Antibacterial peptide cr19 and use thereof
By providing the antimicrobial peptide CR19 and its homologous peptides, the problems of drug abuse and drug resistance in Salmonella infection are solved, effective antibacterial effects are achieved, and the healthy development of the livestock and poultry farming industry is promoted.
Patent Information
- Application Number
- CN202411989918.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2044-12-31
AI Technical Summary
Existing technologies for treating Salmonella infections have problems of drug abuse, increased drug resistance, and drug residues, and it is urgent to find alternative prevention and control solutions.
Provided are an antimicrobial peptide CR19 and a homologous polypeptide thereof, the amino acid sequence of which is shown in SEQ ID NO.1. The peptide has broad-spectrum antimicrobial activity and is used to inhibit Salmonella. The peptide can be combined with a pharmaceutically active agent to prepare an antimicrobial pharmaceutical composition or mixed with feed components to form a feed composition.
The antimicrobial peptide CR19 effectively inhibits Salmonella at lower concentrations, avoiding the effects of drug resistance. It is used in antimicrobial drugs and feed additives to promote the healthy development of livestock and poultry.
Smart Images

Figure CN119661651B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biotechnology, and in particular relates to an antimicrobial peptide CR19 and an application thereof. Background Art
[0002] Salmonella is the most common zoonotic pathogen in the Enterobacteriaceae family, commonly parasitizing the intestines of animals and humans. Its hosts include humans and various animals, with poultry being the primary animal. Salmonella is a major foodborne bacterium that causes human infection. Food poisoning caused by Salmonella is the most common and widespread of all bacterial food poisonings, accounting for approximately 42.6% to 60% of bacterial food poisoning cases. The most common sources of Salmonella infection include cut fruit, unclean vegetables, and raw food. Raw meat and eggs are particularly important sources of infection.
[0003] Salmonella treatment in China and abroad typically uses antimicrobial drugs to mitigate its harmful effects. However, there is considerable confusion regarding the choice of drug type, route of administration, method, dosage, and duration of administration, leading to a considerable degree of blindness and widespread misuse and waste. Furthermore, long-term, repeated use of these drugs not only increases treatment costs but also leads to a series of problems, including increased bacterial resistance and drug residues in livestock and poultry products. Relying solely on drug control has proven to be an inadequate strategy for preventing and controlling Salmonella. With the current widespread prevalence of broadly drug-resistant Salmonella (such as Indiana, Salmonella Typhimurium, and Kentucky), and the implementation of policies prohibiting and restricting the use of antibiotics, the search for alternative antibiotic prevention and control options is urgent.
[0004] Antimicrobial peptides (AMPs) are small polypeptides composed of multiple amino acids and are an important component of the body's innate immune defense system. Previous studies have shown that AMPs possess broad-spectrum antibacterial, antiviral, antifungal, antiparasitic, and immunomodulatory biological activities. Currently, several AMP-based drugs have entered clinical trials, demonstrating promising application prospects. This present invention aims to provide an AMP that effectively inhibits Salmonella, laying the foundation for the development of novel drugs to prevent and block Salmonella infections. Summary of the Invention
[0005] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.
[0006] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.
[0007] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide an antimicrobial peptide CR19.
[0008] To solve the above technical problems, the present invention provides the following technical solution: the amino acid sequence of the antimicrobial peptide CR19 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.
[0009] Furthermore, the antimicrobial peptide also includes a polypeptide having an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homologous to the polypeptide as shown in SEQ ID NO. 1 and having antimicrobial activity.
[0010] It should be noted that homology in the present invention refers to the "sequence identity" between two amino acid sequences, that is, the percentage of identical amino acids between the sequences. Methods for assessing the degree of sequence identity between amino acids or nucleotides are known to those skilled in the art. For example, amino acid sequence identity is typically measured using sequence analysis software. For example, it can be determined using the BLAST program in the NCBI database.
[0011] The above-mentioned polypeptides have 70%, 75%, 80%, 85%, 90%, 95%, 99% or more (such as 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or more, or even 99.9% or more) homology with the polypeptide shown by the antimicrobial peptide CR19 and have antibacterial activity, and their active sites, active pockets, active mechanisms, polypeptide structures, etc. are most likely the same as those of the antimicrobial peptide CR19.
[0012] Those skilled in the art may also perform conservative substitutions on amino acids according to amino acid substitution rules well known to those skilled in the art, such as the "blosum62 scoring matrix" in the prior art.
