Stationary phase for DNA synthesis and preparation method and application thereof

Abstract

The present invention provides a stationary phase for DNA synthesis, a preparation method thereof, and an application. The preparation method of the stationary phase for DNA synthesis provided by the present invention includes: S1, preparing nano-magnetic iron tetroxide particles and coating a SiO2 layer on the surface of the nano-magnetic iron tetroxide particles to obtain a nano-magnetic composite material Fe3O4@SiO2; S2, performing azide group modification on the surface of the nano-magnetic composite material Fe3O4@SiO2 to form a surface-modified nano-magnetic composite material Fe3O4@SiO2@N3; S3, loading an initiator onto the surface of the surface-modified nano-magnetic composite material Fe3O4@SiO2@N3 through a Click reaction to obtain a stationary phase for DNA synthesis. The stationary phase provided by the present invention can be used for DNA synthesis and has the characteristics of high binding strength, good stability, difficult shedding of the initiator, high DNA synthesis yield, etc.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a stationary phase for DNA synthesis and a preparation method and application thereof. Background Art

[0002] As a key basic technology in synthetic biology, the transformation of DNA synthesis technology and corresponding synthesis equipment will bring about major breakthroughs in the field of synthetic biology. The current mainstream DNA synthesis technology is the solid-phase phosphoramidite synthesis method developed in the 1980s. In this method, each synthesis of a nucleotide requires four steps: deprotection, coupling, capping and oxidation. However, this technology faces some serious problems, such as harsh synthesis environment requirements, the need to use toxic gases, and the generation of a large amount of hazardous waste after synthesis, which brings great challenges to post-processing. The enzyme synthesis technology that has emerged in recent years has brought hope to solve the problems existing in the solid-phase phosphoramidite synthesis method. Enzymatic DNA synthesis is mainly based on the engineering single-strand polymerase TDT to catalyze DNA chain extension, while using reversibly terminated modified nucleotides as substrates to accurately control the raw materials of each step of synthesis. Compared with traditional methods, the reaction conditions of enzymatic synthesis are very mild, which greatly reduces the requirements for the environment and can realize laboratory desktop synthesis; and the synthesis process does not produce toxic waste, and can be used with downstream biological enzyme catalysis for a series of operations such as splicing and error correction. It is compatible with biological assembly and has high integration feasibility, opening up a new path for the development of DNA synthesis technology.

[0003] Enzymatic DNA synthesis usually requires a solid phase carrier as a support for the initiator. On this basis, the raw materials required for DNA synthesis are added, including terminal deoxynucleotidyl transferase (TdT), an initiator with a 3'-OH end, and four deoxyribonucleoside triphosphates (dATP, dGTP, dTTP, and dCTP) for DNA enzymatic synthesis. Currently, existing solid phase carriers on the market, such as streptavidin-modified magnetic beads (SA magnetic beads), are widely used. They specifically bind to biotin modified on the initiator to fix the initiator on the magnetic beads, which is convenient for subsequent purification and separation; however, this fixation method has certain limitations. Biotin and streptavidin are affinity adsorbed, and their binding strength is sensitive to temperature. High temperature will cause the initiator to fall off. This will undoubtedly have an adverse effect on the stability and accuracy of DNA synthesis, and may even lead to deviations in experimental results. Summary of the invention

[0004] The present invention provides a stationary phase for DNA synthesis and a preparation method thereof, which comprises a surface-modified nano-magnetic composite material Fe 3 O 4 @SiO 2 @N 3It is obtained after binding with the initiator and is used to solve the problem that the binding strength of streptavidin-modified magnetic beads is not high and the initiator is easy to fall off.

