A microfluidic chip for finger-pressure nucleic acid detection and its use method

Abstract

The present invention relates to a microfluidic chip for finger-pressure nucleic acid detection, including a bottom layer, a flow channel layer, a finger-pressure layer and a film layer, wherein the flow channel layer includes a LAMP reaction chamber, a CRISPR reaction chamber, a water storage chamber, a Tesla valve, a finger-pressure chamber, and a test paper reaction chamber, wherein the LAMP reaction chamber includes a LAMP-based nucleic acid extraction-free reaction system, the CRISPR reaction chamber includes a CRISPR-cas12b reaction system, the water storage chamber is mainly used for dilution of the mixed system, and the Tesla valve is used to prevent the two reaction systems from crosstalking; the finger-pressure layer includes a LAMP reaction chamber button and a CRISPR reaction chamber button, and when the LAMP reaction chamber button is pressed, the liquid in the LAMP reaction chamber is pumped to the CRISPR reaction chamber, and when the two buttons are pressed at the same time, the reaction mixture system is pumped to the water storage chamber for mixing, and then further pumped to the test paper reaction chamber. The chip can be widely used in the field of rapid diagnosis of nucleic acid molecules, reduces detection costs, simplifies manual operation and thus improves detection efficiency.

Description

Technical Field

[0001] The present disclosure relates to the technical field of microfluidic chips, and in particular to a microfluidic chip for integrating nucleic acid amplification and detection, and also includes a preparation method, a use method and application thereof. Background Art

[0002] Rapid and reliable pathogen detection is crucial for clinical diagnosis and treatment. It can quickly provide the test results necessary for clinical decision-making, shortening patient wait times and improving diagnosis and treatment efficiency. Simultaneously, it is easy to operate and highly flexible, making it suitable for rapid diagnosis and disease monitoring in a variety of scenarios. It facilitates early detection, diagnosis, and treatment of diseases, significantly improving the convenience of medical services.

[0003] The qPCR method, currently widely used in clinical practice, is highly adaptable and low-cost, but it suffers from long testing times, demanding equipment requirements, and low sensitivity. The qPCR method relies heavily on temperature control and analytical equipment, making the process complex and time-consuming, and requiring specialized personnel to perform complex operations during nucleic acid testing. Traditional nucleic acid testing methods are difficult to use in remote areas and in grassroots hospitals with limited equipment, and testing efficiency needs to be improved urgently.

[0004] Loop-mediated isothermal amplification (LAMP) technology utilizes DNA polymerases with high strand displacement activity to efficiently and specifically amplify target DNA under constant temperature conditions, offering the advantages of rapidity and low cost. However, LAMP is prone to false-positive results caused by primer cross-reactions and exhibits low specificity. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) detection technology utilizes the trans-cleavage activity of Cas proteins, using guide RNA (gRNA) to guide target binding and cleave probes, resulting in fluorescence, enabling rapid and sensitive detection. In recent years, CRISPR / Cas-based biosensor technologies have been used for nucleic acid detection. CRISPR / Cas12b is more thermostable than other CRISPR family members and can be activated by LAMP amplification products, generating a fluorescent signal through nonspecific cleavage of reporter DNA. Therefore, it can mitigate the false-positive signals associated with LAMP.

[0005] Lateral flow immunochromatographic (LFIA) test strips offer multiple advantages, including simple and fast operation, intuitive and readable results, low cost, portability, and wide applicability. With just a drop of sample, the CRISPR single-system test strip (FAM / FITC) automatically completes the test. Combining the lateral flow immunochromatographic method with the LAMP-CRISPR / Cas12b method presents results in a visually readable strip format, eliminating the need for complex equipment or specialized skills, making it suitable for on-site, timely testing. Summary of the Invention

[0006] In response to the above problems, the present disclosure provides a microfluidic chip for finger-press nucleic acid detection, which integrates nucleic acid extraction, amplification, and detection in one microfluidic chip to solve technical problems such as the difficulty of traditional nucleic acid detection in achieving portable and instrument-free on-site rapid detection. The present invention combines LAMP-CRISPR / Cas12b detection technology with a microfluidic chip to simplify the nucleic acid extraction process. The designed press-type microfluidic sensor chip can accurately control the phased flow of internal liquid with a simple finger press, without relying on any external drive device. This design makes it easy for non-professional technicians to get started, and the chip is small in size and has extremely low reagent consumption, effectively reducing the cost of detection.

