A multicarpel protein from alfalfa and its encoding gene and applications

By cloning the carpel-related gene PCP and its encoded protein from alfalfa, and using gene editing technology to regulate the expression or activity of PCP protein, the problem of regulating the number of carpels in plants was solved, achieving the effect of high-yield and high-quality crop breeding.

CN119661668BActive Publication Date: 2025-10-31CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311215325.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-20
Publication Date
2025-10-31
Estimated Expiration
2043-09-20

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the number of plant carpels, thus affecting crop yield and quality.

Method used

By cloning the multicarpel-related gene PCP and its encoded protein from alfalfa, gene editing technology was used to regulate the expression or activity of the PCP protein, resulting in the cultivation of transgenic plants with increased carpel numbers.

Benefits of technology

It has achieved a significant increase in the number of plant carpels, promoted high-yield and high-quality crop breeding, and has important breeding application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004458766490000011
    Figure HDA0004458766490000011
  • Figure HDA0004458766490000012
    Figure HDA0004458766490000012
  • Figure HDA0004458766490000021
    Figure HDA0004458766490000021
Patent Text Reader

Abstract

This invention discloses a carpel protein from alfalfa, its encoding gene, and its applications. The invention identifies a Tnt1 insertion mutant with increased carpels from an alfalfa Tnt1 insertion mutant library. Through flanking sequence analysis, the controlling gene PCP for this increased carpel phenotype is cloned. To confirm that PCP is the controlling gene for multiple carpels, two other insertion mutants of the PCP gene were back-screened in the mutant library. These two mutants exhibited the same phenotype as the previous mutant. These results demonstrate that the PCP gene in this invention can indeed regulate the number of carpels in plants. This invention is of great significance for the study of floral organ development and evolution, as well as for the cultivation of high-yield and high-quality crops.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a multicarpel protein of alfalfa and its encoding gene and its applications. Background Technology

[0002] The rich biological diversity of plants is reflected in the diversity of floral organ morphology. Flowers are the reproductive organs unique to angiosperms, and their normal development is a crucial step in plant individual development and key to reproduction. Although plant floral organs exhibit a wide variety of forms, their structural composition is highly specific, generally consisting of sepals, petals, stamens, and carpels. The carpel, as a key component in the development of female organs in angiosperms, provides an important site for the development of male and female gametophytes and the formation of fruit after fertilization, playing a vital role in the establishment of yield traits. Therefore, studying the carpel development process is of great significance for breeding high-yield and high-quality crops.

[0003] *Medicago truncatula*, belonging to the Papilionoideae subfamily of the Fabaceae family, has typically bilaterally symmetrical papilionaceous flowers. The mutant library of *Medicago truncatula* contains various types of floral organ mutants. Some mutants exhibit abnormal numbers of floral organs, such as the loss, reduction, or increase of structures like petals, stamens, and carpels; others show incomplete floral organ development, such as inability to open pollen sacs, immature pollen, and incomplete carpel structure, leading to infertility and fruit set. Previous studies have identified many genes that form complex regulatory networks involved in the specialization of floral meristems and the formation of floral organ primordia. According to the "ABCDE" model of floral organ development, the specialization of floral organs requires the coordinated completion of different types of genes. Functional studies of key regulatory genes in the inflorescence and flower development of leguminous plants are crucial for a better understanding of their roles in evolutionary processes. Summary of the Invention

[0004] The purpose of this invention is to provide a protein related to the number of plant carpels and its applications.

[0005] In a first aspect, the present invention protects a protein related to the number of plant carpels, the protein being named PCP, said PCP protein being any of the proteins described below (a1)-(a4):

[0006] (a1) The protein shown in sequence 2 of the sequence listing;

[0007] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0008] (a3) Proteins related to the number of plant carpels obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1);

[0009] (a4) is a protein derived from alfalfa and has more than 98% identity with (a1) and is related to the number of plant carpels.

[0010] In the protein described in (a2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0011] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0012] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences to calculate the identity value (%), the result can be obtained.

[0013] The proteins described in (a1)-(a4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0014] Secondly, the present invention protects nucleic acid molecules encoding PCP proteins.

[0015] The nucleic acid molecule is a DNA molecule as described in (b1) or (b2) below:

[0016] (b1) The DNA molecule shown in sequence 1 or sequence 3 in the sequence listing;

[0017] (b2) A DNA molecule derived from alfalfa and having more than 75% identity with (b1) and encoding the PCP protein.