[0005] In a first aspect, the present invention provides a method for preparing a stationary phase for DNA synthesis, comprising:

[0006] S1, preparing nano-magnetic ferroferric oxide particles, and coating the surface of the nano-magnetic ferroferric oxide particles with SiO 2 layer, and obtain the nano-magnetic composite material Fe 3 O 4 @SiO 2 ;

[0007] S2, in nano-magnetic composite Fe 3 O 4 @SiO 2 The surface was modified with azide groups to obtain a surface-modified nano-magnetic composite material Fe 3 O 4 @SiO 2 @N 3 ;

[0008] S3, the surface modified nano magnetic composite material Fe 3 O 4 @SiO 2 @N 3 Mixed with the initiator, the initiator is loaded onto the surface-modified nano-magnetic composite material Fe by click reaction 3 O 4 @SiO 2 @N 3 to obtain the stationary phase for DNA synthesis;

[0009] The initiator is a single-stranded DNA with a dibenzocyclooctyne group modified at the 5' end, and a free hydroxyl group at the 3' end of the single-stranded DNA.

[0010] According to the method described above, the nano-magnetic ferroferric oxide particles can be synthesized by a hydrothermal method; specifically, a trivalent iron source and a reducing agent are mixed and subjected to an oxidation-reduction reaction, and a portion of the trivalent iron is reduced to divalent iron under the action of the reducing agent, and the divalent iron and the remaining trivalent iron form metal oxides under high temperature and high pressure conditions to obtain nano-magnetic ferroferric oxide particles Fe 3 O 4 .

[0011] Furthermore, the trivalent iron source can be at least one of inorganic iron salts such as ferric chloride hexahydrate, ferric nitrate, and ferric sulfate, or organic iron salts such as ammonium ferric citrate and ferric gluconate. The reducing agent is at least one of oxalic acid or its salt, citric acid or its salt, vitamin C, glucose, sulfite, dithionite, hydroxylamine hydrochloride, and sodium borohydride; wherein oxalic acid or its salt, citric acid or its salt can also exist in the form of substances containing different water, such as dihydrated oxalic acid (H 2 C 2 O 4 •2H 2 O), calcium oxalate monohydrate (CaC 2 O 4 •H 2 O) and calcium oxalate dihydrate (CaC 2 O 4 •2H 2 O), sodium oxalate dihydrate (NaC 2 O 4 •2H 2 O), sodium citrate (Na 3 C 6 H 5 O 7 )、Sodium citrate dihydrate(Na 3 C 6 H 5 O 7 •2H 2 O), sodium citrate pentahydrate (Na 3 C 6 H 5 O 7 •5H 2 O), calcium citrate (Ca 3 C 6 H 5 O 7 )wait.

[0012] Furthermore, the molar ratio of the ferric iron source to the reducing agent is (2.5:1)-(6:1). 3 O 4 The size of the nanostructured carbon nanotubes is regulated by sodium acetate, and the molar ratio of the ferric iron source to sodium acetate is (1:3)-(1:6).

[0013] Further, the ferric iron source, the reducing agent and the sodium acetate are uniformly mixed, and the mixture is reacted by a hydrothermal method for 6-12 hours. After the reaction is completed, the reaction product is washed to obtain nano-magnetic ferroferric oxide particles Fe 3 O 4 .

[0014] Furthermore, the temperature of the hydrothermal method is 150-200° C. and the pressure is 4.7-15.5 Mpa.

[0015] The method described above is used to prepare the nano-magnetic ferroferric oxide particles Fe 3 O 4 It is spherical particles with an average particle size of 100-1000 nm and a PI of less than 0.2. PI (Polydispersity Index) is an important indicator used to evaluate the uniformity of particle distribution in dynamic light scattering (DLS). The PI value ranges from 0 to 1, and the smaller the value, the more uniform the particle size. Both the average particle size and PI are obtained using a dynamic light scattering nanoparticle size analyzer.

[0016] The method described above, the nano magnetic ferroferric oxide particles Fe synthesized according to the above steps 3 O 4 , and then react with the silicon source to form a coating on the nano-magnetic Fe3O4 particles. 3 O 4 Surface coating SiO 2 shell layer, and obtain nano-magnetic composite material Fe 3 O 4 @SiO 2 .