[0007] The present invention provides a push-type microfluidic chip, a microfluidic device and a bacteria detection method, which are used to solve at least one of the above technical problems.

[0008] The first aspect of the present invention provides a press-type microfluidic chip, comprising: a bottom layer, a flow channel layer, a finger pressure layer and a film layer, wherein the flow channel layer comprises a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), wherein the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) are arranged in parallel, and the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are connected by a microchannel. The LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) respectively have sample injection ports (16), (15) and (14), and the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) respectively have exhaust holes (7) and (9);

[0009] The bottom layer (13) is a sticky plastic bottom film, the flow channel layer (12) is PMMA, the finger pressure layer (11) is an elastic PDMS film with a thickness of 0.5 mm, and the film layer (10) is a PE high-viscosity transparent film with a thickness of 0.05 mm.

[0010] A Tesla valve (5) structure for preventing backflow is provided between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2).

[0011] The test paper reaction chamber (4) is connected to the water storage chamber (3) through a microchannel and is used to place the CRISPR single system detection test strip (FAM / FITC).

[0012] The second aspect of the present invention provides a constant temperature amplification device for nucleic acid detection, comprising: a heating patch (with an average heating temperature of 60°C).

[0013] The third aspect of the present invention provides a method for preparing a microfluidic chip for nucleic acid amplification detection, comprising: a microfluidic chip for finger-pressing nucleic acid detection, wherein the flow channel layer (12) is not limited to polydimethylsiloxane (PDMS) or polymethyl methacrylate (PMMA), and the flow channel layer is injection molded. The material of the finger-pressing layer (11) is not limited to polydimethylsiloxane (PDMS) soft film, silicone film, etc., and can be bonded to the flow channel layer after plasma treatment. The material of the film layer (10) is not limited to silicone film, polyethylene (PE) soft film, etc. The material of the bottom layer (13) is a sticky plastic bottom film. Holes are punched in the film layer (10): sample ports (16), (15) and (14); holes are punched in the film layer (10) and the finger-pressing layer (11): exhaust holes (7) and (9).

[0014] A LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a Tesla valve (5), a LAMP reaction chamber button (6), a CRISPR reaction chamber button (7), and a microchannel are etched on the chip flow channel layer (12). The LAMP reaction chamber, the CRISPR reaction chamber, the water storage chamber (1), (2), and (3) are arranged in parallel; the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6), and the CRISPR reaction chamber button (8) are connected by a microchannel. The flow channel layer is not limited to using polydimethylsiloxane (PDMS) or polymethyl methacrylate (PMMA), and the flow channel layer is injection molded.

[0015] The bottom layer (13) is pasted under the chip flow channel layer (12), the finger pressure layer (11) is bonded to the flow channel layer (12), and covers the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (7), and the film layer (10) is pasted on the top of the chip, covering the flow channel layer (12) and the finger pressure layer (11).

[0016] A fourth aspect of the present invention provides a nucleic acid detection method, which uses the above-mentioned push-type microfluidic chip or the above-mentioned microfluidic device to perform bacterial detection on a sample, comprising: adding a LAMP reaction system and a sample, a CRISPR / Cas12b reaction system, DEPC water, and a CRISPR single system detection test strip (FAM / FITC) to a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), and a test paper reaction chamber (4);

[0017] The LAMP reaction system includes 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

[0018] The CRISPR / Cas12b reaction system includes 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water.

[0019] Nucleic acid testing specifically includes the following steps:

[0020] S1: Use a syringe to pre-inject the LAMP reaction system, CRISPR / Cas12b reaction system and DEPC water into the corresponding injection ports (16), (15) and (14) in the LAMP reaction chamber (1), CRISPR reaction chamber (2) and water storage chamber (3); use a syringe to inject the collected pyrolysis sample into the LAMP reaction chamber (1); place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction for 15 minutes;

[0021] S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes.

[0022] S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4);

[0023] S4: After the reaction is completed, observe the CRISPR single system detection test strip (FAM / FITC) to obtain the detection results.

