Saccharomyces cerevisiae and application thereof in fermentation production of ethanol

Abstract

The present application relates to the technical field of microorganism, and more particularly to a Saccharomyces cerevisiae strain and its application in the fermentation production of ethanol. The strain is a low-temperature-resistant, high-sugar-resistant, ethanol-resistant and low-pH-resistant Saccharomyces cerevisiae strain, which can reach a high fermentation degree in a shorter time under the condition of 10-22 DEG C fermentation of a sugar solution with a concentration greater than 300 g / L, has a fast fermentation speed, a short fermentation period and a lower residual sugar, and effectively solves the problems of low fermentation speed, low fermentation efficiency and high production cost in the existing fermentation alcohol technology.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microorganisms, in particular to a Saccharomyces cerevisiae and application thereof in fermentation of ethanol. BACKGROUND

[0002] Formulated wine is a beverage wine prepared by blending or reprocessing wine base such as fermented wine, distilled wine and edible alcohol with edible raw and auxiliary materials, etc. Formulated wine has low alcohol content and various tastes, and is very popular among young consumers. In recent years, the market size of formulated wine has shown a steady growth trend, and the value of global formulated wine market will reach billions of dollars by 2025. In order to achieve the coordination and stability of taste, formulated wine often needs clean and pure distilled wine to highlight the characteristics of added spices, so as to achieve the purpose of integrating various flavors and achieving harmony. Compared with fruit wine, grape wine, beer and even milk wine, alcohol fermented by sugar water is more suitable for being directly used as base wine of formulated wine, because the flavor is pure and there is no foreign smell, which is not easy to destroy the unique flavor and style of formulated wine or produce unpleasant feeling.

[0003] However, in the current sugar water formulated alcohol technology, low-temperature fermentation alcohol (fermentation temperature <22℃) is needed in European and Russian markets due to climate reasons. In the existing technology for low-temperature fermentation of sugar water alcohol, the sugar water concentration is generally about 150g / L-290g / L, and when the fermentation temperature is less than 22℃, the fermentation time is often more than 72h. Therefore, the existing technology generally has the problems of low fermentation sugar concentration, long fermentation time, incomplete fermentation in a short time, low fermentation alcohol content (generally 14-16%), high residual sugar, low production efficiency, long production time, and greatly increased production cost. Therefore, it is urgent to provide a yeast strain capable of rapidly fermenting high-concentration sugar water under low-temperature conditions to produce high-alcohol content, so as to improve the production efficiency. SUMMARY

[0004] Therefore, the present application provides a Saccharomyces cerevisiae and application thereof in fermentation of ethanol. The strain is low-temperature resistant, high-sugar resistant and low-pH resistant, and can ferment sugar solution with a concentration of more than 300g / L at 10℃-22℃ to achieve high fermentation alcohol content in a shorter time, has the advantages of fast fermentation speed, short cycle and low residual sugar, and solves the problems of slow fermentation speed, low fermentation efficiency, long fermentation cycle and high cost in the prior art of low-temperature fermentation of high-concentration sugar water to produce alcohol.

[0005] The present application provides a Saccharomyces cerevisiae MP-8, which is isolated from certain distiller's grains and has been preserved in China Center for Type Culture Collection on June 14, 2024, with the strain preservation number CCTCC NO: M20241232. The ITS rDNA sequence thereof is shown in SEQ ID NO: 1.

[0006] Experiments show that the strain MP-8 is resistant to low temperature, high sugar, ethanol and low pH, and the strain is used for fermentation of high-concentration sugar solution to produce alcohol, and the fermentation speed is fast, the fermentation period is short, the alcohol degree of fermentation is high, and the production cost is low.

[0007] The application further provides a microbial fermentation agent, which comprises at least one of the following: the Saccharomyces cerevisiae strain MP-8, a culture, a metabolite, an exosome or a fermentation product thereof.

[0008] The microbial fermentation agent has no special limitation in form, and common forms in the art can be used, such as solid preparation, liquid preparation and semi-solid preparation. In specific embodiments of the application, the microbial fermentation agent is a solid agent, i.e., dry yeast of the Saccharomyces cerevisiae strain MP-8.

[0009] The application further provides applications of the Saccharomyces cerevisiae strain MP-8 or the microbial fermentation agent in fermentation production of ethanol or in increasing alcohol degree of a wine product.

[0010] The application further provides a method for fermentation production of ethanol, which comprises: adding the MP-8 or the microbial fermentation agent into a high-sugar solution and performing fermentation.