[0018] Those skilled in the art can readily mutate the nucleotide sequence encoding the PCP protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the PCP nucleotide sequence isolated according to this invention, as long as they encode the PCP protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0019] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0020] Thirdly, the present invention protects expression cassettes, recombinant vectors or recombinant microorganisms containing the above-mentioned nucleic acid molecules.

[0021] The expression cassette refers to DNA capable of expressing the PCP protein in a host cell. This DNA may include not only a promoter to initiate PCP transcription but also a terminator to terminate PCP transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0022] The vector can be a plasmid, granule, bacteriophage, or viral vector. The recombinant vector can be a vector containing a DNA molecule encoding the PCP protein as shown in sequence 1. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0023] The recombinant microorganism may be yeast, bacteria, algae, or fungi containing the above-mentioned nucleic acid molecules, expression cassettes, or recombinant vectors.

[0024] Fourthly, the present invention protects new uses of the above-mentioned PCP protein, nucleic acid molecule, expression cassette, recombinant vector, or recombinant microorganism.

[0025] This invention protects the application of the above-mentioned PCP protein, nucleic acid molecule, expression cassette, recombinant vector, or recombinant microorganism in regulating the number of plant carpels.

[0026] Fifthly, the present invention protects novel uses of substances that inhibit the aforementioned PCP protein.

[0027] This invention protects the use of substances that inhibit the aforementioned PCP protein in increasing the number of carpels in plants or in cultivating transgenic plants with an increased number of carpels.

[0028] The substance that inhibits the above-mentioned PCP protein may be a substance that inhibits or reduces the activity and / or content of PCP protein in plants.

[0029] Furthermore, the substance that inhibits or reduces the activity and / or content of PCP protein in plants may be a substance that inhibits the activity of the PCP protein, a substance that inhibits the expression of the gene encoding the PCP protein, or a substance that knocks out the gene encoding the PCP protein.

[0030] The substance that inhibits the activity of the PCP protein can be any substance that can cause the PCP protein to lose its activity in plants, such as proteins, peptides or small molecule compounds (e.g., protein activity inhibitors) that inhibit the synthesis of the PCP protein, promote the degradation of the PCP protein or inhibit the function of the PCP protein.

[0031] The substance that inhibits the expression of the gene encoding the PCP protein can be any substance that prevents the gene encoding the PCP protein in the plant from being expressed, such as substances that silence the gene encoding the PCP protein in plants (e.g., miRNA, siRNA, dsRNA, shRNA, etc.).

[0032] The substance used to knock out the gene encoding the aforementioned PCP protein can be any substance that prevents the host cell from producing the functional protein product of that gene. Specific methods include removing all or part of the coding gene sequence, introducing frameshift mutations to prevent the production of the functional protein, removing or altering regulatory components (e.g., promoter editing) to prevent transcription of the coding gene sequence, or blocking translation by binding to mRNA. Typically, knockout is performed at the genomic DNA level, ensuring that the cell's offspring permanently carry the knockout.

[0033] Furthermore, the substance that knocks out the gene encoding the PCP protein can be any substance that can cause mutations in the gene encoding the PCP protein in plants (the mutations can be deletion mutations and / or insertion mutations and / or base substitutions) and thus render it inactive, such as the zinc finger protein ZFN gene editing system, the TALENs gene editing system, the CRISPR / Cas9 gene editing system, or the biomutation system, etc.

[0034] Furthermore, the biological mutagenesis system may be a substance for T-DNA insertion, a substance for transposon insertion, or a substance for retrotran insertion.

[0035] In one specific embodiment of the present invention, the substance used for reverse transcripton insertion is a substance used for Tnt1 reverse transcripton insertion.

[0036] Sixthly, the present invention protects a method for cultivating transgenic plants with an increased number of carpels.

[0037] The method for cultivating transgenic plants with increased carpel number protected by this invention includes the step of reducing the content and / or activity of PCP protein in a recipient plant to obtain a transgenic plant; wherein the transgenic plant has a higher number of carpels than the recipient plant.

[0038] Furthermore, the method for reducing the content and / or activity of PCP protein in the recipient plant includes introducing the aforementioned substance for reducing the content and / or activity of PCP protein into the recipient plant.

[0039] Furthermore, the substance that reduces the content and / or activity of PCP protein is a substance used for Tnt1 reverse transcriptase insertion.