[0017] Furthermore, the silicon source is one or more polysiloxanes such as tetraethyl orthosilicate (TEOS), sodium silicate, trimethylethoxysilane and polydiethoxysiloxane.

[0018] Furthermore, during the reaction, the nano magnetic ferroferric oxide particles Fe 3 O 4 The nanocomposite Fe nanoparticles are dispersed in an aqueous solution of an organic alcohol, and a catalyst is added and mixed evenly to obtain a mixed reaction system; a silicon source is then added to carry out a coating reaction, and after the reaction is completed, the reaction product is washed to obtain a nanocomposite magnetic material Fe 3 O 4 @SiO 2 .

[0019] Furthermore, the nano magnetic ferroferric oxide particles Fe 3 O 4 The mass ratio of the organic alcohol to the silicon source is 5:1-2:1; the aqueous solution of the organic alcohol is an aqueous solution of ethanol; and the volume ratio of the organic alcohol to water is 1:1-4:1.

[0020] Furthermore, the catalyst is aqueous ammonia; and the volume ratio of the catalyst to the silicon source is 1:1-1:3.

[0021] Furthermore, the coating reaction temperature is 30-80°C, and the reaction time is 0.5-24 h.

[0022] Furthermore, the nano-magnetic composite material Fe 3 O 4 @SiO 2 The average particle size is 100-1000 nm and the PI is less than 0.2.

[0023] The method as described above, the nano-magnetic composite material Fe prepared according to the above steps 3 O 4 @SiO 2 , mixed with a silane coupling agent containing an azide group and subjected to a condensation reaction to form a nano-magnetic composite Fe 3 O 4 @SiO 2 Azide groups are formed on the surface to obtain surface-modified nano-magnetic composite material Fe 3 O 4 @SiO 2 @N 3 .

[0024] Furthermore, the silane coupling agent containing an azide group is selected from at least one of 3-(azidopropyl)triethoxysilane, 3-(azidopropyl)trimethoxysilane, and 6-azidosulfonylhexyltriethoxysilane.

[0025] Furthermore, the nano-magnetic composite material Fe 3 O 4 @SiO 2 The mass concentration in the reaction system is 5%-20%, and the mass concentration of the silane coupling agent containing an azide group is 10%-30%.

[0026] Furthermore, the solvent used in the reaction system is an alcohol solution containing 1%-25% water, and the alcohol is one of ethanol, isopropanol and cyclohexanol.

[0027] Furthermore, the surface modified nano-magnetic composite material Fe 3 O 4 @SiO 2 @N 3 The average particle size is 100-1000 nm and the PI is less than 0.2.

[0028] In the above method, the initiator is used as the basis for DNA synthesis, and its 5' end is modified by DBCO and reacted with the nanomagnetic composite material Fe 3 O 4 @SiO 2 @N 3The azide groups on the surface are connected by covalent bonds through Click reaction, which improves the initiator in the nanomagnetic composite Fe 3 O 4 @SiO 2 @N 3 The 3'-terminal hydroxyl group provides a deoxyribonucleotide attachment site for terminal deoxynucleotidyl transferase (TdT).

[0029] According to the method described above, based on each mg of surface-modified nanomagnetic composite Fe 3 O 4 @SiO 2 @N 3 , loaded into the nano-magnetic composite Fe 3 O 4 @SiO 2 @N 3 The loading amount of the initiator on the surface is 1 pmol-1000 pmol; specifically, it can be 1 pmol, 5 pmol, 10 pmol, 20 pmol, 50 pmol, 100 pmol, 200 pmol, 300 pmol, 400 pmol, 500 pmol, 600 pmol, 700 pmol, 800 pmol, 900 pmol, 1000 pmol or a range consisting of any two thereof.

[0030] In the method described above, the temperature of the Click reaction is 25-55° C., and the reaction time is 0.5-24 h.