[0011] In the method, the dry weight of the Saccharomyces cerevisiae strain or the microbial fermentation agent and the mass-volume ratio g / ml of the high-sugar solution are 0.1% to 2%, preferably 0.5% to 1%, and specifically can be 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%.

[0012] In the method, the fermentation is high-sugar fermentation, and the sugar concentration of the high-sugar solution is less than 400 g / L, including but not limited to this concentration. In some specific embodiments of the application, the sugar concentration of the high-sugar solution is 300 to 360 g / L, and specifically can be 300 g / L, 310 g / L, 320 g / L, 330 g / L, 340 g / L, 350 g / L or 360 g / L.

[0013] Further, the fermentation is low-temperature fermentation, and the temperature of the low temperature is 10 to 38℃, preferably 10 to 22℃, and specifically can be 10℃, 11℃, 12℃, 13℃, 14℃, 15℃, 16℃, 17℃, 18℃, 19℃, 20℃, 21℃ or 22℃.

[0014] Further, the fermentation time is ≤120 h, preferably 48 h to 120 h, and specifically can be 48 h, 60 h, 72 h, 84 h, 96 h, 108 h or 120 h.

[0015] In the method, the sugar solution further comprises urea and a fermentation accelerator.

[0016] In some embodiments, the concentration of urea in the aqueous solution is 1 g / L-5 g / L, specifically 1 g / L, 1.5 g / L, 2 g / L, 2.5 g / L (i.e. 2.5 ‰), 3 g / L, 3.5 g / L, 4 g / L, 4.5 g / L, 5 g / L. In the present application, the concentration of the fermentation accelerator is 0.2-0.8 g / L, specifically 0.2 g / L, 0.3 g / L, 0.4 g / L, 0.5 g / L, 0.6 g / L, 0.7 g / L, 0.8 g / L. The present application does not have special restrictions on the specific type of fermentation accelerator, and any commonly used in the art for the fermentation production of ethanol can be used; in the specific embodiments of the present application, the fermentation accelerator is NutrienFast of Angel Yeast Nutrient Products.

[0017] The Saccharomyces cerevisiae strain MP-8 provided by the present application can ferment a sugar solution with a concentration greater than 300 g / L at a temperature of 10-22℃, reach a higher fermentation degree in a shorter time, have a faster fermentation speed, a shorter cycle, and lower residual sugar, and solve the problems of slow fermentation speed, low fermentation efficiency, and high production cost in the prior art of fermenting high-concentration sugar water at low temperature, and is suitable for industrial fermentation production of various wine products.

[0018] Biological preservation instructions

[0019] The Saccharomyces cerevisiae MP-8 was preserved in the China Center for Type Culture Collection on June 14, 2024, at an address of China, Wuhan, Wuhan University, with a preservation number of CCTCC NO: M20241232. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 A preparation process flow chart of dried yeast is shown;

[0021] Figure 2 A process flow chart of the present application for fermentation production of alcohol is shown. DETAILED DESCRIPTION

[0022] The present application provides a Saccharomyces cerevisiae and its application in fermentation production of ethanol. Those skilled in the art can refer to the content herein and make appropriate improvements to the process parameters. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by preferred embodiments, and relevant personnel can obviously make changes or appropriate changes and combinations to the method and application herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0023] The Saccharomyces cerevisiae strain MP-8 provided by the application is preserved in China Center for Type Culture Collection on June 14, 2024, and the strain preservation number is CCTCC NO: M20241232. The ITS rDNA sequence thereof is shown as SEQ ID NO: 1.

[0024] The sequence of SEQ ID NO: 1 is as follows:

[0025] TTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTAC

[0026] TGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAG

[0027] TGCGCGGTCGTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGT

[0028] GAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACA

[0029] ACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGA

[0030] GCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTA

[0031] AATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTA

[0032] AAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCA

[0033] GCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAAT

[0034] CTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTG

[0035] AGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTT

[0036] GGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAA

[0037] GAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAG

[0038] GTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTT

[0039] ATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACC

[0040] TCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGA

[0041] GGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGC

[0042] AAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTG

[0043] GAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGA

[0044] CGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTA

[0045] AAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGT

[0046] GGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACA

[0047] AGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAA

[0048] GTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTT

[0049] TGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCA

[0050] GCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGG

[0051] TAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCG

[0052] ACGTAAGTCAAGGA.