[0040] In one specific embodiment of the present invention, the transgenic plant is a homozygous mutant of pcp-1 or a homozygous mutant of pcp-2 or a homozygous mutant of pcp-2.

[0041] The only difference between the pcp-1 homozygous mutant and the wild-type alfalfa R108 genome sequence is the insertion of a Tnt1 sequence between positions 251 and 252 of the PCP gene genome sequence (Sequence 3), as shown in Sequence 4 of the sequence listing.

[0042] The only difference between the pcp-2 homozygous mutant and the wild-type alfalfa R108 genome sequence is the insertion of a Tnt1 sequence between positions 656 and 657 of the PCP gene genome sequence (Sequence 3), as shown in Sequence 4 of the sequence listing.

[0043] The only difference between the pcp-3 homozygous mutant and the wild-type alfalfa R108 genome sequence is the insertion of a Tnt1 sequence between positions 759 and 760 of the PCP gene genome sequence (Sequence 3), as shown in Sequence 4 of the sequence listing.

[0044] In a seventh aspect, the present invention provides a method for preparing a transgenic plant.

[0045] The method for preparing transgenic plants provided by this invention can be any one of c1)-c3) below:

[0046] c1) The DNA molecule shown in sequence 3 in the recipient plant is replaced with DNA molecule A to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule A is the DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 251 and 252 of sequence 3;

[0047] c2) Replace the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule B to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule B is the DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 656 and 657 of sequence 3;

[0048] c3) Replace the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule C to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule C is the DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 759 and 760 of sequence 3.

[0049] All of the above-mentioned substitutions are homozygous substitutions, meaning that the same substitution occurs in homologous chromosomes.

[0050] In any of the above applications or methods, the plant is any one of the following d1)-d5):

[0051] d1) Monocotyledons;

[0052] d2) Dicotyledons;

[0053] d3) Legumes;

[0054] d4) Alfalfa;

[0055] d5) Tribulus terrestris.

[0056] This invention identified a Tnt1 insertion mutant with increased carpels from a library of alfalfa Tnt1 insertion mutants. Flanking sequence analysis revealed the control gene PCP for this increased carpel phenotype. To confirm that PCP is indeed the control gene for multiple carpels, two other insertion mutants of the PCP gene were back-screened in the mutant library. These two mutants exhibited the same phenotype as the previous mutant. These results demonstrate that the PCP gene in this invention can indeed regulate the number of carpels in plants. This invention is of great significance for the study of floral organ development and evolution, as well as for the cultivation of high-yield and high-quality crops. Attached Figure Description

[0057] Figure 1 This document presents a structural diagram of the PCP gene and the detection of PCP gene expression levels in mutants. A shows the PCP gene structure and the Tnt1 retrotransposon insertion sites in three PCP mutants. B shows DNA-level identification of PCP mutants. C shows RT-PCR detection of PCP gene expression levels in wild-type Alfalfa R108 and PCP mutants.

[0058] Figure 2 These are phenotypic diagrams of the floral organs of wild-type Alfalfa R108 and the pcp mutant. A and C are top views of mature flowers of wild-type Alfalfa R108 and the pcp mutant, respectively; B and D are side views of young flowers of wild-type Alfalfa R108 and the pcp mutant, respectively; EI is an anatomical diagram of a mature flower of wild-type Alfalfa R108, with side views of the sepals (E), standard (F), keel and wing petals (G), stamens (H), and carpels (I); JN is an anatomical diagram of a mature flower of the pcp mutant, with side views of the sepals (J), standard (K), keel and wing petals (L), stamens (M), and carpels (N).

[0059] Figure 3 The carpel counts for wild-type Alfalfa R108 and the pcp mutant are presented. Error bars represent standard deviation (n=30), and ** indicates P≤0.01, indicating highly significant differences. Detailed Implementation

[0060] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0062] The wild-type alfalfa R108 described in the following examples is described in the literature "WOX family transcriptional regulators modulate cytokinin homeostasis during leaf blade development in Medicago truncatula and Nicotiana sylvestris".

[0063] Example 1: Obtaining the PCP protein and its encoding gene

[0064] I. RNA Extraction

[0065] RNA was extracted from wild-type Alfalfa R108, and the specific steps are as follows:

[0066] 1. Take about 0.1g of plant material and quickly put it into liquid nitrogen. Grind the sample into powder with liquid nitrogen and immediately add 1mL of Trizol. Shake to mix well. If there is a lot of sample, you can put it on ice first and wait for the next sample.