[0031] According to the above method, according to different application scenarios of the target DNA, such as the synthesis of PCR primers, the initiator may also include a cleavage site. After the target DNA is synthesized, the cleavage site is cleaved to break the DNA chain behind the 3' end of the cleavage site, and the nano-magnetic composite material Fe 3 O 4 @SiO 2 @N 3 Dissociate and release the synthesized target DNA, and use the synthesized target DNA directly as a primer for PCR reaction.

[0032] Furthermore, the cleavage site may be inosine nucleotide.

[0033] Furthermore, the structure of the initiator containing the cleavage site can be shown as Formula 1:

[0034] 5'-DBCO-n(a)-dI-n(b)-3' Formula 1;

[0035] In Formula 1, DBCO is a dibenzocyclooctyne group, n(a) is a single-stranded DNA group having a nucleotide sequence of SEQ ID NO: 1, n(b) is a single-stranded DNA group having a nucleotide sequence of SEQ ID NO: 2, and dI is inosine nucleotide.

[0036] In the above method, the target DNA may be an oligonucleotide chain, the initiator may not contain a cleavage site, and the synthesized target DNA does not need to be removed from the nanomagnetic composite material Fe 3 O 4 @SiO 2 @N 3 The above dissociation can be directly used in subsequent methods.

[0037] In a second aspect, the present invention provides a stationary phase for DNA synthesis prepared according to the above preparation method.

[0038] In a third aspect, the present invention provides use of the above-mentioned stationary phase for DNA synthesis in synthesizing DNA.

[0039] In a fourth aspect, the present invention provides a method for synthesizing DNA, comprising: using an enzymatic method to synthesize a target DNA using a stationary phase for DNA synthesis prepared according to the above-mentioned preparation method.

[0040] The method as described above comprises the steps of synthesizing DNA according to the stationary phase for DNA synthesis as described above: a) fully contacting and reacting an initiator having a free 3'-OH or an extension fragment having a free 3'-OH with a nucleotide monomer containing a 3'-O-blocking group and a template-independent terminal deoxynucleotidyl transferase (TdT) in a reaction system, introducing a new nucleotide monomer containing a 3'-O-blocking group at the 3-OH end of the initiator having a free 3'-OH or the extension fragment, and obtaining an extension fragment connected with a 3'-O-blocking group; b) adding a reaction solution capable of removing the blocking group located on the 3'-OH, so that the extension fragment is unblocked to form an extension fragment with a free 3'-OH; adding nucleotide monomers containing a blocking group at 3'-OH in sequence according to the base sequence required for the DNA chain to be synthesized, and continuously repeating the cycle process of the above two steps a) and b) until the target length is reached, and finally forming the DNA chain to be synthesized.

[0041] Furthermore, the blocking group may be at least one of an amino group, an allyl group, a phosphate group or a methylazido group. The reaction solution for removing the blocking group may be sodium nitrite, a platinum salt, an acid or tris(2-carboxyethyl)phosphine.

[0042] The surface-modified nano-magnetic composite material Fe provided by the present invention 3 O 4 @SiO 2 @N3 It can be used as a stationary phase carrier for DNA synthesis. Compared with SA magnetic beads, the surface-modified nano-magnetic composite Fe 3 O 4 @SiO 2 @N 3 The initiator loaded on the magnetic beads has better stability. The binding mode between SA magnetic beads and biotin-modified initiators is affinity adsorption, and its binding strength changes with temperature. At high temperatures, the initiator is easily detached from the magnetic beads; while Fe 3 O 4 @SiO 2 @N 3 The DBCO-modified initiator is coupled by Click reaction, which has high reaction efficiency, high binding strength, good stability after binding, and is not easy to fall off. 3 O 4 @SiO 2 @N 3 It helps to increase the amount of DNA synthesis and expands the scope of application of enzymatic DNA synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The nano-magnetic composite material Fe prepared in step 1 of Example 1 of the present invention 3 O 4 Particle size characterization;

[0044] Figure 2 The nano-magnetic composite material Fe prepared in step 2 of Example 1 of the present invention 3 O 4 @SiO 2 Particle size characterization;