[0024] Beneficial effects:

[0025] Microfluidic chip technology can integrate all aspects of the experiment on a single chip. Microfluidic chips are highly integrated, small in size, and easy to operate. They can integrate nucleic acid purification and amplification on a single chip, providing a new technical option for on-site instant testing. Compared with traditional laboratory detection methods, microfluidic chip-based detection uses a small amount of sample and requires less manual operation, thus greatly reducing the detection time and sample consumption during the process. The present invention combines LAMP-CRISPR / Cas12b detection technology with microfluidic chips to simplify the nucleic acid extraction process. The designed push-type microfluidic sensor chip can accurately control the phased flow of internal liquid with a simple finger press, without relying on any external drive device. This design makes it easy for non-professional technicians to get started, and the chip is small in size and consumes very little reagents, effectively reducing the cost of detection.

[0026] The present invention achieves sequential fluid release through the Tesla valve. The main feature of this structure is that it has no moving parts and does not require pistons, valve discs or rotating devices, which reduces the possibility of components being corroded or worn and thus damaging their functions, and extends the service life of the system. It is composed of a series of annular or spiral channels, which cause the fluid to generate vortices, thereby producing an effect that hinders reverse flow; the Tesla valve has a small resistance from the LAMP reaction chamber (1) to the CRISPR reaction chamber (2), but has a high resistance in the opposite direction.

[0027] The present invention realizes the automation of the sequential release of fluids through finger-pressing drive. It only takes two presses of the corresponding buttons to mix the reagents and react them respectively, and pump the reaction system into the test paper cavity to predict the results. The second step of pressing the two buttons at the same time can, on the one hand, prevent the system in the CRISPR chamber from flowing back into the LAMP chamber, thereby avoiding the loss of the system. On the other hand, the system can be pumped into the water storage chamber and further into the test paper chamber. While pumping the reagents, liquid crosstalk is prevented, and the reaction operation process is optimized. Finger-driven is portable and does not require external equipment. The detection process has great flexibility and freedom. Users can carry out detection anytime and anywhere, opening up a new way for fast and accurate on-site detection.

[0028] This method performs comparable to qPCR and is expected to be widely used in clinical testing in the future. In a study of 72 throat swab samples suspected of Klebsiella pneumoniae infection, using qPCR as the standard, both sensitivity and specificity were 100%. Compared to qPCR, this method offers the following advantages: 1) Rapidity: The average commercial qPCR test time is approximately 90 minutes, while this method only takes 20 minutes, making it particularly advantageous for testing large numbers of samples and urgent cases. 2) Convenience: qPCR relies on a standard curve, which complicates the diagnostic process. In contrast, this method, combined with finger-operated actuation, requires only injecting the mixed sample into the chip and pressing twice to obtain the result. 3) Low instrumentation requirements: qPCR requires sophisticated thermal cycling equipment, while this method requires only a microfluidic chip, a syringe, and a warming patch, which are inexpensive and readily available. 4) Visualization of test results: This method, combined with lateral flow chromatography test strips, enables visual detection of sample-in and result-out. With its advantages of being fast, simple, and requiring few instruments, this method can provide patients with more timely and accurate treatment options, thereby improving prognosis, reducing the occurrence of complications, and lowering overall medical costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a schematic structural diagram of a microfluidic chip according to an embodiment of the present invention;

[0030] Figure 2 for Figure 1 Schematic diagram of the overall flow channel;

[0031] Figure 3 Figure 2 is a diagram of a chip flow channel test according to an embodiment of the present invention, where a simulates adding reagents to the chip; bc represents pressing the LAMP reaction chamber button to pump the system in the LAMP reaction chamber to the CRISPR reaction chamber; and df represents pressing both the LAMP reaction chamber button and the CRISPR reaction chamber button simultaneously to pump the system in the CRISPR reaction chamber into the water storage chamber and then further to the test paper reaction chamber.

[0032] Figure 4 The clinical test results of the embodiment of the present invention are DETAILED DESCRIPTION

[0033] The present invention will be further described below with reference to the accompanying drawings.