[0067] 2. Add 200 μL of chloroform, shake well, let stand at room temperature for 2 min, and centrifuge at 4℃ and 12000×g for 10 min.

[0068] 3. Transfer the supernatant to a new 1.5 mL centrifuge tube, add 500 μL of isopropanol, invert to mix well, let stand at room temperature for 5 min, and centrifuge at 4℃ and 12000×g for 15 min.

[0069] 4. Discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 7500×g for 5 min at 4℃, and repeat once.

[0070] 5. Allow to air dry for 2 minutes, then use a pipette tip to remove all ethanol. Allow to dry at room temperature for 10 minutes or blow dry the ethanol in a clean bench.

[0071] 6. Add 30-50 μL of DEPC H2O to dissolve. If the precipitate is large, shake to help dissolve it.

[0072] 7. After the precipitate has completely dissolved, take 1 μL and use a NANO DROP 2000 to detect the concentration and purity of the RNA. Store the remaining RNA at -80℃.

[0073] II. Reverse Transcription

[0074] Using the RNA extracted in step one as a template, cDNA was reverse transcribed using a TRANS kit. The specific steps are as follows:

[0075] Add 5000 ng RNA and 1 μL Primer Oligo (dTs) to a 200 μL centrifuge tube, then add DEPC H2O to a final volume of 8 μL. Mix well and perform the reaction in a PCR instrument under the following conditions: denaturation at 65°C for 5 min, followed by an ice bath for 2 min. After the reaction is complete, add the following components sequentially: 10 μL 2×Ts Uni Reaction Mix, 1 μL RI Enzyme Mix, and 1 μL GDNA Remover. Mix well, incubate at 50°C for 30 min, then at 85°C for 5 s. Store at -20°C for later use.

[0076] III. PCR Amplification

[0077] Using the cDNA obtained in step two as a template, PCR amplification was performed using a primer pair consisting of primers PCP-F and PCP-R to obtain the PCR amplification product. The primer sequences are as follows:

[0078] PCP-F: 5'-ATGGCTTCATCAAATAGACACTG-3';

[0079] PCP-R: 5'-TTACATATTTAAGTCAACAAAGTCA-3'.

[0080] IV. Detection of PCR Amplification Products

[0081] The PCR amplification product obtained in step 3 was ligated into a T vector and then sequenced to obtain the coding region sequence (CDS sequence) of the PCP gene, as shown in sequence 1 of the sequence listing. It encodes the PCP protein shown in sequence 2 of the sequence listing. The PCP protein consists of 458 amino acid residues.

[0082] The CDS sequence of the PCP gene was aligned with the alfalfa website (http: / / blast.jcvi.org / Medicago-Blast / ) to obtain the genomic sequence of the PCP gene, which is shown in sequence 3 of the sequence listing.

[0083] Example 2: Obtaining and phenotypic analysis of the pcp mutant

[0084] This invention identified a Tnt1 insertion mutant with increased carpels from a library of alfalfa Tnt1 insertion mutants. Flanking sequence analysis revealed the control gene PCP for this increased carpel phenotype. To confirm that PCP is indeed the control gene for multiple carpels, two other insertion mutants of the PCP gene were back-screened in the mutant library. These two mutants exhibited the exact same phenotype as the previous mutant, demonstrating that the PCP gene is indeed the control gene for multiple carpels.

[0085] I. Obtaining the pcp mutant

[0086] 1. Obtaining multicarpel mutants

[0087] Three multicarpel mutants were obtained from the *Medicago truncatula* Tnt1 insertion mutant library (medicago-mutant.dasnr.okstate.edu), with mutant numbers NF15814, NF17106, and NF11628. The Tnt1 retropole insertion sites in these three multicarpel mutants are shown below. Figure 1 A.

[0088] 2. Screening for homozygous PCP mutants

[0089] The mutant seeds purchased from the mutant library, numbered NF15814, NF17106, and NF11628, were gently sanded to break the seed coat and then soaked in water for 1-2 days. Once the seed roots appeared, they were planted in the soil. After 3 weeks of growth, genomic DNA was extracted and amplified using gene primers F / R and gene primers F or R with primer LRT on Tnt1. Homozygous mutants were then screened based on the amplification results.