[0013] Conservative amino acid substitutions or replacements are well known in the art, for example, conservative amino acid substitutions are preferably substitutions of one amino acid residue for another within one of the following groups (1) - (5): (1) smaller aliphatic nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; (2) residues with polar negative charge and their (uncharged) amides: CL, Asn, Glu, and Gin; (3) residues with polar positive charge: His, Arg, and Lys; (4) larger aliphatic nonpolar residues: Met, Leu, lie, Val, and Cys; and (5) aromatic residues: Phe, Tyr, and Trp. Particularly preferred conservative amino acid substitutions are as follows: Ala for Gly or Ser; Arg for Lys; Asn for Gin or His; CL for Glu; Cys for Ser; Gin for Asn; Glu for CL; Gly for Ala or Pro; His for Asn or Gin; lie for Leu or Val; Leu for lie or Val; Lys for Arg, Gin, or Glu; Met for Leu, Tyr, or lie; Phe for Met, Leu, or Tyr; Ser for Thr; Thr for Ser; Trp for Tyr; Tyr for Trp or Phe; and Val for lie or Leu.
[0014] The method for preparing the antibacterial peptide is not strictly limited in the present application, for example, it can be prepared by artificial synthesis, or the corresponding gene sequence can be screened according to the amino acid sequence by bioinformatics means, and the antibacterial peptide corresponding to the amino acid sequence can be obtained by gene expression.
[0015] The terms "antibacterial peptide", "antibacterial polypeptide", "antibacterial protein", and "antibacterial protein" are synonymous and used herein to refer to a polymer of amino acid residues having an antibacterial, bacteriostatic, or bactericidal function. The term applies to amino acid polymers in which one or more of the amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acid, as well as to naturally and non-naturally occurring amino acid polymers. Unless otherwise indicated, a particular polypeptide sequence is also implicitly understood to encompass conservative modifications of that sequence.
[0016] The term "amino acid" means the twenty common naturally occurring amino acids. Naturally occurring amino acids include alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine (C); glutamic acid (E), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), and valine (V).
[0017] It is another object of the present application to provide an application of the antibacterial peptide CR19 in inhibiting Salmonella.
[0018] As a preferred solution of the application of the antibacterial peptide CR19 in inhibiting Salmonella, wherein: the Salmonella comprises Salmonela enterica, Salmonela bongori;
[0019] The Salmonela enterica comprises S. enterica subsp. enterica, S. enterica subsp. salamae, S. enterica subsp. arizonae, S. enterica subsp. diarizonae, S. enterica subsp. houtenae, S. enterica subsp. indica.
[0020] As a preferred solution of the application of the antibacterial peptide CR19 in inhibiting Salmonella, wherein: the minimum inhibitory concentration of the antibacterial peptide CR19 to S. enterica subsp. enterica is 128 μg / ml; the minimum inhibitory concentration to S. enterica subsp. salamae is 32 μg / ml; the minimum inhibitory concentration to S. enterica subsp. arizonae is 64 μg / ml; the minimum inhibitory concentration to S. enterica subsp. diarizonae is 128 μg / ml; the minimum inhibitory concentration to S. enterica subsp. houtenae is 64 μg / ml; the minimum inhibitory concentration to S. enterica subsp. indica is 64 μg / ml; and the minimum inhibitory concentration to Salmonela bongori is 64 μg / ml.
[0021] It is another object of the present application to provide an antibacterial pharmaceutical composition.
[0022] To solve the above technical problems, the present application provides the following technical solutions: the antibacterial drug composition comprises the antibacterial peptide CR19 or its homologues and a pharmaceutically active agent or other pharmaceutically acceptable excipients.
[0023] Specifically, in some embodiments, when the composition is an antibacterial drug, the composition described herein comprises other components, such as physiologically / pharmaceutically acceptable carriers and excipients, in addition to the antibacterial peptide described above. The purpose of the composition is to facilitate the administration to organisms, facilitate the absorption of active ingredients and thus exert biological activity. In the present disclosure, "composition" and "preparation" are not mutually exclusive.
[0024] As a preferred solution of the antibacterial drug composition of the present application, wherein: the drug is an anti-Salmonella drug.
[0025] As a preferred solution of the antibacterial drug composition of the present application, wherein: the pharmaceutically active agent comprises an antibiotic.
[0026] The types of antibiotics include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.
[0027] Penicillins combined with β-lactamase inhibitors, cephalosporins, such as cefaclor, cefazolin, cefuroxime, lafoxapen, etc.; carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycins; polymyxins; sulfonamides; quinolones; cloramphenical; metronidazole; spectinomycin; trimethoprim; vancomycin, etc.
[0028] The pharmaceutically active agent can also be an anti-mycotic agent, including polyenes, such as amphotericin B, nystatin; 5-flucosyn;
[0029] and azoles, such as miconazol, ketoconazol, itraconazol and fluconazol.