[0034] Example 1

[0035] The press-type microfluidic chip of the present invention comprises: a bottom layer (13), a flow channel layer (12), a finger pressure layer (11) and a film layer (10), wherein the flow channel layer comprises a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), wherein the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) are The LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are arranged in parallel and connected via a microchannel; the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) respectively have a first sample injection port (16), a second sample injection port (15) and a third sample injection port (14), and the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) respectively have a first exhaust hole (7) and a second exhaust hole (9);

[0036] The chip flow channel layer (12) can be made of polymethyl methacrylate (PMMA). The upper surface of the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) is covered with a finger-pressing layer (11), and the finger-pressing layer material is a polydimethylsiloxane (PDMS) soft film, which can be bonded to the flow channel layer (12) after plasma treatment. The material of the film layer (10) is a polyethylene (PE) soft film. The material of the bottom layer (13) is an adhesive plastic bottom film.

[0037] A backflow prevention structure (5) is provided between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2). The backflow prevention structure (5) has a Tesla valve structure. The main feature of this structure is that it has no movable parts and does not require a piston, a valve disc or a rotating device. It is composed of a series of annular channels, which cause the fluid to generate vortices, thereby producing an effect of hindering reverse flow. Therefore, the Tesla valve has a small resistance from the LAMP reaction chamber (1) to the CRISPR reaction chamber (2), but has a high resistance in the opposite direction. Therefore, this structure can effectively prevent the backflow of the fluid. Of course, it can also be a microvalve made of other shapes or materials, as long as it can achieve that when the channel receives reverse pressure, the liquid cannot pass through the microvalve.

[0038] According to the aforementioned method for using the microfluidic chip for nucleic acid amplification detection, the method comprises: adding a LAMP reaction system and a sample, a CRISPR / Cas12b reaction system, DEPC water, and a CRISPR single system detection test strip (FAM / FITC) to the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), and the test paper reaction chamber (4);

[0039] The LAMP reaction system includes 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

[0040] The CRISPR / Cas12b reaction system includes 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water.

[0041] The specific steps for nucleic acid testing are:

[0042] S1: Use a syringe to pre-inject the LAMP reaction system, CRISPR / Cas12b reaction system and DEPC water into the corresponding injection ports (16), (15) and (14) of the LAMP reaction chamber (1), CRISPR reaction chamber (2) and water storage chamber (3); use a syringe to inject the collected pyrolysis sample into the LAMP reaction chamber (1); place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction, and the reaction time is 15 minutes;

[0043] S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes.

[0044] S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4);

[0045] S4: After the reaction is completed, observe the CRISPR single system detection test strip (FAM / FITC) to obtain the detection results.

[0046] We used AutoCAD 2020 to design the structure of the finger-driven microfluidic chip. The chip includes: bottom layer (13), flow channel layer (12), finger pressure layer (11) and thin film layer (10). Figure 1 The schematic diagram of the finger-driven microfluidic chip is shown. The chip is designed to be 80 mm long, 35 mm wide, and 3.5 mm thick. The chip bottom layer (13) is a sticky plastic backing film, the flow channel layer (12) is PMMA, the finger pressure layer (11) is a 0.5 mm thick elastic PDMS film, and the film layer (10) is a 0.05 mm thick PE high-viscosity transparent film.

[0047] The three cylindrical chambers are used to store the LAMP reaction system, the CRISPR reaction system and DEPC water respectively. The diameter of the LAMP reaction chamber (1) is 2.4 mm and the height is 3 mm, the diameter of the CRISPR reaction chamber (2) is 3 mm and the height is 3 mm, and the diameter of the water storage chamber (3) is 5.2 mm and the height is 3 mm. The three cylindrical chambers have a first sample injection port (16), a second sample injection port (15) and a third sample injection port (14), each with a diameter of 1 mm. The two finger-press button chambers are used to pump reagents in stages. The diameter of the LAMP reaction chamber button (6) is 12 mm and the height is 3 mm, and the diameter of the CRISPR reaction chamber button (8) is 15 mm and the height is 3 mm. Above the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8), there are a first exhaust hole 7 and a second exhaust hole 9 with a diameter of 1 mm. The test strip reaction chamber (4) is used to place the CRISPR single system detection test strip (FAM / FITC), with a length of 65 mm, a width of 4 mm, and a height of 3 mm. The other microchannel dimensions are all 0.1 mm × 0.1 mm. To prevent liquid backflow, a Tesla valve structure consisting of 6 Tesla valves is designed between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2).