[0053] Another object of the present application is to provide the use of the above-mentioned strain in the fermentation production of ethanol (or alcohol).

[0054] The present application also provides a method for the fermentation production of ethanol using the strain MP-8 of the present application, which comprises adding MP-8 or the microbial fermentation agent to a high-sugar solution and fermenting. The method specifically comprises the following steps:

[0055] Step 1: preparing a high-sugar-concentration sugar solution, adding 2.5‰ (w / v) urea and a fermentation accelerator;

[0056] Step 2: adding a certain amount of dry yeast prepared from the strain MP-8, and thoroughly stirring to completely dissolve the dry yeast;

[0057] Step 3: culturing in a certain temperature incubator, stirring two to three times a day, measuring the specific gravity and sugar content every 24 h, and measuring the fermentation alcohol content after 72 h of fermentation.

[0058] In Step 1, the sugar solution is selected from one of sucrose or glucose, and the fermentation sugar concentration is less than 400 g / L, preferably the sugar concentration is 320 g / L-360 g / L.

[0059] In Step 2, the amount of yeast added is 0.1%-2% by mass / volume content of dry weight to the volume of the fermentation liquid, preferably the amount of yeast added is 0.5%-1%.

[0060] In Step 3, the fermentation temperature is 10℃-38℃, preferably the fermentation temperature is 15-22℃, and the fermentation time is within 120 h, preferably the fermentation time is 72 h.

[0061] The method for preparing dry yeast from the strain MP-8 is not particularly limited in the present application, and any common method in the art can be used. In the examples of the present application, the dry yeast is prepared according to the process shown in the following scheme. Figure 1

[0062] ​The test materials used in the present application are all ordinary commercially available products, which can be purchased in the market.

[0063] The present application is further described below in combination with examples:

[0064] Example 1

[0065] A plurality of yeast strains were isolated from natural wine cellar soil samples in Yibin, Sichuan, and then subjected to initial screening for ethanol tolerance and domestication for high sugar tolerance, and finally a yeast strain capable of tolerating 30% sucrose and 10%-15% ethanol was screened out. The strain was used for low-temperature fermentation of high-concentration sugar water to produce alcohol, and it was found that the strain had a faster fermentation speed and stronger alcohol production capacity. It was identified by molecular biology as a Saccharomyces cerevisiae strain, named MP-8.

[0066] The specific isolation and purification method is as follows: 0.5 g of koji is taken, and sterile water is added for dilution according to the solid-liquid ratio of 1:100, 1:1000, and 1:10000, respectively. 50 μL of the diluent at different concentrations is taken and spread on solid culture medium (sucrose 8%, yeast extract 2%, magnesium sulfate 0.1%, potassium dihydrogen phosphate 0.1%, agar powder 2%, with the addition of 50 μg / ml ampicillin) using a spreader. After incubation in a 30°C incubator for 1-3 days, several white, large and thick, smooth, moist and viscous single colonies are picked and streaked on solid culture medium, and the process is repeated twice to obtain several pure yeast strains. After initial screening for ethanol tolerance and domestication for high sugar tolerance, a strain with strong tolerance is screened out. It was found that the strain had outstanding fermentation performance through low-temperature fermentation of high-concentration sugar water to produce alcohol. It was identified by molecular biology as a Saccharomyces cerevisiae strain, named MP-8.

[0067] The strain MP-8 of the present application and the existing strain were used for low-temperature fermentation of high-sugar solution to produce alcohol, and the fermentation method is shown in the process flowchart Figure 1 , which specifically includes the following steps:

[0068] Step 1: Prepare a high-sugar concentration sugar solution (300 g / L, 340 g / L, 350 g / L, 360 g / L), add 2.5‰ (w / v) urea and fermentation accelerant (Anqi Nutrien Fast, product batch numbers 240523061-1, 240523061-2, 240523061-3 or 240523061-4) to make the urea concentration 2.5 g / L and the fermentation accelerant concentration 0.4 g / L;

[0069] Step 2: Add 0.8%-1% dry yeast (0.1-2 g of dry yeast per 100 ml of sugar solution) to the prepared sugar solution, and mix thoroughly to dissolve the dry yeast completely;

[0070] Step 3: Place in a certain temperature incubator (purchased from Shanghai Yijin Medical Instrument Co., Ltd.) for static culture, the culture temperature is 10℃, static culture, stir twice to three times a day during the period, measure the specific gravity and brix every 24h, measure the fermentation degree, residual sugar and the specific gravity of the fermentation liquor after 72h of fermentation. Among them, the comparative strain 1 is high alcohol yeast with the preservation number CCTCC NO:2023130; the comparative strain 2 is Angel grape wine yeast from the article “Influence of Fermentation Nutrient NutrienFast Addition Time on Grape Wine Fermentation”.