[0045] Figure 3 The nano-magnetic composite material Fe prepared in step 3 of Example 1 of the present invention 3 O 4 @SiO 2 @N 3 Particle size characterization;

[0046] Figure 4 This is the gel image obtained after DNA synthesis using the enzymatic method in Example 3;

[0047] Figure 5 SA magnetic beads and Fe 3 O 4 @SiO 2 @N 3 The test results of the initiator shedding during DNA synthesis using magnetic beads as a stationary phase carrier. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0049] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0050] Example 1. Preparation of stationary phase for DNA synthesis

[0051] Step 1: Fe 3 O 4 Preparation of magnetic beads

[0052] Weigh 1.08 g of ferric chloride hexahydrate and 0.2 g of sodium citrate and evenly disperse them in the solvent, then add 1.2 g of sodium acetate and shake thoroughly to mix; the mixed solution is magnetically stirred for a certain period of time, and reacted at 200°C and 15.5 MPa for 6 hours according to the hydrothermal method. The obtained product is washed several times to obtain magnetic ferroferric oxide nanoparticles. The magnetic ferroferric oxide nanoparticles are tested using a dynamic light scattering nanoparticle size analyzer. The test results are as follows: Figure 1 As shown, it can be seen that the magnetic ferroferric oxide nanoparticles Fe 3 O 4 The average particle size is 361.3 nm and the PI is 0.1516.

[0053] Step 2: Fe 3 O 4 @SiO 2 Preparation of magnetic beads

[0054] Take 0.1 g of the magnetic ferroferric oxide nanoparticles Fe prepared in step 1. 3 O 4 Dispersed in an ethanol aqueous solution, 20 μL of ammonia water was added after 30 minutes and the temperature was raised to 77°C. After the temperature was kept constant, 20 μL of TEOS (tetraethyl orthosilicate) was added for full reaction. After the reaction was complete, the product was washed several times to obtain Fe 3 O 4 @SiO 2Magnetic beads. Fe 3 O 4 @SiO 2 The magnetic beads were tested and the test results were as follows Figure 2 As shown, it can be seen that Fe 3 O 4 @SiO 2 The average particle size of the magnetic beads is 383.8 nm, and the PI is 0.1332.

[0055] Step 3: Fe 3 O 4 @SiO 2 @N 3 Preparation of magnetic beads

[0056] 10% by mass of 3-azidopropyltriethoxysilane was dispersed in an ethanol aqueous solution for hydrolysis to obtain a dispersion of 10% by mass of 3-azidopropyltriethoxysilane. 0.05 g of Fe prepared in step 2 was added to the dispersion. 3 O 4 @SiO 2 The magnetic beads were used for condensation reaction, and the reaction temperature was controlled at 30°C. After 5 h of reaction, the product was washed several times to obtain Fe 3 O 4 @SiO 2 @N 3 Magnetic beads. Fe 3 O 4 @SiO 2 @N 3 The magnetic beads were tested and the test results were as follows Figure 3 As shown, it can be seen that Fe 3 O 4 @SiO 2 @N 3 The average particle size of the magnetic beads is 420.2 nm, and the PI is 0.1025.

[0057] Step 4. Preparation of stationary phase for DNA synthesis

[0058] Take 200 μL of the Fe prepared in step 3 with a concentration of 10 mg / mL. 3 O 4 @SiO 2 @N 3 The magnetic beads were used as the stationary phase carrier, and then 1100 pmol of the initiator was added for binding;

[0059] The structure of the initiator is shown in Formula 1:

[0060] 5'-DBCO-n(a)-dI-n(b)-3' Formula 1;

[0061] In Formula 1, the nucleotide sequence of n(a) is SEQ ID NO: 1, the nucleotide sequence of n(b) is SEQ ID NO: 2, and dI is inosine nucleotide.

[0062] SEQ ID NO: 1:

[0063] 5'-TTTTTTTTTTTTTTTTTTTTTTTTTCACCTGAC-3';

[0064] SEQ ID NO:2:

[0065] 5'-ATGCACTAGGACGACTCGAATT-3'.