[0048] The LAMP reaction system, CRISPR reaction system, and DEPC water were pre-packaged in the LAMP reaction chamber (1), CRISPR reaction chamber (2), and water storage chamber (3). The volume of the LAMP reaction system was 10 μL, and its components included 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primers (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3), and DEPC water. The volume of the CRISPR reaction system was 10 μL, and its components included 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+, and DEPC water. The volume of DEPC water was 30 μL.

[0049] The following formula and Figure 3 Liquid flow testing of specific embodiments

[0050] When the flow channel layer is stationary, Figure 3 (a) The liquid shown has no flow.

[0051] The compression and decompression of the flow channel layer (12) are controlled by the deflection of the finger pressure layer (11). The volume dispensed is determined by the compressed volume of the actuation chamber. The volume change of the pressure chamber caused by finger actuation determines the compressed volume of the actuation chamber. Therefore, if the compressed volume of the pressure chamber is equal to or greater than the volume of the actuation chamber, a constant volume of dispensed fluid can be obtained by pushing and releasing the pressure chamber.

[0052] To analyze whether the pressure generated by a fingertip is sufficient to completely compress the actuation chamber, and to what extent the pressure generated by the fingertip can completely compress the actuation chamber, we investigated the force that can be exerted by a fingertip. Generally speaking, the force that a human fingertip can exert ranges from 21N to 60N. Since the compression limit of the actuation chamber is limited, the design of the finger-actuated microfluidic device should ensure that the actuation chamber can be completely compressed with minimal force.

[0053] The driving chamber comprises a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4) and the microchannels connected thereto; the pressure chamber comprises a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8).

[0054] Taking the LAMP reaction chamber button (6) as an example, its diameter is 12 mm and its height is 3 mm. Its area is 113.04 mm 2 When the minimum pressure is 21N, the pressure applied to the pressure chamber is 1834.64 Pa. Assuming that the pressure caused by the finger movement is evenly loaded on the pressure chamber, the maximum deflection of the pressure chamber is w max It can be calculated by the following formula:

[0055]

[0056] Where h is the thickness of the cover plate over the pressure chamber, r is the radius of the pressure chamber, ν is the Poisson's ratio, E is the Young's modulus of the cover plate material, and p is the applied pressure. This equation is only valid for thick circular plates (h / r > 0.1). For h = 3 mm, r = 6 mm, v = 0.5, and E = 1.63 MPa, the maximum deflection of the pressure chamber is calculated to be 1.11 mm. The volume change of the finger-actuated pressure chamber (ΔV) is then calculated using the spherical cap formula:

[0057]

[0058] The results show that the minimum volume change of the pressure chamber driven by a human finger is approximately 63.48 μL. This represents a drive chamber with an operable volume of 63.48 μL. Similarly, when the pressure chamber is pushed, the pressure change in the pneumatic channel (ΔP) can be expressed using the ideal gas law as follows:

[0059]

[0060] In the formula, Vp is the volume of the pressure chamber, Vc is the volume of the pneumatic channel, Vact is the volume of the driving chamber, which should not exceed ΔV, and Pi is the initial pressure. Considering that Vp is 1.36 μL, ΔV is 63.48 μL, Vact is the volume of the driving chamber minus the volume occupied by the original system, which is 3.57 μL, and Vc is 0.45 μL, the ΔP result calculated by substituting it into formula (3) is greater than 0, which indicates that the system in the LAMP reaction chamber (1) can be driven into the CRISPR reaction chamber (2) by pressing the finger. Figure 3 As shown in (b) and 3 (c), the system in the LAMP reaction chamber (1) enters the CRISPR reaction chamber (2).

[0061] The pressure chamber is a LAMP reaction chamber button (6), the driving chamber is a LAMP reaction chamber (1), and the pneumatic channel is a microchannel connecting the LAMP reaction chamber (1) and the CRISPR reaction chamber (2).

[0062] Similarly, by calculating the volume change of the CRISPR reaction chamber button (8), the CRISPR reaction chamber button (8) has r = 7.5 mm, h = 3 mm, ν = 0.5, E = 1.63 MPa, and w is obtained from formula (1): max is 0.87 mm, and when it is substituted into formula (2), we get ΔV = 77.22 μL. Figure 3 As shown in (d), the system in the CRISPR reaction chamber (2) can enter the water storage chamber (3).

