such as Cy3) of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or greater than 100, or any intermediate value encompassed by the range herein. In some embodiments, surfaces disclosed herein exhibit a ratio of specific fluorescence signal to non-specific fluorescence signal of a fluorophore (such as Cy3) of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or greater than 100, or any intermediate value encompassed by the range herein.

[0348] Low background surfaces consistent with the disclosure herein can exhibit a ratio of specific dye attachment (e.g., Cy3 attachment) to nonspecific dye adsorption (e.g., Cy3 dye adsorption) of at least 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 30:1, 40:1, 50:1, or more than 50 attached specific dye molecules / nonspecifically adsorbed molecules. Similarly, low background surfaces consistent with the disclosure herein that have been attached to fluorophores (e.g., Cy3) can exhibit a ratio of specific fluorescent signals (e.g., generated from Cy3-labeled oligonucleotides attached to the surface) to nonspecifically adsorbed dye fluorescent signals of at least 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 30:1, 40:1, 50:1, or more than 50:1 when subjected to excitation energy.

[0349] In some embodiments, the degree of hydrophilicity (or "wetting" with aqueous solutions) of the disclosed carrier surface can be evaluated, for example, by measuring the water contact angle, wherein a small drop of water is placed on the surface and its contact angle with the surface is measured using, for example, an optical tensiometer. In some embodiments, a static contact angle can be determined. In some embodiments, an advancing or receding contact angle can be determined. In some embodiments, the water contact angle for a hydrophilic low binding carrier surface disclosed herein can be in the range of about 0 degrees to about 30 degrees. In some embodiments, the water contact angle for a hydrophilic low binding carrier surface disclosed herein can be no more than 50 degrees, 40 degrees, 30 degrees, 25 degrees, 20 degrees, 18 degrees, 16 degrees, 14 degrees, 12 degrees, 10 degrees, 8 degrees, 6 degrees, 4 degrees, 2 degrees or 1 degree. In many cases, the contact angle does not exceed 40 degrees. Those skilled in the art will recognize that a given hydrophilic low binding carrier surface of the present disclosure can exhibit a water contact angle with a value anywhere within this range.

[0350] In some embodiments, the hydrophilic surfaces disclosed herein help reduce wash times for bioassays, which is generally due to reduced non-specific binding of biomolecules to low binding surfaces. In some embodiments, a sufficient wash step can be performed in less than 60 seconds, 50 seconds, 40 seconds, 30 seconds, 20 seconds, 15 seconds, 10 seconds, or less than 10 seconds. For example, a sufficient wash step can be performed in less than 30 seconds.

[0351] Some low binding surfaces disclosed herein exhibit significant improvements in stability or durability to prolonged exposure to solvents and elevated temperatures or to repeated cycles of solvent exposure or changes in temperature. For example, the stability of the disclosed surfaces can be tested by fluorescently labeling functional groups on the surface or tethered biomolecules (e.g., oligonucleotide primers) on the surface and monitoring the fluorescent signal before, during, and after prolonged exposure to solvents and elevated temperatures or repeated cycles of solvent exposure or changes in temperature. In some embodiments, the degree of change in fluorescence used to assess the quality of a surface can be less than 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, or 25% (or any combination of these percentages as measured over these time periods) over a period of 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 45 hours, 50 hours, or 100 hours of exposure to a solvent and / or elevated temperature. In some embodiments, the degree of change in fluorescence used to assess the quality of a surface can be less than 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20% or 25% (or any combination of these percentages as measured over this range of cycles) over 5 cycles, 10 cycles, 20 cycles, 30 cycles, 40 cycles, 50 cycles, 60 cycles, 70 cycles, 80 cycles, 90 cycles, 100 cycles, 200 cycles, 300 cycles, 400 cycles, 500 cycles, 600 cycles, 700 cycles, 800 cycles, 900 cycles or 1,000 cycles.

[0352] In some embodiments, the surfaces disclosed herein can exhibit a high ratio of specific signal to nonspecific signal or other background. For example, when used for nucleic acid amplification, some surfaces can exhibit an amplified signal that is at least 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 75 times, 100 times, or more than 100 times the signal of the adjacent unpopulated region of the surface. Similarly, some surfaces exhibit an amplified signal that is at least 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 75 times, 100 times, or more than 100 times the signal of the adjacent amplified nucleic acid population region of the surface.

[0353] In some embodiments, when used in nucleic acid hybridization or amplification applications to generate populations of hybridized or clonally amplified nucleic acid molecules (e.g., that have been directly or indirectly labeled with a fluorophore), fluorescent images of the disclosed low background surfaces exhibit a contrast to noise ratio (CNR) of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 210, 220, 230, 240, 250, or greater.

[0354] One or more types of primers can be connected or tethered to the carrier surface. In some embodiments, one or more types of adapters or primers can include a spacer sequence, an adapter sequence for hybridizing to a target library nucleic acid sequence connected to the adapter, a forward amplification primer, a reverse amplification primer, a sequencing primer, and / or a molecular barcode sequence, or any combination thereof. In some embodiments, 1 primer or adapter sequence can be tethered to at least one layer of the surface. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 different primers or adapter sequences can be tethered to at least one layer of the surface.

[0355] In some embodiments, the length of the tethered adapter and / or primer sequence can be in the range of about 10 nucleotides to about 100 nucleotides. In some embodiments, the length of the tethered adapter and / or primer sequence can be at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides. In some embodiments, the length of the tethered adapter and / or primer sequence can be at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20, or at most 10 nucleotides. Any of the lower and upper limit values ​​described in this paragraph can be combined to form a range included in the present disclosure, for example, in some embodiments, the length of the tethered adapter and / or primer sequence can be in the range of about 20 nucleotides to about 80 nucleotides. One skilled in the art will recognize that the length of the tethered adaptor and / or primer sequence can have any value within this range, for example, about 24 nucleotides.

[0356] In some embodiments, the resulting surface density of primers (eg, capture primers) on the surface of a low binding support of the present disclosure can be between about 100 primer molecules / μm 2 To about 100,000 primer molecules / μm 2 In some embodiments, the resulting surface density of primers on the surface of the low binding support of the present disclosure can be about 1,000 primer molecules / μm 2 To about 1,000,000 primer molecules / μm 2 In some embodiments, the surface density of the primers can be at least 1,000, at least 10,000, at least 100,000, or at least 1,000,000 molecules / μm 2 In some embodiments, the surface density of primers may be at most 1,000,000, at most 100,000, at most 10,000, or at most 1,000 molecules / μm 2 Any of the lower and upper values ​​described in this paragraph can be combined to form a range included in the present disclosure. For example, in some embodiments, the surface density of primers can be about 10,000 molecules / μm. 2 to about 100,000 molecules / μm 2 Those skilled in the art will recognize that the surface density of primer molecules can have any value within this range, for example, about 455,000 molecules / μm 2In some embodiments, the surface density of target library nucleic acid sequences that initially hybridize to adapter or primer sequences on the support surface can be less than or equal to the surface density indicated by the surface density of tethered primers. In some embodiments, the surface density of clonally amplified target library nucleic acid sequences that hybridize to adapter or primer sequences on the support surface can span the same range as the range indicated by the surface density of tethered primers.

[0357] The local densities listed above do not exclude variations in density across the surface, such that a surface may contain oligonucleotides at a density of, for example, 500,000 / μm 2 region, while also comprising at least a second region having a significantly different local density.

[0358] In some embodiments, the performance of nucleic acid hybridization and / or amplification reactions using the disclosed reaction formulations and low-binding carriers can be evaluated using fluorescent imaging techniques, wherein the contrast-to-noise ratio (CNR) of the image provides a key metric in evaluating amplification-specific and non-specific binding on the carrier. CNR is generally defined as: CNR = (signal-background) / noise. The background term is generally considered to be the signal measured for the gap region around a specific feature (diffraction-limited spot (DLS)) in a specified region of interest (ROI). Although the signal-to-noise ratio (SNR) is generally considered to be a benchmark for overall signal quality, it can be demonstrated that in applications requiring rapid image capture (e.g., sequencing applications where cycle time must be minimized), improved CNR can provide significant advantages over SNR as a benchmark for signal quality, as shown in the examples below. At high CNRs, even with moderate improvements in CNR, the imaging time required to achieve accurate differentiation (and therefore accurate base calls in the case of sequencing applications) can be greatly reduced. Improved CNR in imaging data with respect to imaging integration time provides a method for more accurately detecting features (such as clonally amplified nucleic acid colonies on the surface of a carrier).

[0359] In most ensemble-based sequencing methods, the background term is usually measured as the signal associated with the 'gap' region. 间隙 ), the “intrastitial” background (B 内质 ) is present in the area occupied by the amplified DNA colonies. The combination of these two background signals determines the achievable CNR and subsequently directly affects the optical instrument requirements, architecture cost, reagent cost, run time, cost / genome, and ultimately the accuracy and data quality of cycle array-based sequencing applications. 间隙Background signals are generated from a variety of sources; some examples include: autofluorescence from consumable flow cells, nonspecific adsorption of detection molecules that produce false fluorescent signals that may obscure signals from the ROI, and the presence of nonspecific DNA amplification products (e.g., nonspecific DNA amplification products generated from primer dimers). In typical next-generation sequencing (NGS) applications, this background signal in the current field of view (FOV) is averaged and subtracted over time. The signals generated from individual DNA colonies (i.e., (signal)-B(gap) in the FOV) generate distinguishable features that can be classified. In some embodiments, endoplasmic background (B(endoplasmic)) can contribute confounding fluorescent signals that are not specific to the target of interest, but are present in the same ROI, thus making averaging and subtraction much more difficult.

[0360] Nucleic acid amplification on low-binding coated carriers described herein can reduce B (gap) background signals by reducing nonspecific binding, which can lead to improvements in specific nucleic acid amplification and can lead to reductions in nonspecific amplification (which can affect background signals generated from both gaps and endoplasmic regions). In some embodiments, the disclosed low-binding coated carriers (optionally used in combination with the disclosed hybridization and / or amplification reaction preparations) can improve CNR by 2-fold, 5-fold, 10-fold, 100-fold, 250-fold, 500-fold, or 1000-fold compared to improvements achieved using conventional carriers and hybridization, amplification, and / or sequencing protocols. Although described herein in the context of using fluorescence imaging as a readout or detection mode, the same principles also apply to using the disclosed low-binding coated carriers and nucleic acid hybridization and amplification preparations for other detection modes (including both optical and non-optical detection modes).

[0361] The headings provided herein are not limitations of the various embodiments of the disclosure, which can be understood by referring to the specification as a whole.

[0362] Unless otherwise defined, the technology and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art. In general, the terms related to the technology of molecular biology, nucleic acid chemistry, protein chemistry, genetics, microbiology, transgenic cell production and hybridization described herein are well-known and commonly used terms in the art. The technology and procedures described herein are usually performed according to conventional methods well known in the art and as described in the various general and more specific references cited and discussed throughout this specification. For example, see Sambrook et al., " Molecular Cloning: Laboratory Manual (Molecular Cloning:A Laboratory Manual)" (3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) 2000). See also Ausubel et al., " Molecular Biology Experiment Guide (Current Protocols in Molecular Biology) ", Greene Publishing Associates (Greene Publishing Associates) (1992). The nomenclature used in combination with laboratory procedures and techniques described herein is well known and commonly used in the art.

[0363] Unless otherwise required by context herein, singular terms shall include pluralities and plural terms shall include the singular. The singular forms "a / an" and "the" and any word used in the singular include plural referents unless expressly and unequivocally limited to one referent.

[0364] It should be understood that the use of alternative terms (eg, "or") is taken to mean one or both of the alternatives, or any combination thereof.

[0365] As used herein, the term "and / or" will be deemed to mean that each of the specified features or components is explicitly disclosed with or without the other. For example, the term "and / or" used in phrases such as "A and / or B" herein is intended to include: "A and B"; "A or B"; "A" (A alone); and "B" (B alone). In a similar manner, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: "A, B, and C"; "A, B, or C"; "A or C"; "A or B"; "B or C"; "A and B"; "B and C"; "A and C"; "A" (A alone); "B" (B alone); and "C" (C alone).

[0366] As used herein and in the appended claims, the terms "comprising," "including," "having," and "containing," and grammatical variations thereof, as used herein, are intended to be non-limiting, such that one or more items in a list are not exclusive of other items that can be substituted or added to the listed items. It should be understood that whenever an embodiment is described herein with the language "comprising," other similar embodiments described with "consisting of" and / or "consisting essentially of" are also provided.