[0030] As a preferred solution of the antibacterial drug composition of the present application, wherein: the dosage form of the antibacterial drug composition comprises an injection solution, preferably a sodium chloride injection solution.
[0031] In some embodiments, when delivering the composition to animals (eg, poultry), a variety of delivery systems are known and can be used to administer the composition. Methods of introduction include, but are not limited to, eye drops, intranasal, and oral routes.
[0032] Another object of the present invention is to provide a feed composition.
[0033] In order to solve the above technical problems, the present invention provides the following technical solution: the feed composition comprises antimicrobial peptide CR19 or its homologues and feed components or other nutritionally acceptable supplementary materials.
[0034] The antimicrobial peptides in the feed composition herein can be used in combination with one or more of the following: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, or a nutritionally active ingredient, specifically, for example, proteins, peptides, sucrose, lactose, sorbitol, glycerol, propylene glycol, sodium chloride, sodium sulfate, sodium acetate, sodium citrate, sodium formate, sodium sorbate, potassium chloride, potassium sulfate, potassium acetate, potassium citrate, potassium formate, potassium acetate, potassium sorbate, magnesium chloride, magnesium sulfate, magnesium acetate, magnesium citrate, magnesium formate, magnesium sorbate, sodium metabisulfite, methylparaben, and propylparaben.
[0035] In some embodiments, the feed composition can be fodder or a premix thereof, or a compound feed or a premix thereof. The feed additive can be mixed with a compound feed, a compound feed component, or mixed into a compound feed premix, or mixed into fodder, a fodder component, or a fodder premix. The feed composition includes the feed component, and the feed component and the antimicrobial peptide together constitute the feed composition.
[0036] In some embodiments, the antimicrobial peptides of the present invention are mixed with a feed component to form a feed. As used herein, "feed component" means all or part of a feed. A portion of a feed can refer to one component of a feed or more than one (e.g., two or three or four or more) components of a feed. In one embodiment, the term "feed component" encompasses a premix or a premix ingredient.
[0037] Any feed described herein may comprise one or more feed materials selected from the group consisting of
[0038] a) Cereals, such as small grain cereals (e.g., wheat, barley, rye, oats, triticale, and combinations thereof) and / or large grain cereals such as maize or sorghum;
[0039] b) by-products from cereals, such as corn gluten meal, wetcake (especially corn-based wetcake), distillers dried grains (DDG) (especially corn-based distillers dried grains (cDDG)), distillers dried grains with solubles (DDGS) (especially corn-based distillers dried grains with solubles (cDDGS)), wheat bran, semolina, wheat short meal, rice bran, rice hulls, oat hulls, palm kernels and citrus pulp;
[0040] c) Proteins obtained from sources such as soy, sunflower, peanut, lupin, pea, bean, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame;
[0041] d) oils and fats of vegetable and animal origin;
[0042] e) Minerals and vitamins.
[0043] Another object of the present invention is to provide a preservative composition.
[0044] In order to solve the above technical problems, the present invention provides the following technical solution: the preservative composition comprises the antimicrobial peptide CR19 or a homologue thereof.
[0045] Beneficial effects of the present invention:
[0046] The antimicrobial peptides of the present invention have strong antibacterial properties and can exert antibacterial effects even at relatively low concentrations. Furthermore, they are unaffected by Salmonella drug resistance and exhibit significant inhibitory effects against Salmonella, effectively preventing and controlling salmonellosis. The preparation of the antimicrobial peptides of the present invention into antimicrobial drugs, feed additives, or feedstuffs is of great significance for the healthy development of the livestock and poultry farming industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:
[0048] Figure 1 This is a high performance liquid chromatography analysis chart of the antimicrobial peptide CR19.
[0049] Figure 2 This is the liquid chromatography-mass spectrometry analysis diagram of the antimicrobial peptide CR19. DETAILED DESCRIPTION
[0050] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.
[0051] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0052] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.
[0053] The amino acid sequence of the antimicrobial peptide CR19 of the present invention is shown in SEQ ID NO.1:
[0054] SEQ ID NO.1: Leu Arg Ser Leu ArgLys Ala Val Ser Gly Gly Phe Gly ArgTrpLeu Lys Gln Gln
[0055] The nucleotide sequence of the antimicrobial peptide CR19 of the present invention is shown in SEQ ID NO.1:
[0056] SEQ ID NO.2:TTGCGTTCGCTCCGGAAAGCCGTGAGTGGCGGCTTTGGAAGGTGGCTGAAGCAACAGTGA
[0057] Among them, G is guanine, A is adenine, T is thymine, and C is cytosine. SEQ ID NO. 2 contains a total of 60 nucleotides, and every three nucleotides can be translated into one amino acid. The TGA position at the end of the sequence is a stop codon. SEQ ID NO. 1 is derived from SEQ ID NO. 2.