[0063] When the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are pressed simultaneously, ΔV is the sum of the volume changes of the two, which is 140.7 μL. Among them, Vp is the sum of the volumes of the two pressure chambers, which is 238.41 μL, Vc is the sum of the volumes of the pneumatic channels, which is 0.48 μL, the volume of the LAMP reaction chamber (1) is about 13.57 μL, the volume of the CRISPR reaction chamber (2) is about 21.20 μL, and the volume of the water storage chamber (3) is about 64.30 μL; the volume of the LAMP reaction system is 10 μL, the volume of the CRISPR reaction system is 10 μL, the volume of DEPC water is 30 μL, and the sample is 1 μL; Vact is the total volume of the driving chamber, which is 49.07 μL. Substituting into formula (3), the calculated ΔP result is greater than 0, which indicates that pressing simultaneously can drive the system in the water storage chamber (3) into the test paper reaction chamber (4). As Figure 3 As shown in (d), 3 (e), and 3 (f), the system in the water storage chamber (3) enters the test paper reaction chamber (4).

[0064] The pressure chamber is a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), the driving chamber is a LAMP reaction chamber (1), a CRISPR reaction chamber (2) and a water storage chamber (3), and the pneumatic channel is a microchannel connecting the LAMP reaction chamber (1) to the test paper reaction chamber (4).

[0065] Example 2

[0066] The chip described in Example 1 is tested for performance using Klebsiella pneumoniae as a target.

[0067] Primer Explorer V4 software was used to design LAMP primers targeting the khe gene of Klebsiella pneumoniae in GenBank. Four specific LAMP primers were designed targeting six regions of the target gene: two outer primers (F3 and B3) and two inner primers (FIP and BIP). FIP consists of a complementary sequence to F1 and a forward sequence to F2. BIP consists of a complementary sequence to Bl and a forward sequence to B2. A gRNA specific for the khe gene was designed near the PAM site (5'-TTN-3') of the LAMP amplification product. The nucleotide sequences are as follows (5'-3'):

[0068] Upstream external primer Khe-F3 (SEQ ID NO. 1):

[0069] ATGCACAGCACAGACGG

[0070] Downstream external primer Khe-B3 (SEQ ID NO. 2):

[0071] CAGGGAAAGTAGTGCCAGTG

[0072] Upstream internal primer Khe-FIP (SEQ ID NO. 3):

[0073] GCACGCAATAGCCACACGCTT-CGCTACGCATACCGGACA

[0074] Downstream internal primer Khe-BIP (SEQ ID NO. 4):

[0075] GTCCCGGGGGCTCCTTTTCGC-ACCGGGCGAGAAACCG

[0076] gRNA (SEQ ID NO. 5):

[0077] GTCTAGAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAGCTTCTCAAATCTGAGAAGTGGCACGCGCTGGCGCTGTTCGTCGC

[0078] ssDNA (SEQ ID NO. 6):

[0079] FAM-TTATTATTAT-BHQ1

[0080] The volume of the LAMP reaction system is 10 μL, and its components include 1× WarmStart® LAMP premix, 1× LAMP fluorescent dye SYTO82, 1× LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

[0081] The CRISPR reaction system is prepared in a 10 μL volume and contains 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1000 U / mL RNase inhibitor, 4 mM Mg 2+ , and DEPC water. The volume of DEPC water is 30 μL.

[0082] The specific steps for nucleic acid testing are as follows:

[0083] S1: Use a syringe to pre-inject 10 μL of LAMP reaction system, 10 μL of CRISPR / Cas12b reaction system and 30 μL of DEPC water into the corresponding injection ports (16), (15) and (14) of the LAMP reaction chamber (1), CRISPR reaction chamber (2) and water storage chamber (3) respectively; use a syringe to inject 1 μL of sample into the LAMP reaction chamber (1); place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction for 15 minutes;

[0084] S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes.

[0085] S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4);

[0086] S4: After the reaction is completed, observe the CRISPR single system detection test strip (FAM / FITC) to obtain the detection results.