[0367] As used herein, the terms "about", "approximately" and "substantially" refer to values ​​or compositions within an acceptable error range for a particular value or composition as determined by a person of ordinary skill in the art, which will depend in part on how to measure or determine the value or composition, i.e., the limitations of the measurement system. For example, according to practice in the art, "about", "approximately" or "substantially" may mean within one or more than one standard deviation. Alternatively, "about" or "approximately" may mean a range of up to 10% (i.e., ± 10%) or more, depending on the limitations of the measurement system. For example, about 5 mg may include any number between 4.5 mg and 5.5 mg. In addition, particularly for biological systems or methods, the term may mean a value of up to an order of magnitude or up to 5 times. When a particular value or composition is provided in the present disclosure, unless otherwise stated, the meaning of "about", "approximately", "substantially" should be assumed to be within an acceptable error range for the particular value or composition. In addition, in the case of providing a range and / or sub-range of a value, the range and / or sub-range may include the endpoints of the range and / or sub-range.

[0368] The term "colony" as used herein refers to a nucleic acid library molecule that can be cloned in a solution or on a carrier to generate an amplicon that can serve as a template molecule for sequencing. In certain embodiments, a linear library molecule can be cyclized to generate a cyclized library molecule, and the cyclized library molecule can be cloned in a solution or on a carrier to generate a concatemer. In certain embodiments, a concatemer can serve as a nucleic acid template molecule that can be sequenced. A concatemer is sometimes referred to as a colony. In certain embodiments, a colony includes a nucleotide chain.

[0369] The terms "peptide", "polypeptide" and "protein" and other related terms used herein are used interchangeably and refer to polymers of amino acids and are not limited to any specific length. Polypeptides may contain natural and non-natural amino acids. Polypeptides include recombinant or chemically synthesized forms. Polypeptides also include precursor molecules that have not yet undergone post-translational modifications, such as proteolytic cleavage, cleavage due to ribosome skipping, hydroxylation, methylation, lipidation, acetylation, SUMOylation, ubiquitination, glycosylation, phosphorylation and / or disulfide bond formation. These terms encompass natural and artificial proteins, protein fragments and polypeptide analogs (such as mutant proteins, variants, chimeric proteins and fusion proteins) of protein sequences, as well as proteins that are covalently or non-covalently modified after translation or otherwise.

[0370] As used herein, the term "polymerase" and its variants include any enzyme that can catalyze nucleotides (including analogs thereof) to polymerize into nucleic acid chains. Generally, but not necessarily, such nucleotide polymerization can occur in a template-dependent manner. Generally, the polymerase includes one or more active sites at which nucleotide binding and / or nucleotide polymerization catalysis can occur. In some embodiments, the polymerase includes other enzymatic activities, such as 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, the polymerase has strand displacement activity. The polymerase may include, but is not limited to, naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, fused or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof (e.g., catalytically active fragments) that retain the ability to catalyze nucleotide polymerization. In some embodiments, the polymerase may be separated from a cell or produced using recombinant DNA technology or chemical synthesis methods. In some embodiments, the polymerase may be expressed in prokaryotes, eukaryotes, viruses or bacteriophage organisms. In some embodiments, the polymerase may be a protein or fragment thereof that is post-translationally modified. The polymerase may be derived from a prokaryotic organism, a eukaryotic organism, a virus or a bacteriophage. The polymerase comprises a DNA-guided DNA polymerase and an RNA-guided DNA polymerase.

[0371] As used herein, the term "fidelity" refers to the accuracy of DNA polymerization by a template-dependent DNA polymerase. The fidelity of a DNA polymerase is usually measured by the error rate (the frequency of incorporation of inaccurate nucleotides (i.e., nucleotides that are not complementary to the template nucleotides)). The accuracy or fidelity of DNA polymerization is maintained by the polymerase activity and 3'-5' exonuclease activity of the DNA polymerase.

[0372] As used herein, the term "binding complex" refers to a complex formed by binding together free nucleotides or nucleotide units of a nucleic acid duplex, a polymerase, and a multivalent molecule, wherein the nucleic acid duplex comprises a nucleic acid template molecule hybridized with a nucleic acid primer. In the binding complex, the free nucleotides or nucleotide units may or may not bind to the 3' end of the nucleic acid primer at a location relative to the complementary nucleotide in the nucleic acid template molecule. A "ternary complex" is an example of a binding complex formed by binding together free nucleotides or nucleotide units of a nucleic acid duplex, a polymerase, and a multivalent molecule, wherein the free nucleotides or nucleotide units bind to the 3' end of the nucleic acid primer (as part of the nucleic acid duplex) at a location relative to the complementary nucleotide in the nucleic acid template molecule.

[0373] The term "residence time" and related terms refer to the length of time that a binding complex remains stable without any component dissociation, wherein the components of the binding complex include nucleic acid templates and nucleic acid primers, polymerases, nucleotide units of multivalent molecules or free (e.g., unconjugated) nucleotides. Nucleotide units or free nucleotides can be complementary or non-complementary to the nucleotide residues in the template molecule. Nucleotide units or free nucleotides can be combined with the 3' end of the nucleic acid primer at a location relative to the complementary nucleotide residues in the nucleic acid template molecule. The residence time indicates the stability of the binding complex and the intensity of the binding interaction. The residence time can be measured by observing the start and / or duration of the binding complex (such as by observing the signal of the labeled component from the binding complex). For example, labeled nucleotides or labeled reagents comprising one or more nucleotides can be present in the binding complex, so that the signal from the label is allowed to be detected during the residence time of the binding complex. An example label is a fluorescent label. The binding complex (e.g., a ternary complex) remains stable before being subjected to the conditions of the dissociation of the interaction between any one of the polymerase, template molecule, primer and / or nucleotide units or nucleotides. For example, the dissociation conditions comprise contacting the bound complex with any one of a detergent, EDTA, and / or water, or any combination thereof.

[0374] The terms "nucleic acid", "polynucleotide" and "oligonucleotide" and other related terms used herein are used interchangeably and refer to polymers of nucleotides and are not limited to any specific length. Nucleic acids include recombinant and chemically synthesized forms. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of DNA or RNA produced using nucleotide analogs (e.g., peptide nucleic acids and non-natural nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acids can be single-stranded or double-stranded. Nucleic acids include polymers of nucleotides, wherein nucleotides include natural or non-natural bases and / or sugars. Nucleic acids include naturally occurring internucleoside bonds, such as phosphodiester bonds. Nucleic acids include non-natural internucleoside bonds, including thiophosphates, sulfur-containing phosphates, or peptide nucleic acid (PNA) bonds. In some embodiments, nucleic acids include a mixture of one type of polynucleotide or two or more different types of polynucleotides.

[0375] The term "primer" and related terms used herein refer to natural or synthetic oligonucleotides that can hybridize with DNA and / or RNA polynucleotide templates to form duplex molecules. Primers can have any length, but generally range from 4 to 50 nucleotides. Typical primers include 5' ends and 3' ends. The 3' end of a primer can include a 3'OH portion that serves as a nucleotide polymerization initiation site in a polymerase-mediated primer extension reaction. Alternatively, the 3' end of a primer can lack a 3'OH portion or can include a terminal 3' blocking group that inhibits nucleotide polymerization in a polymerase-mediated reaction. Any one nucleotide along the length of the primer or more than one nucleotide can be labeled with a detectable reporter gene portion. Primers can be in solution (e.g., soluble primers) or can be fixed to a carrier (e.g., capture primers).

[0376] The terms "template nucleic acid", "template polynucleotide", "target nucleic acid", "target polynucleotide", "template strand" and other variants refer to a nucleic acid strand that serves as a base nucleic acid molecule for generating a complementary nucleic acid strand. The template nucleic acid may be single-stranded or double-stranded, or the template nucleic acid may have a single-stranded or double-stranded portion. The sequence of the template nucleic acid may be partially or completely complementary to the sequence of the complementary strand. The template nucleic acid may be obtained from a naturally occurring source, a recombinant form, or chemically synthesized to include any type of nucleic acid analog. The template nucleic acid may be linear, circular, or in other forms. The template nucleic acid may include an insertion region having an insertion sequence also referred to as a sequence of interest. The template nucleic acid may also include at least one adapter sequence. The template nucleic acid may be a concatemer having two or tandem copies of a sequence of interest and at least one adapter sequence. The insertion region may be isolated in any form, including chromosomes, genomes, organelles (e.g., mitochondria, chloroplasts, or ribosomes), recombinant molecules, cloned, amplified cDNA, RNA (e.g., pre-mRNA or mRNA), oligonucleotides, whole genomic DNA obtained from freshly frozen paraffin-embedded tissue, needle biopsies, cell-free circulating DNA, or any type of nucleic acid library. Insertion regions can be isolated from any source, including from organisms such as prokaryotes, eukaryotes (e.g., humans, plants, and animals), fungi, viruses, cells, tissues, normal or diseased cells or tissues, body fluids, including blood, urine, serum, lymph, tumors, saliva, anal and vaginal secretions, amniotic fluid samples, sweat, semen, environmental samples, culture samples, or synthetic nucleic acid molecules prepared using recombinant molecular biology or chemical synthesis methods. Insertion regions can be isolated from any organ, including the head, neck, brain, breast, ovary, cervix, colon, rectum, endometrium, gallbladder, intestine, bladder, prostate, testis, liver, lung, kidney, esophagus, pancreas, thyroid, pituitary, thymus, skin, heart, larynx, or other organs. Template nucleic acids can be subjected to nucleic acid analysis (including sequencing and composition analysis).

[0377] When used to refer to nucleic acid molecules, the term "hybridize" or "hybridizing" or "hybridization" or other related terms refer to hydrogen bonding between two different nucleic acids to form a duplex nucleic acid. Hybridization also includes hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridizing molecule with a duplex region. Hybridization can include Watson-Crick or Hoogstein binding to form a duplex double-stranded nucleic acid or a double-stranded region within a nucleic acid molecule. Two different regions of a double-stranded nucleic acid or a single nucleic acid can be fully complementary or partially complementary. Complementary nucleic acid chains do not need to hybridize to each other across their entire length. Complementary base pairing can be standard AT or CG base pairing or can be other forms of base pairing interactions. Duplex nucleic acids can include mismatched base-paired nucleotides.

[0378] The term "nucleotide" and related terms refer to molecules comprising an aromatic base, a five-carbon sugar (e.g., ribose or deoxyribose) and at least one phosphate group. Regular or non-regular nucleotides are consistent with the use of the term. In certain embodiments, phosphates comprise monophosphates, diphosphates or triphosphates, or corresponding phosphate analogs. In certain embodiments, nucleotides comprise 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphate groups. The term "nucleoside" refers to a molecule comprising an aromatic base and a sugar.

[0379] Nucleotides (and nucleosides) typically contain heterocyclic bases, including substituted or unsubstituted nitrogen-containing parent heteroaromatic rings (typically present in nucleic acids), including naturally occurring, substituted, modified or engineered variants or analogs thereof. The base of a nucleotide (or nucleoside) is capable of forming Watson-Crick and / or Hoostein hydrogen bonds with an appropriate complementary base. Exemplary bases include, but are not limited to, purines and pyrimidines, such as: 2-aminopurine, 2,6-diaminopurine, adenine (A), ethyleneadenine, N 6 -Δ 2 -Isopentenyl adenine (6iA), N 6 -Δ 2 -Isopentenyl-2-methylthioadenine (2ms6iA), N 6 -methyladenine, guanine (G), isoguanine, N 2 -dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and O 6-methylguanine; 7-deaza-purines, such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G); pyrimidines, such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4-thiothymine (4sT), 5,6-dihydrothymine, O 4 -methylthymine, uracil (U), 4-thiouracil (4sU) and 5,6-dihydrouracil (dihydrouracil; D); indoles such as nitroindole and 4-methylindole; pyrroles such as nitropyrrole; agarosin; inosine; hydroxymethylcytosine; 5-methylcytosine; base (Y); and methylated, glycosylated and acylated base moieties; etc. Additional example bases can be found in Fasman, 1989, "Practical Handbook of Biochemistry and Molecular Biology", pp. 385-394, CRC Press, Boca Raton, Fla.