[0066] Will include Fe 3 O 4 @SiO 2 @N 3 The mixed system of magnetic beads and the initiator of the structure shown in Formula 1 was reacted at 30°C for 2 h. After the reaction, a stationary phase for DNA synthesis was obtained. The concentration of the primer before and after binding was determined using the Qubit kit, and the binding amount and loading amount were calculated by the difference method. The results are shown in Table 1.

[0067]

[0068] Example 2: Enzymatic Biosynthesis of DNA

[0069] The stationary phase prepared in Example 1 is used to carry out DNA synthesis reaction and deprotection reaction cycle to synthesize the target sequence. Specifically, TdT enzyme and dNTP with protected bases can be used for enzyme reaction, and the protected bases can be eluted with deprotection solution. Multiple cycles can be used to achieve enzymatic synthesis of the target DNA sequence. The synthesis steps are as follows:

[0070] 1. Prepare the reaction system required for enzymatic DNA synthesis, including reaction solution, deprotection solution and cleaning solution. The reaction solution includes TdT enzyme, dNTP with protected bases, 0.25 mM CoCl 2 , 100 mM NaCl and 50 mM phosphate buffer; the deprotection solution is 700 mM sodium nitrite buffer at pH 5; the cleaning solution includes 50 mM potassium phosphate buffer and 100 mM NaCl;

[0071] 2. Place the magnetic beads in the system, add the reaction solution containing the corresponding nucleotide (including TdT enzyme) to react, add the deprotection solution after the reaction is completed and remove the protective group at the 3' end of the synthesis to facilitate the connection of the next nucleotide;

[0072] 3. Wash the magnetic beads 2-3 times with a cleaning solution. After washing, continue to add the reaction solution containing the next nucleotide to react, and repeat the reaction-deprotection group-magnetic bead washing steps in the order of TAGGTATATATGTGCCATGGTGGTTTGTTGCACCCATCAACCCTTCATCTACATTAGGTA to achieve enzymatic synthesis of the target DNA sequence and synthesize the required DNA chain;

[0073] 4. Cut the DNA after synthesis with enzyme, take the supernatant containing DNA for PAGE gel test, and analyze the electrophoresis bands, such as Figure 4 As shown, the DNA lengths obtained from the four parallel experiments were consistent with those of the standard.

[0074] 5. The synthesized DNA was sent for next-generation sequencing. The sequencing results are shown in Table 2. The average yield can reach 69%. According to the formula shown in Formula 2, the average single-step accuracy can reach 99.39%.

[0075] Accuracy = Formula 2.

[0076]

[0077] Comparative Example 1: Streptavidin-modified (SA) magnetic beads as stationary phase for biosynthesizing DNA

[0078] The 5' end of the initiator was modified with biotin to obtain a biotin-modified initiator; the nucleotide sequence of the initiator was 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCACCTGAC / dI / ATGCACTAGGACGACTCGAATT-3', and the same amount of DNA primer chain was added to combine with SA magnetic beads (purchased from Suzhou Beaver Biotechnology Co., Ltd.) as a control of the stationary phase carrier, and then enzymatic DNA synthesis was performed with the same target sequence as the homemade stationary phase carrier in Example 2. The sequencing results are shown in Table 3, and the average synthesis accuracy is 98.93%, and the average yield is 52.74%.

[0079]

[0080] It can be seen from Tables 2 and 3 that, compared with magnetic beads modified with streptavidin (SA), the use of the stationary phase for DNA synthesis provided in Example 1 of the present invention helps to improve the yield and single-step accuracy of DNA enzymatic synthesis.