[0071] The sources of the above raw materials and the types of the equipment are shown in Tables 1-2. The residual sugar brix and specific gravity are measured by a densimeter, and the fermentation degree is determined as follows, and the determination results are shown in Tables 3-6.

[0072] Fermentation degree determination method:

[0073] (1) Distillation

[0074] After the fermentation is completed, shake well, take 100mL of the fermentation mash into a 1000mL distillation flask with a 100mL measuring cylinder, add 100-150mL of tap water into the distillation flask, add 2 drops of antifoam agent, and perform distillation. Receive the distillate with a 100mL volumetric flask (with an additional cold water bath to control the distillate temperature below 25℃). When the distillate reaches about 95mL, stop distillation, remove it, and dilute to 100mL, shake well.

[0075] (2) Measure the alcohol content

[0076] Pour all the constant-volume distillate into a clean and dry 100mL measuring cylinder, and let it stand for a few minutes. After the bubbles in the wine disappear, place it in a clean and dry precision alcohol meter, and press it gently again. After standing, observe the scale reading at the tangent to the meniscus, and insert the thermometer to record the temperature. According to the measured temperature and alcohol meter reading, convert the alcohol content at 20℃ to the alcohol content at 20℃ according to the “Alcohol Meter Temperature Concentration Conversion Table” shown in Appendix E of the “Yeast Quality Requirements for Food Processing” of the national standard GBT20886.1-2021bz, and keep the effective digits after the decimal point to 1 digit. Repeat the detection again, and take the higher value of the two times.

[0077] Table 1 Source of ingredients

[0078] Drug name Model / purity Distributor Glucose Food grade National Pharmaceutical Group Chemical Reagent Sucrose Food grade National Pharmaceutical Group Chemical Reagent Urea AR Xilong Chemical Co., Ltd.

[0079] Table 2 Equipment information

[0080] Equipment name Equipment model Distributor Incubator HPX-Ⅱ-300 Shanghai Yijin Medical Instrument Co., Ltd. Portable densimeter DMA35 Anton Paar Multifunctional ice bath distillation instrument Optima-W4 Ou Run

[0081] Table 3 Sugar concentration, specific gravity and fermentation degree under the conditions of initial sugar concentration 300g / L and culture temperature 10℃

[0082]

[0083] Table 4 Sugar content, specific gravity and fermented alcohol degree under the condition of initial sugar concentration 340 g / L and culture temperature 17℃

[0084]

[0085] Table 5 Sugar content, specific gravity and fermented alcohol degree under the condition of initial sugar concentration 350 g / L and culture temperature 20℃

[0086]

[0087] Table 6 Sugar content, specific gravity and fermented alcohol degree under the condition of initial sugar concentration 360 g / L and culture temperature 21℃

[0088]

[0089]

[0090] The results show that, compared with the comparative strains 1-2, under the condition of initial sugar concentration in the range of 300 g / L-360 g / L and fermentation temperature in the range of 10℃-22℃, the strain of the application has higher fermented alcohol degree and lower residual sugar and specific gravity at the same fermentation time of 72 h (i.e. three days of fermentation). It is illustrated that the strain of the application has the advantages of short fermentation time and high efficiency compared with the comparative strains 1-2.

[0091] Example 2

[0092] The difference between the fermentation method of Example 1 and the fermentation method of Example 2 is that the culture temperature is uniformly 20℃, and the fermentation end time of each strain is recorded, and other fermentation conditions and determination methods are the same as those of Example 1. The alcohol degree and residual sugar after fermentation are determined. The results are shown in Tables 7-9.

[0093] Table 7 Fermentation end time, alcohol degree, residual sugar and specific gravity of different strains under the condition of initial sugar concentration 340 g / L and culture temperature 20℃

[0094]

[0095] The results show that the strain of the application is fermented under the condition of initial sugar concentration 340 g / L and culture temperature 20℃, and the fermentation is ended at 72 h, while the comparative strains 1-2 are close to the fermentation end point at 96 h.