[0380] Nucleotides (and nucleosides) typically contain sugar moieties such as carbocyclic moieties (Ferraro and Gotor 2000 Chem. Rev. 100:4319-48), acyclic moieties (Martinez et al. 1999 Nucleic Acids Research 27:1271-1274; Martinez et al. 1997 Bioorganic & Medicinal Chemistry Letters 7:3013-3016), and other sugar moieties (Joeng et al. 1993 J. Med. Chem. 36:2627-2638; Kim et al. 1993 J. Med. Chem. 36:30-7; Eschenmosser et al. 1994 J. Med. Chem. 36:31-32; Kim et al. 1994 J. Med. Chem. 36:32-33; Eschenmosser et al. 1994 J. Med. Chem. 36:33-34; Kim et al. 1994 J. Med. Chem. 36:33-33; Eschenmosser ... 1999 Science 284:2118-2124; and U.S. Pat. No. 5,558,991). The sugar moiety includes: ribosyl; 2'-deoxyribosyl; 3'-deoxyribosyl; 2',3'-dideoxyribosyl; 2',3'-didehydrodideoxyribosyl; 2'-alkoxyribosyl; 2'-azidoribosyl; 2'-aminoribosyl; 2'-fluororibosyl; 2'-thiolribosyl; 2'-alkylthioribosyl; 3'-alkoxyribosyl; 3'-azidoribosyl; 3'-aminoribosyl; 3'-fluororibosyl; 3'-thiolribosyl; 3'-alkylthioribosyl carbocyclic; acyclic or other modified sugars.

[0381] In some embodiments, the nucleotide comprises a chain of one, two or three phosphorus atoms, wherein the chain is generally connected to the 5' carbon of the sugar moiety by an ester or phosphoramide bond. In some embodiments, the nucleotide is an analog with a phosphorus chain, wherein the phosphorus atoms are linked together with an intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups (including O, S or BH3). In some embodiments, the chain includes a phosphate group substituted with an analog, including phosphoramide, phosphorothioate, phosphorodithioate and O-methylphosphoramidite groups.

[0382] When used in reference to nucleic acids, the terms "extend," "extending," "extension," and other variants refer to the incorporation of one or more nucleotides into a nucleic acid molecule. Nucleotide incorporation comprises polymerization of one or more nucleotides into the terminal 3'OH end of a nucleic acid chain, resulting in extension of the nucleic acid chain. Nucleotide incorporation can be performed with natural nucleotides and / or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in a template-dependent manner. Any suitable method for extending nucleic acid molecules can be used, including primer extension catalyzed by a DNA polymerase or an RNA polymerase.

[0383] The term "reporter moiety", "reporter moieties" or related terms refers to a compound that produces or causes a detectable signal. The reporter moiety is sometimes referred to as a "label". Any suitable reporter moiety can be used, including luminescence, photoluminescence, electroluminescence, bioluminescence, chemiluminescence, fluorescence, phosphorescence, chromophore, radioisotope, electrochemistry, mass spectrometry, Raman, hapten, affinity tag, atom or enzyme. The reporter moiety produces a detectable signal caused by a chemical or physical change (e.g., heat, light, electricity, pH, salt concentration, enzymatic activity or adjacent event). The adjacent event includes two reporter moieties approaching, associating or binding to each other. It is well known to those skilled in the art that the reporter moiety is selected so that each reporter moiety absorbs excitation radiation and / or emits fluorescence at a wavelength that can be distinguished from other reporter moieties to allow monitoring of the presence of different reporter moieties in the same reaction or in different reactions. Two or more different reporter moieties with spectrally distinct emission curves or with minimal overlapping spectral emission curves can be selected. The reporter moiety can be linked (eg, operably linked) to a nucleotide, nucleoside, nucleic acid, enzyme (eg, polymerase or reverse transcriptase), or carrier (eg, surface).

[0384] The reporter gene portion (or label) comprises a fluorescent marker or fluorophore. Exemplary fluorescent moieties that can serve as fluorescent markers or fluorophores include, but are not limited to, fluorescein and fluorescein derivatives (such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynaphthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetylaminofluorescein, fluorescein maleimide, SAMSA-fluorescein, fluorescein semicarbazide, carbohydrazinomethylthioacetylaminofluorescein), rhodamine and rhodamine derivatives (such as TRITC, TMR, lissamine rhodamine (lissamine rhodamine), Texas Red, Rhodamine B, Rhodamine 6G, Rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lissamine rhodamine B sulfonyl chloride, lissamine rhodamine B sulfonyl hydrazide, Texas Red sulfonyl chloride, Texas Red hydrazide), coumarin and coumarin derivatives (such as AMCA, AMCA-NHS, AMCA-sulfo-NHS, AMCA-HPDP, DCIA, AMCE-hydrazide), BODIPY and derivatives (such as BODIPY FL C3-SE, BODIPY 530 / 550C3, BODIPY 530 / 550C3-SE, BODIPY 530 / 550C3 hydrazide, BODIPY 493 / 503C3 hydrazide, BODIPY FLC3 hydrazide, BODIPY FL IA, BODIPY 530 / 551IA, Br-BODIPY 493 / 503), Cascade Blue and derivatives (such as Cascade Blue acetyl azide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide), Fluorescent Yellow and derivatives (such as Fluorescent Yellow iodoacetamide, Fluorescent Yellow CH), Cyanine and derivatives (such as indolium-based cyanine dyes, benzindolium-based cyanine dyes, pyridinium-based cyanine dyes, thiazolium-based cyanine dyes, quinolinium-based cyanine dyes, imidazolium-based cyanine dyes, Cy3, Cy5), lanthanide chelates and derivatives (such as BCPDA, TBP, TMT, BHHCT, BCOT, europium chelates, terbium chelates, Alexa Fluor dyes, DyLight dyes, Atto dyes, LightCycler Red dyes, CAL Flour dyes), JOE and its derivatives, Oregon Green (Oregon Green dyes, WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, malachite green, stilbene, DEG dyes, NR dyes, near infrared dyes, and other fluorescent moieties known in the art, such as Haugland, Molecular Probes Handbook, 6th ed. (Eugene, Oreg.);A fluorescent moiety as described in Lakowicz, Principles of Fluorescence Spectroscopy, 2nd ed., Plenum Press New York (1999) or Hermanson, Bioconjugate Techniques, 2nd ed., or a derivative thereof;or any combination thereof. Cyanine dyes may exist in sulfonated or non-sulfonated form and consist of two indolenine, benzindolium, pyridinium, thiazolium and / or quinolinium groups separated by a polymethine bridge between the two nitrogen atoms. Commercially available cyanine fluorophores include, for example, Cy3 (which may contain 1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium or 1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium-5-sulfonate), Cy5 (which may include 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indolin-2-ylidene )penta-1,3-dien-1-yl)-3,3-dimethyl-3H-indol-1-ium or 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfoindolyl-2-ylidene)penta-1,3-dien-1-yl)-3,3-dimethyl-3H-indol-1-ium-5-sulfonate) and Cy7 (which may contain 1-(5-carboxypentyl) 1-(5-carboxypentyl)-2-[(1E,3E,5E,7Z)-7-(1-ethyl-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-trien-1-yl]-3H-indolium or 1-(5-carboxypentyl)-2-[(1E,3E,5E,7Z)-7-(1-ethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-trien-1-yl]-3H-indolium-5-sulfonate), where "Cy" stands for 'cyanine' and the first number indicates the number of carbon atoms between the two indolenine groups. Cy2 is an oxazole derivative rather than an indolenine, and the benzo-derived Cy3.5, Cy5.5 and Cy7.5 are exceptions to this rule. ;

[0385] In some embodiments, the reporter moiety may be a FRET pair, so that multiple classifications may be performed with a single excitation and imaging step. As used herein, FRET may comprise excitation exchange (Forster) transfer or electron exchange (Dexter) transfer.

[0386] The terms "linked", "engaged", "attached" and variations thereof include any type of fusion, binding, adhesion or association between any combination of compounds or molecules that are sufficiently stable to withstand use in a particular procedure. The procedure may include, but is not limited to: transient binding of nucleotides; nucleotide incorporation; deblocking; washing; removal; flow; detection; imaging and / or identification. Such bonds may include, for example, covalent bonding, ionic bonding, hydrogen bonding, dipole-dipole bonding, hydrophilic bonding, hydrophobic bonding or affinity bonding, bonds or associations involving van der Waals forces, mechanical bonding, and the like. In some embodiments, such bonds occur within a molecule, such as connecting the ends of a single-stranded or double-stranded linear nucleic acid molecule together to form a circular molecule. In some embodiments, such bonds may occur between combinations of different molecules or between a molecule and a non-molecule, including, but not limited to, bonds between a nucleic acid molecule and a solid surface; bonds between a protein and a detectable reporter gene portion; bonds between a nucleotide and a detectable reporter gene portion; and the like. Some examples of bonds can be found, for example, in Hermanson, G., "Bioconjugation Technology", 2nd edition (2008); Aslam, M., Dent, A., "Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences", London: Macmillan (1998); Aslam, M., Dent, A., "Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences", London: Macmillan (1998).

[0387] As used herein, the terms "operably connected" and "operably joined" or related terms refer to the juxtaposition of components. The juxtaposed components can be covalently linked together. For example, two nucleic acid components can be enzymatically linked together, wherein the bond joining the two components together comprises a phosphodiester bond. A first nucleic acid component and a second nucleic acid component can be linked together, wherein the first nucleic acid component can confer a function to the second nucleic acid component. For example, the bond between the primer binding sequence and the sequence of interest forms a nucleic acid library molecule having a portion that can bind to a primer. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or a nucleic acid sequence of interest) can be linked to a vector, wherein the bond allows the transgenic sequence contained in the vector to be expressed or function. In some embodiments, the transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects transgenic expression. In some embodiments, the vector comprises at least one host cell regulatory sequence, comprising a promoter sequence, an enhancer, a transcription and / or translation initiation sequence, a transcription and / or translation termination sequence, a polypeptide secretion signal sequence, and the like. In some embodiments, the host cell regulatory sequence controls the expression of the level, timing, and / or position of the transgene.

[0388] The term "adapter" and related terms refer to an oligonucleotide that can be operably connected (attached) to a target polynucleotide, wherein the adaptor confers function to the co-engaged adaptor-target molecule. The adaptor comprises DNA, RNA, chimeric DNA / RNA or its analogs. The adaptor may include at least one ribonucleoside residue. The adaptor may be single-stranded, double-stranded or have a single-stranded and / or double-stranded portion. The adaptor may be configured into a linear form, a stem-loop form, a hairpin form or a Y-shaped form. The adaptor may be of any length, including 4-100 nucleotides or longer. The adaptor may have a blunt end, an overhang end or a combination of the two. The overhang end includes a 5' overhang end and a 3' overhang end. The 5' end of a single-stranded adaptor or one chain of a double-stranded adaptor may have a 5' phosphate group or lack a 5' phosphate group. The adaptor may include a 5' tail (e.g., a tailed adaptor) that is not hybridized with a target polynucleotide, or the adaptor may be tailless. The adapter may include a sequence complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., a soluble or immobilized capture primer). The adapter may include a random sequence or a degenerate sequence. The adapter may include at least one inosine residue. The adapter may include at least one phosphorothioate, phosphorothiol, and / or phosphoramide bond. The adapter may include a barcode sequence that can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. The adapter may include a unique identifier sequence (e.g., a unique molecular index, UMI; or a unique molecular tag) that can be used to uniquely identify the nucleic acid molecule to which the adapter is attached. In some embodiments, the unique identifier sequence can be used to increase error correction and accuracy, reduce false positive variant call rates, and / or increase the sensitivity of variant detection. The adapter may include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from the group consisting of: type I, type II, type III, type IV, type Hs, or type IIB.

[0389] The terms "universal sequence," "universal adapter sequence," and related terms refer to a sequence in a nucleic acid molecule that is shared between two or more polynucleotide molecules. For example, an adapter having the same universal sequence can be joined to multiple polynucleotides such that the population of co-joined molecules carries the same universal adapter sequence. Examples of universal adapter sequences include amplification primer sequences, sequencing primer sequences, or capture primer sequences (e.g., soluble or carrier-immobilized capture primers).

[0390] In some embodiments, the carrier is solid, semi-solid, or a combination of the two. In some embodiments, the carrier is porous, semi-porous, non-porous, or any combination of porosity. In some embodiments, the carrier can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the carrier can be cylindrical, such as comprising a capillary or the inner surface of a capillary.

[0391] In some embodiments, the surface of the carrier can be substantially smooth. In some embodiments, the carrier can have a regular or irregular texture, including bumps, etchings, holes, three-dimensional scaffolds, or any combination thereof.