[0090] The amplification primer (F+R / R+6) sequences for mutant NF15814 are as follows:

[0091] Primer F:CTTGCCACAGAACCCCTT;

[0092] Primer R:GCAAACAGATGTTCAGATGTG;

[0093] LRT6:GCTACCAACCAAACCAAGTCAA.

[0094] If Primer F and Primer R do not amplify bands, but Primer R and LRT6 amplify bands, then the mutant is a homozygous mutant numbered NF15814 and is designated as pcp-1.

[0095] The amplification primer (F+R / F+6) sequences for mutant NF11036 are as follows:

[0096] Primer F:AGAAGTCCTGAGCCAAAGC;

[0097] Primer R:GCAAACAGATGTTCAGATGTG;

[0098] LRT6:GCTACCAACCAAACCAAGTCAA.

[0099] If Primer F and Primer R do not amplify bands, but Primer F and LRT6 amplify bands, then the mutant is a homozygous mutant numbered NF11036 and is designated as pcp-2.

[0100] The amplification primer (F+R / R+6) sequences for the mutant numbered NF11628 are as follows:

[0101] Primer F:AGAAGTCCTGAGCCAAAGC

[0102] Primer R:GCAAACAGATGTTCAGATGTG

[0103] LRT6:GCTACCAACCAAACCAAGTCAA

[0104] If Primer F and Primer R do not amplify bands, but Primer R and LRT6 amplify bands, then the mutant is a homozygous mutant numbered NF11628 and is designated as pcp-3.

[0105] The only difference between the pcp-1 homozygous mutant and the wild-type alfalfa R108 genome sequence is the insertion of the Tnt1 sequence between positions 251 and 252 of the PCP gene genome sequence (Sequence 3), as shown in Sequence 4 of the sequence listing.

[0106] The only difference between the pcp-2 homozygous mutant and the wild-type alfalfa R108 genome sequence is the insertion of the Tnt1 sequence between positions 656 and 657 of the PCP gene genome sequence (Sequence 3), as shown in Sequence 4 of the sequence listing.

[0107] The only difference between the pcp-3 homozygous mutant and the wild-type alfalfa R108 genome sequence is the insertion of the Tnt1 sequence between positions 759 and 760 of the PCP gene genome sequence (Sequence 3), as shown in Sequence 4 of the sequence listing.

[0108] II. Molecular Identification of PCP Mutants

[0109] 1. Extraction of genomic DNA

[0110] 1) Take an appropriate amount of plant leaves (wild-type alfalfa R108, pcp-1 homozygous mutant, pcp-2 homozygous mutant and pcp-3 homozygous mutant) into a 2 mL centrifuge tube, add 100 μL CTAB into the centrifuge tube, and then grind the sample into powder at room temperature using a plant tissue homogenizer.

[0111] 2) Add 400 μL of CTAB to the centrifuge tube, mix thoroughly, and incubate at 65°C in a water bath or air bath for 30 minutes, inverting the tube several times during the incubation period.

[0112] 3) After standing to room temperature, add 500 μL of chloroform, mix by inverting the container, and centrifuge at 12000×g for 10 min.

[0113] 4) Pipette 400 μL of supernatant into a 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix by inverting the tube, and centrifuge at 12000 × g for 10 min.

[0114] 5) Discard the supernatant, add 1 mL of 75% ethanol, and centrifuge at 12000×g for 5 min.

[0115] 6) Discard the supernatant, centrifuge at 12000×g for 2 min, remove all ethanol with a pipette tip, air dry the precipitate, and dissolve it with 50μL ddH2O.

[0116] 2. PCR amplification

[0117] Using the genomic DNA obtained in step 1 as a template, PCR amplification was performed using PCP F / R and PCP-F / LRT, respectively. The primer sequences are as follows:

[0118] PCP-F:ATGGCTTCATCAAATAGACACTG;

[0119] PCP-R:TTACATATTTAAGTCAACAAAGTCA;

[0120] LRT6:GCTACCAACCAAACCAAGTCAA;

[0121] LRT31:CTCCTCTCGGGGTCGTGGTT.