[0096] Table 8 Fermentation results of different strains under the condition of initial sugar concentration 350 g / L and culture temperature 20℃

[0097]

[0098]

[0099] As shown in Table 8, the strain of the application is fermented completely in 72h, while the comparative strains 1-2 are not fermented completely even in 120h under the conditions of initial sugar concentration of 350g / L and culture temperature of 20℃. The fermentation end point is determined according to the specific gravity and residual sugar, and generally, the fermentation end point is considered when the specific gravity is lower than 1.0 and the residual sugar is close to 0.

[0100] Table 9 Fermentation results of different strains under the conditions of initial sugar concentration of 360g / L and culture temperature of 20℃

[0101]

[0102] As shown in Table 9, the strain of the application is fermented completely in 72h, while the comparative strains 1-2 are not fermented completely even in 120h.

[0103] The above results show that, under the same fermentation conditions, the strain of the application has higher fermentation degree, shorter fermentation time and lower residual sugar than the comparative strains 1-2, which indicates that the strain of the application has obvious advantages in low-temperature tolerance, sugar tolerance and ethanol tolerance, and is more suitable for low-temperature fermentation of sugar water to produce alcohol.

[0104] Example 3

[0105] The difference between this example and Example 1 is that the initial sugar concentration is 250g / L, the culture temperature is 28℃, and the pH is 3.5. The other fermentation conditions and determination methods are the same as those in Example 1. The fermentation end time of the two strains is recorded, and the residual sugar and alcohol degree after fermentation are determined. The results are shown in the following table.

[0106] Table 10

[0107]

[0108] The above results show that, under the low pH condition, the strain of the application has higher fermentation degree and faster fermentation speed than the comparative strain 1, which indicates that the strain of the application has obvious advantages in low pH tolerance.

[0109] Example 4

[0110] The Saccharomyces cerevisiae with the preservation number CCTCC M20231997 in patent CN117603826 is used as the comparative strain 3. The strain MP-8 of the application and the comparative strain 3 are fermented and cultured for 5-10 days according to the fermentation method of Example 8 in patent CN117603826. The alcohol degree of the simulated grape juice with different sugar content fermented by the strain of the application for 5 days is determined. The determination method is the same as that in Example 1 of the application. The results are shown in Table 10.

[0111] Table 11

[0112]

[0113] The results show that, compared with the comparative strain 3, the alcohol degree of the strain MP-8 of the application is higher, the fermentation time is shorter, the cost is lower, and the economic benefit is higher.

[0114] The above merely is the preferred embodiment of the present application, it should be pointed out that, for the ordinary skilled in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. Saccharomyces cerevisiae strain MP-8, characterized in that, Its accession number is CCTCCNO: M20241232.

2. A microbial fermentation agent, characterized in that, Includes the Saccharomyces cerevisiae strain or culture thereof as described in claim 1.

3. The application of the brewing yeast strain MP-8 according to claim 1 or the microbial fermentation agent according to claim 2 in the fermentation production of ethanol or in increasing the alcohol content of alcoholic beverages.

4. A method for producing ethanol by fermentation, characterized in that, The *Saccharomyces cerevisiae* strain of claim 1 or the microbial fermentation agent of claim 2 is inoculated into a high-sugar solution for fermentation.

5. The method according to claim 4, characterized in that, The dry weight of the brewer's yeast strain or the microbial fermentation agent to the mass-volume ratio of the high-sugar solution (g / ml) is 0.1%~2%.

6. The method according to claim 5, characterized in that, The dry weight of the brewer's yeast strain or the microbial fermentation agent to the mass-volume ratio of the high-sugar solution (g / ml) is 0.5%~1%.

7. The method according to claim 4, characterized in that, The fermentation is a high-sugar fermentation; the sugar concentration of the high-sugar solution is <400g / L.

8. The method according to claim 7, characterized in that, The sugar concentration of the high-sugar solution is 300~360g / L.

9. The method according to claim 4, characterized in that, The fermentation is a low-temperature fermentation, and the low temperature is 10~38℃.

10. The method according to claim 4, characterized in that, The fermentation time is 48-120 hours.

11. The method according to claim 10, characterized in that, The fermentation time is 72 hours.

12. The method according to any one of claims 4 to 11, characterized in that, The high-sugar solution also includes urea and a fermentation promoter.

13. The method according to claim 12, characterized in that, In the high-sugar solution, the concentration of urea is 1 g / L to 5 g / L, and the concentration of fermentation promoter is 0.2 to 0.8 g / L.

Images