[0392] In some embodiments, the support comprises beads having any shape, including spheres, hemispheres, cylinders, barrels, rings, disks, rods, cones, triangles, cubes, polygons, tubes, or wires.

[0393] The support may be made of any material including, but not limited to, glass, fused silica, silicon, polymers (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethyl methacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymer (COP), cyclic olefin copolymer (COC), polyethylene terephthalate (PET)), or any combination thereof. Various compositions of both glass and plastic substrates are contemplated.

[0394] In certain embodiments, the surface of the carrier is coated with one or more compounds to produce a passivation layer on the carrier. In certain embodiments, the carrier comprises a low non-specific binding surface that can improve nucleic acid hybridization and amplification performance on the carrier. Generally speaking, the carrier can include one or more layers (e.g., silane layers, polymer films) in a covalently or non-covalently attached low binding chemical modification layer, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid template molecules to the carrier.

[0395] In some embodiments, the degree of hydrophilicity (or "wetting" with aqueous solutions) of the surface coating can be evaluated, for example, by measuring the water contact angle, wherein a small drop of water is placed on the surface and its contact angle with the surface is measured using, for example, an optical tensiometer. In some embodiments, a static contact angle can be determined. In some embodiments, an advancing or receding contact angle can be determined. In some embodiments, the water contact angle for a hydrophilic low binding carrier surface disclosed herein can be in the range of about 0 degrees to about 30 degrees. In some embodiments, the water contact angle for a hydrophilic low binding carrier surface disclosed herein can be no more than 50 degrees, 40 degrees, 30 degrees, 25 degrees, 20 degrees, 18 degrees, 16 degrees, 14 degrees, 12 degrees, 10 degrees, 8 degrees, 6 degrees, 4 degrees, 2 degrees or 1 degree. In many cases, the contact angle does not exceed 40 degrees. Those skilled in the art will recognize that a given hydrophilic low binding carrier surface of the present disclosure can exhibit a water contact angle with a value anywhere within this range.

[0396] Embodiments of the present disclosure provide multiple (e.g., two or more) nucleic acid templates fixed to a carrier. In some embodiments, the multiple nucleic acid templates fixed have the same sequence or have different sequences. In some embodiments, individual nucleic acid template molecules in multiple nucleic acid templates are fixed to different sites on the carrier. In some embodiments, two or more individual nucleic acid template molecules in multiple nucleic acid templates are fixed to sites on the carrier. In some embodiments, the carrier comprises multiple sites arranged in an array. The term "array" refers to a carrier comprising multiple sites located at predetermined positions on the carrier to form an array of sites. The sites may be discrete and separated by gaps. In some embodiments, the predetermined sites on the carrier may be arranged in rows or columns in one dimension, or in rows and columns in two dimensions. In some embodiments, multiple predetermined sites are arranged in an organized manner on the carrier. In some embodiments, multiple predetermined sites are arranged in any organized pattern, including straight lines, hexagonal patterns, grid patterns, patterns with reflection symmetry, patterns with rotational symmetry, and the like. The spacing between different site pairs may be the same or may be different. In some embodiments, the carrier may have a spacing of about 10 2 -10 15 Sites / mm 2 or higher surface density to immobilize nucleic acid template molecules at multiple sites to form a nucleic acid template array. In some embodiments, the carrier comprises at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 109 sites, at least 10 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, at least 10 15 In some embodiments, the plurality of predetermined sites (e.g., 10 2 -10 15 In some embodiments, the nucleic acid template is fixed at a plurality of predetermined sites by hybridizing with an immobilized surface capture primer, or the nucleic acid template is covalently linked to the surface capture primer. In some embodiments, the nucleic acid template is fixed at a plurality of predetermined sites, for example, at 10 2 -10 15 In some embodiments, the nucleic acid template fixed at multiple sites on the carrier comprises a linear nucleic acid template molecule or a circular nucleic acid template molecule or a mixture of both linear and circular molecules. In some embodiments, the fixed nucleic acid template is amplified in a clonal manner to produce a fixed nucleic acid colony at multiple predetermined sites. In some embodiments, a single fixed nucleic acid template molecule comprises a copy of the target sequence of interest, or comprises a concatemer having two or more tandem copies of the target sequence of interest.

[0397] In some embodiments, a vector comprising a plurality of sites located at random positions on the vector is referred to herein as a vector having randomly positioned sites thereon. The positions of the randomly positioned sites on the vector are not predetermined. The plurality of randomly positioned sites are arranged in an unordered and / or unpredictable manner on the vector. In some embodiments, the vector comprises at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 10 9 sites, at least 10 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, at least 10 15In some embodiments, the plurality of randomly positioned sites (e.g., 10 2 -10 15 In some embodiments, the nucleic acid template is fixed at a plurality of randomly located sites by hybridization with an immobilized surface capture primer, or the nucleic acid template is covalently linked to the surface capture primer. In some embodiments, the nucleic acid template is fixed at a plurality of randomly located sites, for example, fixed at 10 2 -10 15 In some embodiments, the nucleic acid template fixed at multiple sites on the carrier comprises a linear nucleic acid template molecule or a circular nucleic acid template molecule or a mixture of both linear and circular molecules. In some embodiments, the fixed nucleic acid template is amplified in a clonal manner to produce a fixed nucleic acid colony at multiple randomly positioned sites. In some embodiments, a single fixed nucleic acid template molecule comprises a copy of the target sequence of interest, or comprises a concatemer having two or more tandem copies of the target sequence of interest.

[0398] In some embodiments, for nucleic acid template molecules fixed to predetermined or random sites on a carrier, multiple fixed nucleic acid template molecules on the carrier are fluidically connected to each other to allow reagent solutions (e.g., enzymes including polymerases, multivalent molecules, nucleotides, divalent cations and / or buffers, etc.) to flow onto the carrier, so that multiple fixed nucleic acid template molecules on the carrier can react with reagents in a large-scale parallel manner. In some embodiments, the fluid connection of multiple fixed nucleic acid template molecules can be used to perform nucleotide binding assays and / or nucleotide polymerization reactions (e.g., primer extension or sequencing) on ​​multiple fixed nucleic acid template molecules, and for detection and imaging for large-scale parallel sequencing. In some embodiments, the term "fixed" and related terms refer to nucleic acid molecules or enzymes (e.g., polymerases) connected to a carrier at a predetermined or random position, wherein the nucleic acid molecules or enzymes are directly connected to the carrier by covalent bonds or non-covalent interactions, or the nucleic acid molecules or enzymes are connected to a coating on the carrier.

[0399] When used to refer to a low binding surface coating, one or more layers of the multilayer surface coating may comprise a branched polymer or may be linear. Examples of suitable branched polymers include, but are not limited to, branched PEG, branched poly(vinyl alcohol) (branched PVA), branched poly(vinyl pyridine), branched poly(vinyl pyrrolidone) (branched PVP), branched), poly(acrylic acid) (branched PAA), branched polyacrylamide, branched poly(N-isopropylacrylamide) (branched PNIPAM), branched poly(methyl methacrylate) (branched PMA), branched poly(2-hydroxyethyl methacrylate) (branched PHEMA), branched poly(oligo(ethylene glycol) methyl ether methacrylate) (branched POEGMA), branched polyglutamic acid (branched PGA), branched polylysine, branched polyglucosides, and dextran.

[0400] In some embodiments, the branched polymer used to create one or more layers of any of the multi-layer surfaces disclosed herein can contain at least 4 branches, at least 5 branches, at least 6 branches, at least 7 branches, at least 8 branches, at least 9 branches, at least 10 branches, at least 12 branches, at least 14 branches, at least 16 branches, at least 18 branches, at least 20 branches, at least 22 branches, at least 24 branches, at least 26 branches, at least 28 branches, at least 30 branches, at least 32 branches, at least 34 branches, at least 36 branches, at least 38 branches, or at least 40 branches.

[0401] The molecular weight of the linear, branched or multi-branched polymer used to create one or more layers of any of the multi-layer surfaces disclosed herein can be at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, at least 5,000, at least 10,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 35,000, at least 40,000, at least 45,000, or at least 50,000 Daltons.

[0402] In some embodiments, for example, where at least one layer of the multilayer surface comprises a branched polymer, the number of covalent bonds between branched polymer molecules of the layer being deposited and molecules of the previous layer can range from about one covalent bond per molecule to about 32 covalent bonds per molecule. In some embodiments, the number of covalent bonds between branched polymer molecules of the new layer and molecules of the previous layer can be at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 22, at least 24, at least 26, at least 28, at least 30, or at least 32 covalent bonds per molecule.

[0403] Any reactive functional groups remaining after the material layer is coupled to the surface can optionally be blocked by coupling a small inert molecule using a high yield coupling chemistry. For example, where an amine coupling chemistry is used to connect a new material layer to a previous material layer, any residual amine groups can then be acetylated or inactivated by coupling with a small amino acid such as glycine.

[0404] The number of layers of low non-specific binding materials (e.g., hydrophilic polymer materials) deposited on the surface can be in the range of 1 to about 10. In some embodiments, the number of layers is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10. In some embodiments, the number of layers can be at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2, or at most 1. Any of the lower and upper limits described in this paragraph can be combined to form a range included in the present disclosure, for example, in some embodiments, the number of layers can be in the range of about 2 to about 4. In some embodiments, all layers can comprise the same material. In some embodiments, each layer can comprise different materials. In some embodiments, multiple layers can comprise multiple materials. In some embodiments, at least one layer can comprise a branched polymer. In some embodiments, all layers can comprise a branched polymer.

[0405] In some cases, one or more layers of low non-specific binding material can be deposited on and / or conjugated to the substrate surface using a polar protic solvent, a polar or polar aprotic solvent, a non-polar solvent, or any combination thereof. In some embodiments, the solvent used for layer deposition and / or conjugation can include an alcohol (e.g., methanol, ethanol, propanol, etc.), another organic solvent (e.g., acetonitrile, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), etc.), water, an aqueous buffer solution (e.g., phosphate buffer, phosphate buffered saline, 3-(N-morpholino) propanesulfonic acid (MOPS), etc.), or any combination thereof. In some embodiments, the organic component of the solvent mixture used can account for at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% of the total amount, wherein the balance is made up of water or aqueous buffer solution. In some embodiments, the aqueous component of the solvent mixture used can account for at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% of the total amount, wherein the balance is made up of organic solvent. The pH of the solvent mixture used can be less than 6, about 6, 6.5, 7, 7.5, 8, 8.5, 9 or greater than pH 9.

[0406] The term "branched polymer" and related terms refer to polymers with multiple functional groups that contribute to the conjugation of bioactive molecules (such as nucleotides), and the functional groups can be on the side chains of the polymer or directly connected to the central core or central backbone of the polymer. Branched polymers can have a linear backbone, wherein one or more functional groups are separated from the backbone to be conjugated. Branched polymers can also be polymers with one or more side chains, wherein the side chains have sites suitable for conjugation. Examples of functional groups include but are not limited to hydroxyl, ester, amine, carbonate, acetal, aldehyde, aldehyde hydrate, alkenyl, acrylate, methacrylate, acrylamide, active sulfone, hydrazide, thiol, alkanoic acid, acyl halide, isocyanate, isothiocyanate, maleimide, vinyl sulfone, dithiopyridine, vinylpyridine, iodoacetamide, epoxide, glyoxal, diketone, mesylate, tosylate and tresylate.

[0407] As used herein, the term "clonally amplified" and variants thereof refer to nucleic acid template molecules that have been subjected to one or more amplification reactions in solution or on a carrier. In the case of amplifying template molecules in solution, the resulting amplicons are distributed on the carrier. Prior to amplification, the template molecule comprises a sequence of interest and at least one universal adapter sequence. In some embodiments, clonal amplification comprises the use of polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification (RCA), circle-to-circle amplification, helicase-dependent amplification, recombinase-dependent amplification, single-stranded binding (SSB) protein-dependent amplification, or any combination thereof.