[0081] Comparative Example 2: Investigation of primer shedding during gene synthesis

[0082] The prepared Fe 3 O 4 @SiO 2 @N 3 Magnetic beads and SA magnetic beads were used as stationary phase carriers to perform primer shedding tests during enzymatic synthesis. The specific steps are as follows: Repeat the synthesis reaction-deprotection group-magnetic bead washing steps in the order of TAGGTATATATGTGCCATGGTGGTTTGTTGCACCCATCAACCCTTCATCTACATTAGGTA. Take 10 μL out of each round of synthesis in the first five rounds and perform PAGE gel test on the supernatant. The test results are as follows: Figure 5 As shown in Figure A, the probe detachment of SA magnetic bead fixed phase, Figure B is the Fe 3 O 4 @SiO 2 @N 3 The probe falls off.

[0083] according to Figure 5 It can be seen that during the DNA synthesis process using SA magnetic beads, there are detached DNA chains in the supernatant, while using Fe 3 O 4 @SiO 2 @N 3 During the DNA synthesis process of magnetic beads, no detached DNA chains were detected in the supernatant, indicating that Fe 3 O 4 @SiO 2 @N 3 The binding strength between the magnetic beads and the initiator is high and it is not easy to fall off the surface of the magnetic beads, which is conducive to the enzymatic synthesis of DNA.

[0084] The present invention uses ferroferric oxide magnetic nanoparticles as the core with excellent physical and chemical properties, and obtains functional magnetic nanoparticles by grafting functional groups on the surface and modifying them, thereby successfully preparing a stationary phase with low cost and good stability. The stationary phase of the present invention can be used to carry out biological DNA synthesis reaction, and the synthesis accuracy and yield are also high.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing a stationary phase for DNA synthesis, characterized in that: include: S1, preparing nano-magnetic ferroferric oxide particles, and coating the surface of the nano-magnetic ferroferric oxide particles with a SiO2 layer to obtain a nano-magnetic composite material Fe3O4@SiO2; S2, modifying the surface of the nano-magnetic composite material Fe3O4@SiO2 with azide groups to obtain a surface-modified nano-magnetic composite material Fe3O4@SiO2@N3; S3, mixing the surface-modified nano-magnetic composite material Fe3O4@SiO2@N3 with an initiator, and loading the initiator onto the surface of the surface-modified nano-magnetic composite material Fe3O4@SiO2@N3 through a Click reaction to obtain the stationary phase for DNA synthesis; The initiator is a single-stranded DNA with a dibenzocyclooctyne group modified at the 5' end, and the 3' end of the single-stranded DNA contains a free hydroxyl group; S2 specifically comprises: mixing the nano-magnetic composite material Fe3O4@SiO2 with a silane coupling agent containing an azide group, modifying the surface of the nano-magnetic composite material Fe3O4@SiO2 with an azide group through a condensation reaction, and obtaining a surface-modified nano-magnetic composite material Fe3O4@SiO2@N3; The silane coupling agent containing an azide group is selected from at least one of 3-(azidopropyl)triethoxysilane, 3-(azidopropyl)trimethoxysilane, and 6-azidosulfonylhexyltriethoxysilane.

2. The preparation method according to claim 1, characterized in that: The mass concentration of the nano-magnetic composite material Fe3O4@SiO2 in the reaction system is 5%-20%; and / or the mass concentration of the silane coupling agent containing an azide group in the reaction system is 10%-30%.

3. The preparation method according to claim 1, characterized in that: The surface-modified nano-magnetic composite material Fe3O4@SiO2@N3 has an average particle size of 100-1000 nm and a PI of less than 0.

2.

4. The preparation method according to claim 1, characterized in that: The initiator also includes a cleavage site.

5. The preparation method according to claim 1, characterized in that: Based on each milligram of the surface-modified nano-magnetic composite material Fe3O4@SiO2@N3, the loading amount of the initiator is 1 pmol-1000 pmol.

6. A stationary phase for DNA synthesis prepared according to the preparation method according to any one of claims 1 to 5.

7. Use of the stationary phase for DNA synthesis according to claim 6 in synthesizing DNA.

8. A method for synthesizing DNA, characterized in that: include: The target DNA is synthesized using an enzymatic method using the stationary phase for DNA synthesis prepared by the preparation method according to any one of claims 1 to 5.

Images