[0122] The results are as follows Figure 1 As shown in B, PCP-F / PCP-R amplified bands only in wild-type Alfalfa R108; PCP-F / LRT amplified bands in all three mutants. Compared to wild-type Alfalfa R108, the pcp-1 homozygous mutant amplified a 711 bp fragment using Tnt1-specific primers (LRT31) and PCP gene primers (PCP-F); the pcp-2 homozygous mutant amplified a 1189 bp fragment using Tnt1-specific primers (LRT6) and PCP gene primers (PCP-F); and the pcp-3 homozygous mutant amplified a 1219 bp fragment using Tnt1-specific primers (LRT31) and PCP gene primers (PCP-F).

[0123] III. Detection of PCP mutant expression levels

[0124] Using cDNA from wild-type Alfalfa R108, homozygous mutants of pcp-1, pcp-2, and pcp-3 as templates, PCR amplification was performed using PCP-F / PCP-R primers. Simultaneously, MtActin was used as an internal control gene to detect PCP gene expression. Primer sequences are as follows:

[0125] PCP-F:CTTGCCACAGAACCCCTT;

[0126] PCP-R:GGTCCAGATGCAACCTCA;

[0127] RT-MtActin-F:TCTTACTCTCAAGTACCCCATTGAGC;

[0128] RT-MtActin-R:GTGGGAGTGCATAACCCTCATAGATT.

[0129] The results are as follows Figure 1 As shown in C, compared with wild-type alfalfa R108, the PCP gene was not expressed in the three PCP mutants.

[0130] IV. Phenotypic Analysis of PCP Mutants

[0131] Flower buds of wild-type Alfalfa R108 and three PCP mutants (PCP-1 homozygous mutant, PCP-2 homozygous mutant, and PCP-3 homozygous mutant) with sepals level with petals were collected during the flowering period. The small flower buds were dissected under a stereomicroscope. After making a cut at the base of the flower, the sepals and petals were gently separated using hybridization forceps. The carpels were wrapped in the middle of the stamens. The carpels were carefully separated from the middle part of the stamens. Each organ was photographed and the number of carpels was counted.

[0132] Phenotypic observation such as Figure 2 As shown in the figure, the number of carpels in the PCP mutant is higher than that in the wild-type alfalfa R108. Further statistical analysis of the carpel numbers in wild-type alfalfa R108 and the PCP mutant revealed that the wild-type alfalfa R108 had 1 carpel, the homozygous PCP-1 mutant had 3, the homozygous PCP-2 mutant had 3.1, and the homozygous PCP-3 mutant had 2.5. Compared to wild-type alfalfa R108, the number of carpels in the three PCP mutants was significantly increased. Figure 3 ).

[0133] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of a protein-inhibiting substance in increasing the number of carpels in plants or in cultivating transgenic plants with an increased number of carpels; wherein the protein-inhibiting substance is a substance that knocks out the gene encoding the protein; The protein is any one of the proteins described in (a1)-(a2) below: (a1) The protein shown in sequence 2 of the sequence listing; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The plant in question is alfalfa.

2. The application according to claim 1, characterized in that: The nucleic acid molecule encoding the protein is a DNA molecule as described in (b1) or (b2) below: (b1) The DNA molecule shown in sequence 1 or sequence 3 in the sequence listing; (b2) A DNA molecule derived from alfalfa and having more than 75% identity with (b1) and encoding the protein thereon.

3. A method for cultivating a transgenic plant with an increased number of carpels, comprising the step of reducing the protein content and / or activity in a recipient plant to obtain the transgenic plant; wherein the transgenic plant has a higher number of carpels than the recipient plant; The protein is any one of the proteins described in (a1)-(a2) below: (a1) The protein shown in sequence 2 of the sequence listing; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The plant in question is alfalfa.

4. The method according to claim 3, characterized in that: The method for reducing the content and / or activity of proteins in recipient plants includes the step of introducing a substance that knocks out the gene encoding the protein into the recipient plant.

5. A method for preparing a transgenic plant, wherein the method is any one of c1)-c3) below: c1) The DNA molecule shown in sequence 3 in the recipient plant is replaced with DNA molecule A to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule A is the DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 251 and 252 of sequence 3; c2) Replace the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule B to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule B is the DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 656 and 657 of sequence 3; c3) Replace the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule C to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule C is the DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 759 and 760 of sequence 3; The plant in question is alfalfa.

Citation Information

Patent Citations

  • Plant multi-flag-petal control gene, protein coded by same and application of plant multi-flag-petal control gene

    CN116640772A

  • Mutant gene of medicago truncatula pinna2 gene

    WO2023143185A1