[0408] As used herein, the term "sequencing" and its variants include obtaining sequence information from a nucleic acid chain by determining the identity of at least some nucleotides (including its core base components) within a nucleic acid template molecule. Although in some embodiments, "sequencing" of a given region of a nucleic acid molecule includes identifying each nucleotide in the sequenced region, in some embodiments, "sequencing" includes only determining the identity of some nucleotides in the nucleotides in the region, while still not determining or erroneously determining the method of the identity of some nucleotides. Any suitable sequencing method can be used. In an exemplary embodiment, sequencing may include a label-free or ion-based sequencing method. In some embodiments, sequencing may include labeled or dye-based nucleotide or fluorescence-based nucleotide sequencing methods. In some embodiments, sequencing may include sequencing or bridge sequencing methods based on communities. In some embodiments, sequencing includes a massively parallel sequencing platform using sequencing while synthesis, sequencing while hybridization, or sequencing while combination procedures. Examples of massively parallel sequencing-by-synthesis procedures include colony sequencing, pyrosequencing (e.g., from 454 Life Sciences; U.S. Pat. Nos. 7,211,390, 7,244,559, and 7,264,929), chain terminator sequencing (e.g., from Illumina; U.S. Pat. No. 7,566,537; Bentley 2006 Current Opinion Genetics and Development 16:545-552; and Bentley et al., 2008 Nature 456:53-59), ion-sensitive sequencing (e.g., from Ion Torrent), probe-anchor ligation sequencing (e.g., Complete Genomics), DNA nanoball sequencing, nanopore DNA sequencing. Examples of single-molecule sequencing include Heliscope single-molecule sequencing and single-molecule real-time (SMRT) sequencing from Pacific Biosciences (Levene et al., 2003 Science 299(5607):682-686; Eid et al., 2009 Science 323(5910):133-138; U.S. Patents No. 7,170,050; No. 7,302,146; and No. 7,405,281). Examples of sequencing by hybridization include SOLiD sequencing (e.g., from Life Technologies; WO2006 / 084132). Examples of sequencing by binding include Omniome sequencing (e.g., U.S. Patent No. 10,246,744).

[0409] It should be understood that the detailed description section, rather than any other section, is intended to be used to interpret the claims. The other sections may set forth one or more example embodiments contemplated by the inventors but not all example embodiments, and therefore, are not intended to limit the present disclosure or the appended claims in any way.

[0410] Although the present disclosure describes example embodiments of example fields and applications, it should be understood that the present disclosure is not limited thereto. Other embodiments and modifications thereto are possible and within the scope and spirit of the present disclosure. For example, and without limiting the generality of this paragraph, the embodiments are not limited to the software, hardware, firmware, and / or entities shown in the figures and / or described herein. Further, the embodiments (whether or not explicitly described herein) have significant utility for fields and applications beyond the examples described herein.

[0411] Embodiments have been described herein with the aid of functional building blocks that illustrate implementations of specified functions and their relationships. For ease of description, the boundaries of these functional building blocks have been arbitrarily defined herein. Alternative boundaries may be defined as long as the specified functions and their relationships (or their equivalents) are properly performed. Likewise, alternative embodiments may perform functional blocks, steps, operations, methods, etc., in different orders than those described herein.

[0412] References herein to "one embodiment," "an embodiment," "example embodiment," "some embodiments," or similar phrases indicate that the described embodiments may include a particular feature, structure, or characteristic, but not every embodiment necessarily includes the particular feature, structure, or characteristic. Furthermore, such phrases do not necessarily refer to the same embodiment. Furthermore, when a particular feature, structure, or characteristic is described as being associated with an embodiment, it would be within the knowledge of those skilled in the relevant art to incorporate such feature, structure, or characteristic into other embodiments, whether or not explicitly mentioned or described herein.

[0413] Additionally, the expressions "coupled" and "connected" and their derivatives may be used to describe some embodiments. These terms are not necessarily intended to be synonymous with each other. For example, the terms "connected" and / or "coupled" may be used to describe some embodiments to indicate that two or more elements are in direct physical or electrical contact with each other. However, the term "coupled" may also mean that two or more elements are not in direct contact with each other, but still cooperate or interact with each other.

[0414] Although preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. The breadth and scope of the present disclosure should not be limited by any one of the exemplary embodiments described above. Without departing from the present invention, those skilled in the art will now appreciate that many variations, changes and substitutions are possible. It should be understood that each alternative of the embodiments of the present invention described herein can be used to practice the present invention. The appended claims are intended to define the scope of the present invention, and thus cover methods and structures within the scope of these claims and their equivalents.

Claims

1. A computer-implemented method for adaptor trimming in sequencing data analysis, the computer-implemented method comprising: One or more of the following is selected, by the processor and based on the plurality of match scores: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the tail of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the tail of the second sequencing read at one or more fourth locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; generating, by the processor, a first consensus location using the first alignment and the third alignment and generating a second consensus location using the second alignment and the fourth alignment; as well as A trim position is determined, by the processor, based on the first consensus position, the second consensus position, a first consensus match score, and a second consensus match score.

2. The computer-implemented method of any preceding claim, further comprising: A first sequencing read having a first adapter and a second sequencing read having a second adapter are obtained by a processor and from a sequencer.

3. A computer-implemented method according to any of the preceding claims, wherein each of the first sequencing read, the second sequencing read, the head of the first sequencing read, the head of the second sequencing read, the tail of the first sequencing read, the tail of the second sequencing read, the first adapter and the second adapter comprises a base sequence.

4. The computer-implemented method of any one of the preceding claims, wherein the first sequencing read comprises a first insert.

5. The computer-implemented method of any one of the preceding claims, wherein the second sequencing read comprises a second insert. 6 . The computer-implemented method of claim 1 , wherein the tail and the head of the first sequencing read are included in a first insert of the first sequencing read.

7. The computer-implemented method of any one of the preceding claims, wherein the tail and the head of the second sequence read are included in a second insert of the second sequence read.

8. The computer-implemented method of any one of the preceding claims, wherein (a) aligning the tail of the first sequencing read with the head of the second sequencing read at the one or more first locations comprises: (1) a reverse complement of the head of the second sequencing read is aligned with (2) the tail of the first sequencing read at the one or more first locations by shifting the head of the second sequencing read by a certain number of bases relative to the tail of the first sequencing read.

9. The computer-implemented method of any preceding claim, wherein (a) aligning the tail of the first sequencing read with the head of the second sequencing read at one or more first locations comprises: (1) a reverse complement of the tail of the first sequencing read is aligned with (2) the head of the second sequencing read at the one or more first locations by shifting the tail of the first sequencing read by a certain number of bases relative to the head of the second sequencing read.

10. The computer-implemented method of any one of the preceding claims, wherein (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations comprises: (1) aligning a reverse complement of the head of the first sequencing read with the tail of the second sequencing read at the one or more second locations by shifting the head of the first sequencing read by a certain number of bases relative to the tail of the second sequencing read.

11. The computer-implemented method of any one of the preceding claims, wherein (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations comprises: Aligning (1) the reverse complement of the tail of the second sequencing read with (1) the head of the first sequencing read at the one or more second locations by shifting the tail of the second sequencing read by a certain number of bases relative to the head of the first sequencing read.

12. The computer-implemented method of any preceding claim, further comprising: Multiple alignments are generated by the processor by: (a) aligning the tail of the first sequencing read with the head of the second sequencing read at the one or more first locations; (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations; (c) aligning a first adaptor to the tail of the first sequencing read at the one or more third locations; (d) aligning a second adaptor to the tail of the second sequencing read at the one or more fourth locations; or a combination thereof.

13. The computer-implemented method of any preceding claim, further comprising: The plurality of match scores is determined by the processor, wherein each match score in the plurality of match scores corresponds to an alignment corresponding to one of the one or more first locations, the one or more second locations, the one or more third locations, and the one or more fourth locations.

14. The computer-implemented method of any one of the preceding claims, wherein the first number of matched bases and the second total number of bases correspond to one of the one or more first locations, the one or more second locations, the one or more third locations, and the one or more fourth locations.

15. The computer-implemented method of any preceding claim, wherein generating the first consensus position using the first alignment and the third alignment and generating the second consensus position using the second alignment and the fourth alignment comprises: generating a first adaptor mapping based on the first alignment; generating a second adaptor mapping based on the third alignment; In response to determining that the first adaptor location is consistent with the second adaptor location, the first consensus location is determined as the first adaptor location.

16. The computer-implemented method of any preceding claim, wherein generating the first consensus position using the first alignment and the third alignment and generating the second consensus position using the second alignment and the fourth alignment comprises: generating a first adaptor mapping based on the first alignment; generating a second adaptor mapping based on the third alignment; In response to determining that the first adaptor location is inconsistent with the second adaptor location, the first consensus location is determined to be the first adaptor location or the second adaptor location.

17. The computer-implemented method of any one of the preceding claims, wherein generating the first consensus position using the first alignment and the third alignment and generating the second consensus position using the second alignment and the fourth alignment comprises: generating a third adaptor mapping based on the second alignment; generating a fourth adaptor mapping based on the fourth alignment; In response to determining that the third adaptor location is consistent with the fourth adaptor location, the second consensus location is determined as the second adaptor location.

18. The computer-implemented method of any preceding claim, wherein generating the first consensus position using the first alignment and the third alignment and generating the second consensus position using the second alignment and the fourth alignment comprises: generating a third adaptor mapping based on the second alignment; generating a fourth adaptor mapping based on the fourth alignment; In response to determining that the third adaptor location is inconsistent with the fourth adaptor location, the second consensus location is determined to be the second adaptor location or the fourth adaptor location.

19. The computer-implemented method of any preceding claim, further comprising: A first consensus match score is determined, by the processor, based on the first alignment and the third alignment.

20. The computer-implemented method of any preceding claim, further comprising: In response to determining that the first and third alignments agree on adaptor positioning, a first consensus match score is determined based on a first sum of matched bases and a second total sum of bases from the first and third alignments.

21. The computer-implemented method of any preceding claim, further comprising: In response to determining that the first alignment and the third alignment do not agree in the adaptor positioning: determining a first candidate match score based on a first adapter location obtained from the first alignment and a first sum of matched bases and a second total sum of bases from aligning the first adapter to the tail of the first sequencing read at the first adapter location; determining a second candidate match score based on a second adapter location obtained from the third alignment and the first sum of matched bases and the second total sum of bases from aligning the tail of the first sequencing read to the head of the second sequencing read at the second adapter location; as well as A score is selected from the first candidate matching score and the second candidate matching score as the first consensus score.

22. The computer-implemented method of any preceding claim, wherein the selected score is a higher score of the first candidate match score and the second candidate match score.

23. The computer-implemented method of any preceding claim, further comprising: A second consensus match score is determined, by the processor, based on the second alignment and the fourth alignment.

24. The computer-implemented method of any preceding claim, further comprising: In response to determining that the second and fourth alignments agree on adaptor positioning, a second consensus match score is determined based on a third sum of matched bases and a fourth total sum of bases from the second and fourth alignments.

25. The computer-implemented method of any preceding claim, further comprising: In response to determining that the second alignment and the fourth alignment do not agree in the adaptor positioning: determining a third candidate match score based on a third sum of matched bases from a third adapter location obtained from the second alignment and a fourth total sum of bases from aligning the second adapter to the tail of the second sequencing read at the third adapter location; determining a fourth candidate match score based on a fourth adapter location obtained from the fourth alignment and the third matched base sum and a fourth total base sum from aligning the tail of the second sequencing read to the head of the first sequencing read at the fourth adapter location; and A score is selected from the third candidate matching score and the fourth candidate matching score as the second consensus score.

26. The computer-implemented method of any preceding claim, wherein the selected score is a higher score of the third candidate match score and the fourth candidate match score.

27. The computer-implemented method of any preceding claim, wherein determining the trim position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score comprises: selecting a higher score from the first consensus match score and the second consensus match score; determining that the selected higher score is above a predetermined threshold; and The pruning position is determined based on the selected higher score.

28. The computer-implemented method of any preceding claim, wherein determining the trim position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score comprises: selecting a higher score from the first consensus match score and the second consensus match score; determining that the selected higher score is below a predetermined threshold; and A determination is made not to perform trimming on the first sequenced read or the second sequenced read.

29. The computer-implemented method of any preceding claim, wherein determining the trim position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score comprises: selecting a higher score from the first consensus match score and the second consensus match score; determining that the selected higher score is above a predetermined threshold; and The trimmed position is determined as the first consensus position or the second consensus position, wherein the trimmed position corresponds to the selected higher score.

30. The computer-implemented method of any preceding claim, wherein each match score in the plurality of match scores comprises a probability that the first number of matched bases does not occur by chance.

31. The computer-implemented method of any preceding claim, wherein each match score in the plurality of match scores comprises a probability that the first number of matched bases in the second total number of bases does not occur randomly.