[0058] Example 1 Synthesis and characterization of antimicrobial peptides
[0059] Feces of healthy Rugao yellow chickens were collected and the antimicrobial peptide CR19 of the present invention was obtained by metagenomic sequencing screening. The antimicrobial peptide CR19 was chemically synthesized (linear peptide solid phase synthesis) by Shanghai Shenggong Biology according to the sequence SEQ ID NO.1. The results were analyzed by high performance liquid chromatography and liquid chromatography-mass spectrometry. Figure 1 、 Figure 2 And shown in Table 1.
[0060] Table 1
[0061] Peak Ret. Time Area Height Area % Height % 1 14.172 38265 5166 0.165 0.341 2 14.490 310378 30649 1.339 2.024 3 14.726 22675177 1462868 97.847 96.609 4 15.276 105998 9801 0.457 0.647 5 15.742 44186 5737 0.191 0.379 Total 23174003 1514221 100.000 100.000
[0062] Figure 1 The high performance liquid chromatogram for the synthesis of the sequence is shown in Table 1, and the peak information table obtained from the chromatogram is shown in Table 1. The results show that five peaks are detected, the main peak has a retention time of 14.726 minutes, and accounts for 97.847% of the peak area, indicating that the purity of the target polypeptide is high.
[0063] Figure 2 The liquid chromatography-mass spectrometry analysis chart for the synthesis of the sequence is shown in the results. The detected multiple charge ions match well with the theoretical molecular weight, and the measured value is close to the theoretical value, indicating that the target polypeptide of the sample is accurate.
[0064] The above results show that the antibacterial peptide CR19 has been accurately synthesized, and after freeze-drying, it is stored at -80°C for use.
[0065] Example 2 Minimum inhibitory concentration (MIC) detection of antibacterial peptides
[0066] The minimum inhibitory concentrations of different antibacterial peptides were compared, and the sequences of the antibacterial peptides are shown in Table 2.
[0067] Table 2
[0068]
[0069]
[0070] The enteritidis Salmonella ATCC13076 was cultured in MH broth at 37°C to the logarithmic phase, and then the bacterial suspension was diluted to a final concentration of 1 x 10 7 CFU / mL;
[0071] 100 μL of different concentrations of antibacterial peptides shown in Table 1 were mixed with 100 μL of bacterial solution and added to a 96-well plate. After incubation at 37°C for 16 h, the turbidity was observed under light, and the MIC (Minimum Inhibitory Concentration) of different antibacterial peptides was obtained. All experimental groups were set in triplicate, and the final results (MIC) were determined. The results are shown in Table 3.
[0072] Table 3 Minimum inhibitory concentration (MIC) detection of antibacterial peptides
[0073] Antibacterial Peptide MIC Value CR8 512 μg / ml CR17 256 μg / ml CR47 128 μg / ml CR19 64 μg / ml CR46 > 1024 μg / ml
[0074] It can be seen that among the 5 selected antibacterial peptides, 4 have obvious antibacterial effect, and the MIC value of CR19 is 64 μg / ml, which is significantly better than that of other several polypeptides, so CR19 is further analyzed and tested.
[0075] Example 3 In vitro antibacterial detection of antibacterial peptide CR19 on different Salmonella
[0076] The reference strains of different species (subspecies) of Salmonella, ATCC 13076, ATCC 14028, ATCC 43972, ATCC 13314, ATCC 12325, ATCC 43974, ATCC 43976 and ATCC 43975 were selected to test the in vitro antibacterial activity of the antibacterial peptide CR19 on the different species (subspecies) of Salmonella. The results are shown in Table 4.
[0077] Table 4 In vitro antibacterial detection of antibacterial peptide CR19
[0078]
[0079]
[0080] As can be seen from Table 4, the MIC value of CR19 on different species (subspecies) of Salmonella is in the range of 64-128 μg / ml, and the minimum bactericidal concentration MBC value is in the range of 64-256 μg / ml, indicating that CR19 has good antibacterial activity.