[0087] The optimized system was evaluated for sensitivity using a DNA template encoding the Klebsiella pneumoniae khe gene. Target DNA at varying concentrations (5×10³ to 0.5 copies / μL) was loaded onto the chip for detection. Lateral flow chromatography strips revealed visible T lines in samples as low as 2.5 copies / μL. These results indicate that the method has a low density of 2.5 copies / μL ( Figure 4 a).

[0088] The results of this method are visualized using lateral flow chromatography test strips, which is user-friendly and can be performed by non-professionals. Using this method, we detected Klebsiella pneumoniae infection in 72 throat swab samples obtained from patients suspected of Klebsiella pneumoniae infection. In addition, we used qPCR, which is widely used in clinical practice, as a standard to test the precise qualitative ability of the method. Figure 4 As shown in Figures 4a and 4b, this method detected all sputum samples positive for K. pneumoniae by qPCR with a sensitivity of 100% and a specificity of 100%. These results demonstrate that this method performs well in detecting clinical samples.

Claims

1. A method for using a microfluidic chip for finger-pressure nucleic acid detection, characterized in that: The following steps are involved: S1: Use a syringe to pre-inject the LAMP reaction system, CRISPR / Cas12b reaction system and DEPC water into the first injection port (16), the second injection port (15) and the third injection port (14) corresponding to the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3); use a syringe to inject the collected pyrolysis sample into the LAMP reaction chamber (1); place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction, and the reaction time is 15 minutes; S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes. S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4); S4: After the reaction is complete, observe the CRISPR single system detection test strip FAM / FITC to obtain the test results; The microfluidic chip for finger-pressure nucleic acid detection comprises: a bottom layer (13), a flow channel layer (12), a finger-pressure layer (11) and a thin film layer (10), wherein the flow channel layer (12) comprises a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), wherein the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) are arranged in parallel. There are respectively a first sample addition port (16), a second sample addition port (15) and a third sample addition port (14); the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) respectively have a first exhaust hole (7) and a second exhaust hole (9); an anti-backflow structure (5) is provided between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2); the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are connected through a microchannel; A sample addition hole is punched in the film layer (10), communicating with the first sample addition hole (16), the second sample addition hole (15), and the third sample addition hole (14); and an exhaust hole is punched in the film layer (10) and the finger pressure layer (11), communicating with the first exhaust hole (7) and the second exhaust hole (9); The bottom layer (13) is attached to the bottom of the chip flow channel layer (12), the finger pressure layer (11) is bonded to the flow channel layer (12), and covers the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8), and the film layer (10) is attached to the top of the chip flow channel layer (12), covering the flow channel layer (12) and the finger pressure layer (11); The anti-backflow structure (5) is a Tesla valve structure. The Tesla valve has a small resistance from the LAMP reaction chamber (1) to the CRISPR reaction chamber (2), but has a high resistance in the opposite direction. The test paper reaction chamber (4) is connected to the water storage chamber (3) through a microchannel and is used to place the CRISPR single system detection test paper strip FAM / FITC; The LAMP reaction chamber (1) stores a LAMP reaction system; The CRISPR reaction chamber (2) stores a CRISPR / Cas12b reaction system.

2. The method for using the microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The chip flow channel layer (12) is made of polymethyl methacrylate (PMMA) and polydimethylsiloxane (PDMS); the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are covered with a finger pressure layer (11), and the finger pressure layer (11) is made of a polydimethylsiloxane (PDMS) soft film; the film layer (10) is made of a polyethylene (PE) soft film; and the bottom layer (13) is made of a sticky plastic sealing film.

3. The method for using the microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The LAMP reaction system includes 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primers of 1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3 and DEPC water.

4. The method for using the microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The CRISPR / Cas12b reaction system includes 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water.

5. The method for using the microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: Use a heating patch with an average heating temperature of 60°C. When the temperature of the patch becomes constant, stick it on the bottom of the chip.

6. The method for using the microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The flow channel layer (12) is formed by injection molding; the finger pressing layer (11) is bonded to the flow channel layer (12) after being subjected to plasma treatment; A LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a Tesla valve, a LAMP reaction chamber button (6), a CRISPR reaction chamber button (8), and a microchannel are etched on the chip flow channel layer (12). The LAMP reaction chamber (1), the CRISPR reaction chamber (2), and the water storage chamber (3) are juxtaposed in parallel.

Images