32. The computer-implemented method of any one of the preceding claims, wherein each match score in the plurality of match scores comprises a probability that is a constant minus a cumulative distribution function (CDF) of a variable m having a binomial distribution, and wherein the binomial distribution is determined by the total number of bases n and the probability p of randomly matching a base in the alignment.

33. The computer-implemented method of any preceding claim, wherein the constant is 1 and each of the plurality of match scores is greater than approximately 0.99000, approximately 0.99900, approximately 0.99990, or approximately 0.99999.

34. The computer-implemented method of any preceding claim, wherein the constant is 1 and each of the plurality of match scores is greater than 0.99000, 0.99900, 0.99990, or 0.99999.

35. The computer-implemented method of any one of the preceding claims, wherein each match score in the plurality of match scores is calculated as CP(m>=M), where C is a constant, M is a first number of matching bases, m is a variable with a binomial distribution, i.e., binomial(n,p), n is a second total number of bases, and p is the probability of randomly matching a base to a certain number of different bases.

36. The computer-implemented method of any one of the preceding claims, wherein when the number of different bases is 4, p is 0.

25.

37. The computer-implemented method of any preceding claim, wherein C is 1.

38. The computer-implemented method of any preceding claim, wherein n ranges from 1 base to the number of bases in the first adaptor or the second adaptor.

39. The computer-implemented method of any preceding claim, wherein n is in the range of 1 to about 64.

40. The computer-implemented method of any preceding claim, wherein n is in the range of 1 to about 32.

41. The computer-implemented method of any preceding claim, wherein M is in the range of 0 to about 64.

42. The computer-implemented method of any preceding claim, wherein M is in the range of 0 to about 32.

43. The computer-implemented method of any one of the preceding claims, wherein the first adaptor or the second adaptor has approximately 32 bases.

44. The computer-implemented method of any one of the preceding claims, wherein the first adaptor or the second adaptor has 32, 33, or 34 bases.

45. The computer-implemented method of any one of the preceding claims, wherein the first adaptor or the second adaptor has about 4 bases to about 64 bases.

46. ​​The computer-implemented method of any one of the preceding claims, wherein the first adaptor or the second adaptor has about 8 bases to about 32 bases.

47. The computer-implemented method of any one of the preceding claims, wherein the head of the first sequencing read or the second sequencing read is at least about 32 bases or about 16 bases.

48. The computer-implemented method of any one of the preceding claims, wherein the tail of the first sequencing read or the second sequencing read has a length of less than about 80 bases and greater than about 16 bases.

49. The computer-implemented method of any one of the preceding claims, wherein the length of the head of the first sequencing read or the second sequencing read is less than about 80 bases and greater than about 16 bases.

50. The computer-implemented method of any one of the preceding claims, wherein the length of the tail of the first sequencing read is different from the length of the head of the second sequencing read.

51. The computer-implemented method of any one of the preceding claims, wherein the length of the tail of the first sequencing read is the same as the length of the head of the second sequencing read.

52. The computer-implemented method of any one of the preceding claims, wherein the length of the head of the first sequencing read is different from the length of the tail of the second sequencing read.

53. The computer-implemented method of any one of the preceding claims, wherein the length of the head of the first sequencing read is the same as the length of the tail of the second sequencing read.

54. The computer-implemented method of any one of the preceding claims, wherein the number of bases of the first insert of the first sequencing read or the second insert of the second sequencing read is in the range of about 16 bases to about 400 bases.

55. The computer-implemented method of any one of the preceding claims, wherein the number of bases of the first insert of the first sequencing read or the second insert of the second sequencing read is in the range of about 16 bases to about 150 bases.

56. The computer-implemented method of any one of the preceding claims, wherein the first adaptor is ligated to the tail of the first sequencing read.

57. The computer-implemented method of any one of the preceding claims, wherein the second adaptor is ligated to the tail of the second sequencing read.

58. The computer-implemented method of any one of the preceding claims, wherein the first adaptor is a 3' adaptor of the first sequencing read.

59. The computer-implemented method of any one of the preceding claims, wherein the second adaptor is a 5' adaptor of the second sequencing read.

60. The computer-implemented method of any preceding claim, wherein one or more of the following: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adaptor comprises: insertion of one or more bases; a deletion of one or more bases; or both.

61. The computer-implemented method of any preceding claim, wherein each base in one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adaptor is represented by an integer.

62. The computer-implemented method of any preceding claim, wherein each base in one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adapter is represented as a bitwise integer.

63. The computer-implemented method of any preceding claim, wherein each base of one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second linker is represented as a 4-bit binary number.

64. The computer-implemented method of any preceding claim, wherein one or more of the following: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the tail of the first sequencing read at one or more third locations; as well as A fourth alignment, the fourth alignment resulting from (d) aligning the second adaptor to the tail of the second sequencing read at one or more fourth locations, is determined based on a bitwise operation.

65. The computer-implemented method of any preceding claim, wherein the processor comprises: one or more processing units; one or more integrated circuits; or Its combination.

66. The computer-implemented method of any preceding claim, wherein the processor comprises: one or more central processing units (CPUs); one or more field programmable gate arrays (FPGAs); or a combination thereof.

67. The computer-implemented method of any preceding claim, further comprising: The first sequenced reads, the second sequenced reads, or both are generated by the processor by performing one or more preliminary analysis steps on the flow cell image.

68. The computer-implemented method of any preceding claim, wherein the one or more preliminary analysis steps performed on the flow cell image comprise: background subtraction; Image sharpening; Intensity offset adjustment; Color correction; Intensity normalization; Phasing and prephasing correction; Image registration; Intensity normalization Quality score estimates; or Its combination.

69. The computer-implemented method of any preceding claim, further comprising: trimming the first sequencing read, the second sequencing read, or both at the trimming location; converting, by the processor, the pruned first sequencing reads, the pruned second sequencing reads, or both, to a predetermined format; recording, by the processor, the pruned first sequencing reads, the pruned second sequencing reads, or both in the predetermined format; and 70. The computer-implemented method of any preceding claim, further comprising: The pruned first sequencing reads, the pruned second sequencing reads, or both in the predetermined format are transmitted by the processor to a processing unit.

71. The computer-implemented method of any preceding claim, wherein the processing unit is a central processing unit (CPU).

72. A computer-implemented method according to any of the preceding claims, wherein the processing unit is configured to generate sequencing results for display to a user based on the trimmed first sequencing reads, the trimmed second sequencing reads, or both in the predetermined format.

73. The computer-implemented method of any preceding claim, wherein one or more of the following are selected: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations, comprising: choose a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as A fourth alignment results from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations.

74. The computer-implemented method of any preceding claim, wherein one or more of the following are selected: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations, comprising: Select two or three of the following: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as A fourth alignment results from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations.

75. The computer-implemented method of any one of the preceding claims, wherein the second sequence read is the reverse complement of the first sequence read.

76. A computer-implemented system for adapter trimming for sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising: Select one or more of the following based on multiple match scores: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the tail of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the tail of the second sequencing read at one or more fourth locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; generating a first consensus location using the first alignment and the third alignment and generating a second consensus location using the second alignment and the fourth alignment; as well as A trim position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score.

77. A computer-implemented system for adapter trimming for sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising any of any of claims 1 to 75.

78. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more hardware processors to perform operations for adapter trimming in sequencing data analysis, the operations comprising: Select one or more of the following based on multiple match scores: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the tail of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the tail of the second sequencing read at one or more fourth locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; generating a first consensus location using the first alignment and the third alignment and generating a second consensus location using the second alignment and the fourth alignment; as well as A trim position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score.

79. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more hardware processors to perform operations for adapter trimming in sequencing data analysis, the operations comprising any of any of claims 1 to 75.

80. A computer-implemented method for adaptor trimming in sequencing data analysis, the computer-implemented method comprising: One or more of the following is selected, by the processor and based on the plurality of match scores: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; generating, by the processor, a first consensus location using the first alignment and the third alignment and generating a second consensus location using the second alignment and the fourth alignment; as well as A trim position is determined, by the processor, based on the first consensus position, the second consensus position, a first consensus match score, and a second consensus match score.

81. The computer-implemented method of any preceding claim, further comprising: A first sequencing read having a first adapter and a second sequencing read having a second adapter are obtained by a processor and from a sequencer.

82. A computer-implemented method according to any of the preceding claims, wherein each of the first sequencing read, the second sequencing read, the head of the first sequencing read, the head of the second sequencing read, the tail of the first sequencing read, the tail of the second sequencing read, the first adapter and the second adapter comprises a base sequence.

83. The computer-implemented method of any one of the preceding claims, wherein the first sequencing read comprises a first insert.

84. The computer-implemented method of any one of the preceding claims, wherein the second sequencing read comprises a second insert.

85. The computer-implemented method of any one of the preceding claims, wherein the tail and the head of the first sequencing read are included in a first insert of the first sequencing read.

86. The computer-implemented method of any one of the preceding claims, wherein the tail and the head of the second sequence read are included in a second insert of the second sequence read.

87. The computer-implemented method of any preceding claim, wherein (a) aligning the tail of the first sequencing read with the head of the second sequencing read at the one or more first locations comprises: (1) a reverse complement of the head of the second sequencing read is aligned with (2) the tail of the first sequencing read at the one or more first locations by shifting the head of the second sequencing read by a certain number of bases relative to the tail of the first sequencing read.

88. The computer-implemented method of any preceding claim, wherein (a) aligning the tail of the first sequencing read with the head of the second sequencing read at one or more first locations comprises: (1) a reverse complement of the tail of the first sequencing read is aligned with (2) the head of the second sequencing read at the one or more first locations by shifting the tail of the first sequencing read by a certain number of bases relative to the head of the second sequencing read.

89. The computer-implemented method of any preceding claim, wherein (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations comprises: (1) aligning a reverse complement of the head of the first sequencing read with the tail of the second sequencing read at the one or more second locations by shifting the head of the first sequencing read by a certain number of bases relative to the tail of the second sequencing read.

90. The computer-implemented method of any preceding claim, wherein (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations comprises: Aligning (1) the reverse complement of the tail of the second sequencing read with (1) the head of the first sequencing read at the one or more second locations by shifting the tail of the second sequencing read by a certain number of bases relative to the head of the first sequencing read.

91. The computer-implemented method of any preceding claim, further comprising: Multiple alignments are generated by the processor by: (a) aligning the tail of the first sequencing read with the head of the second sequencing read at the one or more first locations; (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations; (c) aligning a first adaptor to the head of the first sequencing read at the one or more third locations; (d) aligning a second adaptor to the head of the second sequencing read at the one or more fourth locations; or a combination thereof.

92. The computer-implemented method of any preceding claim, further comprising: The plurality of match scores is determined by the processor, wherein each match score in the plurality of match scores corresponds to an alignment corresponding to one of the one or more first locations, the one or more second locations, the one or more third locations, and the one or more fourth locations.

93. The computer-implemented method of any one of the preceding claims, wherein the first number of matched bases and the second total number of bases correspond to one of the one or more first locations, the one or more second locations, the one or more third locations, and the one or more fourth locations.

94. The computer-implemented method of any preceding claim, wherein generating the first consensus location using the first alignment and the third alignment and generating the second consensus location using the second alignment and the fourth alignment comprises: generating a first adaptor mapping based on the first alignment; generating a second adaptor mapping based on the third alignment; In response to determining that the first adaptor location is consistent with the second adaptor location, the first consensus location is determined as the first adaptor location.

95. The computer-implemented method of any preceding claim, wherein generating the first consensus location using the first alignment and the third alignment and generating the second consensus location using the second alignment and the fourth alignment comprises: generating a first adaptor mapping based on the first alignment; generating a second adaptor mapping based on the third alignment; In response to determining that the first adaptor location is inconsistent with the second adaptor location, the first consensus location is determined to be the first adaptor location or the second adaptor location.

96. The computer-implemented method of any preceding claim, wherein generating the first consensus location using the first alignment and the third alignment and generating the second consensus location using the second alignment and the fourth alignment comprises: generating a third adaptor mapping based on the second alignment; generating a fourth adaptor mapping based on the fourth alignment; In response to determining that the third adaptor location is consistent with the fourth adaptor location, the second consensus location is determined as the second adaptor location.

97. The computer-implemented method of any preceding claim, wherein generating the first consensus location using the first alignment and the third alignment and generating the second consensus location using the second alignment and the fourth alignment comprises: generating a third adaptor mapping based on the second alignment; generating a fourth adaptor mapping based on the fourth alignment; In response to determining that the third adaptor location is inconsistent with the fourth adaptor location, the second consensus location is determined to be the second adaptor location or the fourth adaptor location.