[0081] Example 4 Cell hemolysis safety experiment of antibacterial peptide CR19
[0082] The blood of healthy adult chickens was collected and centrifuged at 1500 g for 5 min at 4°C. The obtained red blood cells were washed with PBS solution until colorless and transparent, and then diluted with PBS solution to a red blood cell concentration of 2%. Then an equal volume of antibacterial peptide CR19 (final concentration range in PBS is 0.5-200 μg / mL) was added. After incubation at 37°C for 60 min, the optical absorption value was measured at 570 nm using a microplate reader. Red blood cells treated with 0.1% Triton X-100 and red blood cells treated with an equal volume of PBS were used as positive and negative controls, respectively. Three repeated determinations were set for each treatment group, and the degree of hemolysis was calculated according to the following formula:
[0083] Hemolysis rate (%) = (test tube absorbance - negative control tube absorbance) / (positive control tube absorbance - negative control tube absorbance) x 100%.
[0084] It was found through detection that the cell hemolysis rate was less than 10% in the range of 0.5-200 μg / mL of antibacterial peptide CR19. Even at a concentration of 200 μg / mL, the cell hemolysis rate was only about 8.0%, indicating that the antibacterial peptide CR19 has good safety.
[0085] Example 5 Animal experiment of antibacterial peptide CR19
[0086] In order to verify the application prospect of the antibacterial peptide CR19 in the prevention and treatment of salmonellosis, an injection containing the antibacterial peptide CR19 is prepared in this embodiment, and the injection contains 200 μg / mL of the antibacterial peptide CR19 and sodium chloride (0.9 g / mL) injection.
[0087] Healthy chickens of 21 days old are selected as the research objects, and are randomly divided into a control group (injected with normal saline), a streptomycin group and an antibacterial peptide CR19 group; the injection amount of each group is 500 μL, the concentration of streptomycin is also 200 μg / mL, and the number of each group is 10. After injection, the experimental groups are infected with salmonella, and then the number of survival is counted, and the results are shown in Table 5.
[0088] Table 5: Prevention and treatment effect of the antibacterial peptide CR19 injection
[0089]
[0090]
[0091] As can be seen from Table 5, compared with streptomycin, the antibacterial peptide CR19 can also have a similar prevention and treatment effect, and can be used for clinical prevention and treatment.
[0092] In summary, the antibacterial peptide CR19 and its application are disclosed, the amino acid sequence of the antibacterial peptide CR19 is shown as SEQ ID NO. 1, the antibacterial peptide of the present application has strong antibacterial ability and can have an antibacterial effect at a small concentration. In addition, the antibacterial peptide of the present application is not affected by the drug resistance of salmonella, has obvious inhibition effect on salmonella, and can effectively prevent and control salmonellosis. The antibacterial peptide of the present application is prepared into an antibacterial drug, a feed additive or a feeding material, which has important significance for the healthy development of livestock and poultry breeding industry.
[0093] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application but not limit the present application, although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the technical solutions of the present application, and all should be covered in the scope of the claims of the present application.
Claims
1. Antimicrobial peptide CR19, characterized by: The amino acid sequence of the antimicrobial peptide CR19 is shown in SEQ ID NO. 1, and the nucleotide sequence is shown in SEQ ID NO.
2.
2. Use of the antimicrobial peptide CR19 according to claim 1 in the preparation of a medicament for inhibiting Salmonella, characterized in that: The Salmonella ( Salmonella ) contains Salmonella enterica ( Salmonella enterica ), Salmonella bongori ( Salmonella bongori ); Wherein, the enteric Salmonella comprises enteric Salmonella enterica subspecies ( S. enterica subsp. enterica ), Salmonella enterica subspecies Salamé ( S. enterica subsp. salamae ), Salmonella enterica ssp. arizona ( S. enterica subsp. arizonae ), Salmonella enterica ssp. arizona ( S. enterica subsp. diarizonae ), Salmonella enterica subspecies Houghtonii ( S. enterica subsp. houtenae ), Salmonella enterica subspecies indicus ( S. enterica subsp. indica ).
3. An antibacterial pharmaceutical composition, characterized in that: The invention comprises the antimicrobial peptide CR19 as claimed in claim 1, and a pharmaceutically active agent or other pharmaceutically acceptable excipients.
4. The antibacterial pharmaceutical composition according to claim 3, wherein: The pharmaceutically active agents include antibiotics.
5. The antibacterial pharmaceutical composition according to claim 4, wherein: The dosage form of the antibacterial pharmaceutical composition includes injection.
6. A feed composition, characterized in that: The method comprises the antimicrobial peptide CR19 as claimed in claim 1, and feed components or other nutritionally acceptable supplementary materials.
7. A preservative composition, characterized in that: Comprising the antimicrobial peptide CR19 as claimed in claim 1.
Citation Information
Patent Citations
Antibacterial peptide and application thereof
CN112724202A
Isolated CAS13 protein and use thereof
EP4428232A1