98. The computer-implemented method of any preceding claim, further comprising: A first consensus match score is determined, by the processor, based on the first alignment and the third alignment.

99. The computer-implemented method of any preceding claim, further comprising: In response to determining that the first and third alignments agree on adaptor positioning, a first consensus match score is determined based on a first sum of matched bases and a second total sum of bases from the first and third alignments.

100. The computer-implemented method of any preceding claim, further comprising: In response to determining that the first alignment and the third alignment do not agree in the adaptor positioning: determining a first candidate match score based on a first adapter location obtained from the first alignment and a first sum of matched bases and a second total sum of bases from aligning the first adapter to the tail of the first sequencing read at the first adapter location; determining a second candidate match score based on a second adapter location obtained from the third alignment and the first sum of matched bases and the second total sum of bases from aligning the tail of the first sequencing read to the head of the second sequencing read at the second adapter location; as well as A score is selected from the first candidate matching score and the second candidate matching score as the first consensus score.

101. The computer-implemented method of any preceding claim, wherein the selected score is a higher score of the first candidate match score and the second candidate match score.

102. The computer-implemented method of any preceding claim, further comprising: A second consensus match score is determined, by the processor, based on the second alignment and the fourth alignment.

103. The computer-implemented method of any preceding claim, further comprising: In response to determining that the second and fourth alignments agree on adaptor positioning, a second consensus match score is determined based on a third sum of matched bases and a fourth total sum of bases from the second and fourth alignments.

104. The computer-implemented method of any preceding claim, further comprising: In response to determining that the second alignment and the fourth alignment do not agree in the adaptor positioning: determining a third candidate match score based on a third sum of matched bases from a third adapter location obtained from the second alignment and a fourth total sum of bases from aligning the second adapter to the tail of the second sequencing read at the third adapter location; determining a fourth candidate match score based on a fourth adapter location obtained from the fourth alignment and the third matched base sum and a fourth total base sum from aligning the tail of the second sequencing read to the head of the first sequencing read at the fourth adapter location; and A score is selected from the third candidate matching score and the fourth candidate matching score as the second consensus score.

105. The computer-implemented method of any preceding claim, wherein the selected score is a higher score of the third candidate match score and the fourth candidate match score.

106. The computer-implemented method of any preceding claim, wherein determining the trim position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score comprises: selecting a higher score from the first consensus match score and the second consensus match score; Determine if the selected higher score is above a predetermined threshold: The pruning position is determined based on the selected higher score.

107. The computer-implemented method of any preceding claim, wherein determining the trim position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score comprises: selecting a higher score from the first consensus match score and the second consensus match score; Determine if the selected higher score is below a predetermined threshold: A determination is made not to perform trimming on the first sequenced read or the second sequenced read.

108. The computer-implemented method of any preceding claim, wherein determining the trim position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score comprises: selecting a higher score from the first consensus match score and the second consensus match score; determining that the higher score is above a predetermined threshold; and determining the trimmed position as the first consensus position or the second consensus position, wherein the trimmed position corresponds to the selected higher score.

109. The computer-implemented method of any preceding claim, wherein each match score in the plurality of match scores comprises a probability that the first number of matched bases does not occur by chance.

110. The computer-implemented method of any preceding claim, wherein each match score of the plurality of match scores comprises a probability that the first number of matched bases in the second total number of bases does not occur randomly.

111. The computer-implemented method of any of the preceding claims, wherein each match score in the plurality of match scores comprises a probability that is a constant minus a cumulative distribution function (CDF) of a variable m having a binomial distribution, and wherein the binomial distribution is determined by the total number of bases n and the probability p of randomly matching a base in the alignment.

112. The computer-implemented method of any preceding claim, wherein the constant is 1 and each of the plurality of match scores is greater than approximately 0.99000, approximately 0.99900, approximately 0.99990, or approximately 0.99999.

113. The computer-implemented method of any preceding claim, wherein the constant is 1 and each of the plurality of match scores is greater than 0.99000, 0.99900, 0.99990, or 0.99999.

114. A computer-implemented method according to any of the preceding claims, wherein each match score in the plurality of match scores is calculated as CP(m>=M), where C is a constant, M is a first number of matching bases, m is a variable with a binomial distribution, i.e., binomial(n,p), n is a second total number of bases, and p is the probability of randomly matching a base to a certain number of different bases.

115. The computer-implemented method of any preceding claim, wherein when the number of different bases is 4, p is 0.

25.

116. The computer-implemented method of any preceding claim, wherein C is 1.

117. The computer-implemented method of any preceding claim, wherein n is in the range of 1 to about 64.

118. The computer-implemented method of any preceding claim, wherein n is in the range of 1.16 to about 32.

119. The computer-implemented method of any preceding claim, wherein M is in the range of 0 to about 64.

120. The computer-implemented method of any preceding claim, wherein M is in the range of 0 to about 32.

121. The computer-implemented method of any of the preceding claims, wherein the first adaptor or the second adaptor has approximately 10 bases.

122. The computer-implemented method of any one of the preceding claims, wherein the first adaptor or the second adaptor has 10 bases.

123. The computer-implemented method of any of the preceding claims, wherein the first adaptor or the second adaptor has about 4 bases to about 64 bases.

124. The computer-implemented method of any of the preceding claims, wherein the first adaptor or the second adaptor has about 8 bases to about 32 bases.

125. The computer-implemented method of any of the preceding claims, wherein the head of the first sequencing read or the second sequencing read is at least about 32 bases or about 16 bases.

126. The computer-implemented method of any of the preceding claims, wherein the tail of the first or second sequencing read is less than about 80 bases and greater than about 16 bases in length.

127. The computer-implemented method of any of the preceding claims, wherein the length of the head of the first sequencing read or the second sequencing read is less than about 80 bases and greater than about 16 bases.

128. The computer-implemented method of any preceding claim, wherein the tail of the first sequencing read has a length different from the length of the head of the second sequencing read.

129. The computer-implemented method of any preceding claim, wherein the length of the tail of the first sequencing read is the same as the length of the head of the second sequencing read.

130. The computer-implemented method of any preceding claim, wherein the length of the head of the first sequencing read is different from the length of the tail of the second sequencing read.

131. The computer-implemented method of any preceding claim, wherein the length of the head of the first sequencing read is the same as the length of the tail of the second sequencing read.

132. The computer-implemented method of any of the preceding claims, wherein the number of bases of the first insert of the first sequencing read or the second insert of the second sequencing read is in the range of about 16 bases to about 400 bases.

133. The computer-implemented method of any of the preceding claims, wherein the number of bases of the first insert of the first sequencing read or the second insert of the second sequencing read is in the range of about 16 bases to about 150 bases.

134. The computer-implemented method of any of the preceding claims, wherein the first adaptor is ligated to the head of the first sequencing read.

135. The computer-implemented method of any of the preceding claims, wherein the second adaptor is ligated to the head of the second sequencing read.

136. The computer-implemented method of any of the preceding claims, wherein the first adaptor is a 5' adaptor of the first sequencing read.

137. The computer-implemented method of any of the preceding claims, wherein the second adaptor is a 3' adaptor of the second sequencing read.

138. The computer-implemented method of any preceding claim, wherein one or more of the following: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adaptor comprises: insertion of one or more bases; a deletion of one or more bases; or both.

139. The computer-implemented method of any preceding claim, wherein each base in one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adaptor is represented by an integer.

140. The computer-implemented method of any preceding claim, wherein each base of one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adapter is represented as a bitwise integer.

141. The computer-implemented method of any preceding claim, wherein each base of one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second linker is represented as a 4-bit binary number.

142. The computer-implemented method of any preceding claim, wherein one or more of the following: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as A fourth alignment, the fourth alignment resulting from (d) aligning the second adaptor to the head of the second sequencing read at one or more fourth locations, is determined based on a bitwise operation.

143. A computer-implemented method according to any one of the preceding claims, wherein 144. The computer-implemented method of any preceding claim, wherein the processor comprises: one or more processing units; one or more integrated circuits; or Its combination.

145. The computer-implemented method of any preceding claim, wherein the processor comprises: one or more central processing units (CPUs); one or more field programmable gate arrays (FPGAs); or a combination thereof.

146. The computer-implemented method of any preceding claim, further comprising: The first sequenced reads, the second sequenced reads, or both are generated by the processor by performing one or more preliminary analysis steps on the flow cell image.

147. The computer-implemented method of any preceding claim, wherein the one or more preliminary analysis steps performed on the flow cell image comprise: background subtraction; Image sharpening; Intensity offset adjustment; Color correction; Intensity normalization; Falling behind and leading ahead correction; Image registration; Intensity normalization Quality score estimates; or Its combination.

148. The computer-implemented method of any preceding claim, further comprising: trimming the first sequencing read, the second sequencing read, or both at the trimming location; converting, by the processor, the pruned first sequencing reads, the pruned second sequencing reads, or both, to a predetermined format; recording, by the processor, the pruned first sequencing reads, the pruned second sequencing reads, or both in the predetermined format; and The pruned first sequencing reads, the pruned second sequencing reads, or both in the predetermined format are transmitted by the processor to a processing unit.

149. The computer-implemented method of any preceding claim, wherein the processing unit is a central processing unit (CPU).

150. A computer-implemented method according to any of the preceding claims, wherein the processing unit is configured to generate sequencing results for display to a user based on the trimmed first sequencing reads, the trimmed second sequencing reads, or both in the predetermined format.

151. A computer-implemented system for adapter trimming for sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising: Select one or more of the following based on multiple match scores: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; generating a first consensus location using the first alignment and the third alignment and generating a second consensus location using the second alignment and the fourth alignment; as well as A trim position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score.

152. The computer-implemented method of any one of the preceding claims, wherein the second sequence read is the reverse complement of the first sequence read.

153. A computer-implemented system for adaptor trimming for sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising any one of claims 80 to 149.

154. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more hardware processors to perform operations for adapter trimming in sequencing data analysis, the operations comprising: Select one or more of the following based on multiple match scores: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; a third alignment resulting from (c) aligning the first adaptor to the head of the first sequencing read at one or more third locations; as well as a fourth alignment resulting from (d) aligning a second adaptor to the head of the second sequencing read at one or more fourth locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; generating a first consensus location using the first alignment and the third alignment and generating a second consensus location using the second alignment and the fourth alignment; as well as A trim position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score.

155. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more hardware processors to perform operations for adapter trimming in sequencing data analysis, the operations comprising any one of claims 80 to 149.

156. A computer-implemented method for adaptor determination in sequencing data analysis, the computer-implemented method comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; The adaptor location is determined by the processor based on: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; as well as a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; obtaining, by the processor, a plurality of adapter sequences from the plurality of paired-end sequencing reads based on the determined adapter locations; Repeatedly perform one or more operations until a stopping criterion is met, including: selecting a seed adapter sequence from the plurality of adapter sequences; identifying one or more adapter sequences in the plurality of adapter sequences that meet a threshold similarity compared to the seed adapter sequence; as well as determining whether each base position is an A, G, C, or T / U base based on corresponding counts of different bases at corresponding base positions of the one or more determined adapter sequences and a predetermined threshold, thereby generating separate candidate adapters; as well as The seed adapter sequence and the one or more determined adapter sequences are removed from the plurality of adapter sequences.

157. A computer-implemented method for adaptor determination in sequencing data analysis, the computer-implemented method comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; Selecting, by the processor and based on a plurality of matching scores, one or more of: a first alignment resulting from (a) aligning the tail of the first sequencing read with the head of the second sequencing read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; An adaptor location is determined, by the processor, based on one or more of the selected first and second alignments.

158. The computer-implemented method of any preceding claim, wherein the second sequence read is the reverse complement of the first sequence read.

159. The computer-implemented method of any preceding claim, wherein determining, by the processor, adapter locations based on: a first alignment from (a) aligning a tail of a first sequencing read to a head of a second sequencing read at one or more first locations; and a second alignment from (b) aligning a tail of the second sequencing read to a head of the first sequencing read at one or more second locations, comprising: The adapter locations are determined, by the processor, based on a plurality of match scores, each match score calculated based on a first number of matched bases and a second total number of bases at the one or more first locations and the one or more second locations.

160. The computer-implemented method of any preceding claim, wherein the adapter mapping is determined by the processor based on a maximum match score among the plurality of match scores.

161. The computer-implemented method of any preceding claim, further comprising: selecting a second seed adaptor sequence from the plurality of adaptor sequences; identifying one or more second adapter sequences in the plurality of adapter sequences that meet a threshold similarity compared to the seed adapter sequence; as well as determining an A, G, C, or T / U base for the one or more base maps based on corresponding counts of different bases at corresponding base maps of the one or more determined adapter sequences and a predetermined threshold; as well as In response to determining that n base mappings out of the total number of mappings do not meet the predetermined threshold, removing the seed adapter sequence and the one or more determined adapter sequences from the plurality of adapter sequences without generating a candidate adapter.

162. The computer-implemented method of any preceding claim, further comprising: selecting a second seed adaptor sequence from the plurality of adaptor sequences; In response to determining that no adapter sequence in the plurality of adapter sequences satisfies a similarity threshold compared to the second seed adapter sequence, the second seed adapter sequence is removed from the plurality of adapter sequences without generating a candidate adapter.

163. The computer-implemented method of any preceding claim, further comprising: The individual candidate adaptors are forwarded by the processor to a memory device, a display, or both.

164. The computer-implemented method of any preceding claim, wherein the similarity threshold is determined by one or more of: a Hamming distance, a Smith-Waterman algorithm, and a Needleman-Wunsch algorithm.

165. The computer-implemented method of any one of the preceding claims, wherein the predetermined threshold is an occurrence greater than 50% of the total number of bases at the corresponding base location.

166. The computer-implemented method of any preceding claim, wherein the one or more adapter sequences comprise at least 50, 60, 80, or 100 sequences.

167. The computer-implemented method of any preceding claim, wherein the adaptor mapping is a trimming mapping.

168. The computer-implemented method of any preceding claim, further comprising: The individual candidate adapters are trimmed, by the processor, from the plurality of paired-end sequencing reads, thereby generating a plurality of trimmed sequencing reads.

169. The computer-implemented method of any preceding claim, further comprising: A secondary analysis is performed, by the processor, on the plurality of trimmed sequencing reads.

170. The computer-implemented method of any preceding claim, further comprising: The plurality of trimmed sequencing reads are forwarded by the processor for secondary analysis.

171. The computer-implemented method of any of the preceding claims, wherein the first sequence reads and the second sequence reads comprise only one adapter.

172. The computer-implemented method of any of the preceding claims, wherein the first sequence reads and the second sequence reads comprise two or more different adapters.

173. The computer-implemented method of any of the preceding claims, wherein the adaptor comprises 4 to 64 bases.

174. The computer-implemented method of any of the preceding claims, wherein the adaptor comprises 10 to 48 bases.

175. The computer-implemented method of any preceding claim, wherein the first sequencing read comprises a first insert.

176. The computer-implemented method of any preceding claim, wherein the second sequencing read comprises a second insert.

177. The computer-implemented method of any of the preceding claims, wherein the tail and the head of the first sequencing read are included in a first insert of the first sequencing read.

178. The computer-implemented method of any preceding claim, wherein the tail and the head of the second sequence read are included in a second insert of the second sequence read.

179. The computer-implemented method of any preceding claim, wherein (a) aligning the tail of the first sequencing read with the head of the second sequencing read at the one or more first locations comprises: (1) a reverse complement of the head of the second sequencing read is aligned with (2) the tail of the first sequencing read at the one or more first locations by shifting the head of the second sequencing read by a certain number of bases relative to the tail of the first sequencing read.

180. The computer-implemented method of any preceding claim, wherein (a) aligning the tail of the first sequencing read with the head of the second sequencing read at one or more first locations comprises: (1) a reverse complement of the tail of the first sequencing read is aligned with (2) the head of the second sequencing read at the one or more first locations by shifting the tail of the first sequencing read by a certain number of bases relative to the head of the second sequencing read.

181. The computer-implemented method of any preceding claim, wherein (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations comprises: (1) aligning a reverse complement of the head of the first sequencing read with the tail of the second sequencing read at the one or more second locations by shifting the head of the first sequencing read by a certain number of bases relative to the tail of the second sequencing read.

182. The computer-implemented method of any preceding claim, wherein (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations comprises: Aligning (1) the reverse complement of the tail of the second sequencing read with (1) the head of the first sequencing read at the one or more second locations by shifting the tail of the second sequencing read by a certain number of bases relative to the head of the first sequencing read.

183. The computer-implemented method of any preceding claim, further comprising: Multiple alignments are generated by the processor by: (a) aligning the tail of the first sequencing read with the head of the second sequencing read at the one or more first locations; (b) aligning the tail of the second sequencing read with the head of the first sequencing read at the one or more second locations; or a combination thereof.

184. The computer-implemented method of any preceding claim, further comprising: The plurality of match scores is determined by the processor, wherein each match score in the plurality of match scores corresponds to an alignment corresponding to one of the one or more first locations and the one or more second locations.

185. The computer-implemented method of any one of the preceding claims, wherein the first number of matched bases and the second total number of bases correspond to one of the one or more first locations and the one or more second locations.

186. The computer-implemented method of any preceding claim, further comprising: A match score is determined, by the processor, based on the first alignment and the second alignment.

187. The computer-implemented method of any of the preceding claims, wherein the tail of the first sequencing read or the second sequencing read is less than about 80 bases and greater than about 16 bases in length.

188. The computer-implemented method of any of the preceding claims, wherein the length of the head of the first sequencing read or the second sequencing read is less than about 80 bases and greater than about 16 bases.

189. The computer-implemented method of any of the preceding claims, wherein the tail of the first sequencing read is a different length than the head of the second sequencing read.

190. The computer-implemented method of any preceding claim, wherein the length of the tail of the first sequencing read is the same as the length of the head of the second sequencing read.

191. The computer-implemented method of any preceding claim, wherein the length of the head of the first sequencing read is different from the length of the tail of the second sequencing read.

192. The computer-implemented method of any preceding claim, wherein the length of the head of the first sequencing read is the same as the length of the tail of the second sequencing read.

193. A computer-implemented method according to any of the preceding claims, wherein the number of bases of the first insert portion of the first sequencing read or the second insert portion of the second sequencing read is in the range of about 16 bases to about 400 bases.

194. A computer-implemented method according to any of the preceding claims, wherein the number of bases of the first insert portion of the first sequencing read or the second insert portion of the second sequencing read is in the range of about 16 bases to about 150 bases.

195. The computer-implemented method of any of the preceding claims, wherein the first adaptor is ligated to the tail of the first sequencing read.

196. The computer-implemented method of any of the preceding claims, wherein the second adaptor is ligated to the tail of the second sequencing read.

197. The computer-implemented method of any of the preceding claims, wherein the first adaptor is a 3' adaptor of the first sequencing read.

198. The computer-implemented method of any of the preceding claims, wherein the second adaptor is a 5' adaptor of the second sequencing read.

199. The computer-implemented method of any preceding claim, wherein one or more of the following: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adaptor comprises: insertion of one or more bases; a deletion of one or more bases; or both.

200. The computer-implemented method of any preceding claim, wherein each base in one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adaptor is represented by an integer.

201. The computer-implemented method of any preceding claim, wherein each base in one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second adapter is represented as a bitwise integer.

202. The computer-implemented method of any preceding claim, wherein each base in one or more of: the header of the first sequencing read; the header of the second sequencing read; the tail of the first sequencing read; the tail of the second sequencing read; the first adaptor; and The second linker is represented as a 4-bit binary number.

203. The computer-implemented method of any preceding claim, wherein the processor comprises: one or more processing units; one or more integrated circuits; or Its combination.

204. The computer-implemented method of any preceding claim, wherein the processor comprises: one or more central processing units (CPUs); one or more field programmable gate arrays (FPGAs); or a combination thereof.

205. The computer-implemented method of any preceding claim, further comprising: The first sequenced reads, the second sequenced reads, or both are generated by the processor by performing one or more preliminary analysis steps on the flow cell image.

206. The computer-implemented method of any preceding claim, wherein the one or more preliminary analysis steps performed on the flow cell image comprise: background subtraction; Image sharpening; Intensity offset adjustment; Color correction; Intensity normalization; Falling behind and leading ahead correction; Image registration; Intensity normalization; Quality score estimates; or Its combination.

207. The computer-implemented method of any preceding claim, further comprising: trimming the first sequencing read, the second sequencing read, or both at the trimming location; converting, by the processor, the pruned first sequencing reads, the pruned second sequencing reads, or both, to a predetermined format; and The trimmed first sequencing reads, the trimmed second sequencing reads, or both are recorded by the processor in the predetermined format.

208. The computer-implemented method of any preceding claim, further comprising: The pruned first sequencing reads, the pruned second sequencing reads, or both in the predetermined format are transmitted by the processor to a processing unit.

209. The computer-implemented method of any preceding claim, wherein the processing unit is a central processing unit (CPU).

210. A computer-implemented method according to any of the preceding claims, wherein the processing unit is configured to generate sequencing results for display to a user based on the trimmed first sequencing reads, the trimmed second sequencing reads, or both in the predetermined format.

211. The computer-implemented method of any preceding claim, further comprising: A plurality of adapter sequences are obtained, by the processor, from the plurality of paired-end sequencing reads based on the determined adapter locations.

212. A computer-implemented system for adapter determination in sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; Selecting, by the processor and based on a plurality of matching scores, one or more of: a first alignment resulting from (a) aligning the tail of the first sequencing read with the head of the second sequencing read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; An adaptor location is determined, by the processor, based on one or more of the selected first and second alignments.

213. A computer-implemented system for adapter determination in sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; Selecting, by the processor and based on a plurality of matching scores, one or more of: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; An adaptor location is determined, by the processor, based on one or more of the selected first and second alignments.

214. A computer-implemented system for adapter determination in sequencing data analysis, the computer-implemented system comprising: one or more hardware processors; One or more data storage devices storing instructions that, when executed by the one or more hardware processors, cause the one or more hardware processors to perform operations comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; The adaptor location is determined by the processor based on: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; as well as a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; obtaining, by the processor, a plurality of adapter sequences from the plurality of paired-end sequencing reads based on the determined adapter locations; Repeatedly perform one or more operations until a stopping criterion is met, including: selecting a seed adapter sequence from the plurality of adapter sequences; identifying one or more adapter sequences in the plurality of adapter sequences that meet a threshold similarity compared to the seed adapter sequence; as well as determining whether each base position is an A, G, C, or T / U base based on corresponding counts of different bases at corresponding base positions of the one or more determined adapter sequences and a predetermined threshold, thereby generating separate candidate adapters; as well as The seed adapter sequence and the one or more determined adapter sequences are removed from the plurality of adapter sequences.

215. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more hardware processors to perform operations for adapter determination in sequencing data analysis, the operations comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; Selecting, by the processor and based on a plurality of matching scores, one or more of: a first alignment resulting from (a) aligning the tail of the first sequencing read with the head of the second sequencing read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; An adaptor location is determined, by the processor, based on one or more of the selected first and second alignments.

216. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more hardware processors to perform operations for adapter determination in sequencing data analysis, the operations comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; Selecting, by the processor and based on a plurality of matching scores, one or more of: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations, wherein each match score in the plurality of match scores is based on a first number of matched bases and a second total number of bases; An adaptor location is determined, by the processor, based on one or more of the selected first and second alignments.

217. One or more non-transitory computer storage media encoded with instructions that, when executed by one or more hardware processors, cause the one or more processors to perform operations for adapter determination in sequencing data analysis, the operations comprising: Obtaining, by a processor, a plurality of paired-end sequencing reads, each paired-end sequencing read comprising a first sequencing read and a second sequencing read, wherein each of the first sequencing read and the second sequencing read comprises a nucleotide base sequence; The adaptor location is determined by the processor based on: a first alignment resulting from (a) aligning the tail of the first sequenced read with the head of the second sequenced read at one or more first locations; as well as a second alignment resulting from (b) aligning the tail of the second sequenced read to the head of the first sequenced read at one or more second locations; obtaining, by the processor, a plurality of adapter sequences from the plurality of paired-end sequencing reads based on the determined adapter locations; Repeatedly perform one or more operations until a stopping criterion is met, including: selecting a seed adapter sequence from the plurality of adapter sequences; identifying one or more adapter sequences in the plurality of adapter sequences that meet a threshold similarity compared to the seed adapter sequence; as well as determining whether each base position is an A, G, C, or T / U base based on corresponding counts of different bases at corresponding base positions of the one or more determined adapter sequences and a predetermined threshold, thereby generating separate candidate adapters; as well as The seed adapter sequence and the one or more determined adapter sequences are removed from the plurality of adapter sequences.

Images