Tetracycline degrading bacterium enterococcus faecalis SH01 and application thereof

Abstract

The invention discloses a tetracycline degrading bacterium enterococcus faecalis SH01 and an application thereof. The strain is separated from livestock and poultry manure and is identified as enterococcus faecalis, the highest degradation rate can reach 86.04% under the optimal conditions of TC degradation, namely, the temperature is 29.67 DEG C, the pH value is 7.21, the inoculum size is 1.01%, and the initial concentration of tetracycline is 39.18 mg.L <-1 >, and the strain has high practical value.

Description

Technical Field

[0001] The invention relates to a tetracycline-degrading bacterium Enterococcus faecalis SH01 and application thereof, belonging to the technical field of microorganisms. Background Art

[0002] Tetracycline (TC) is widely used in livestock and poultry farming and aquaculture. Since TC cannot be completely absorbed by animals or humans, the ingested TC is excreted from the body in the form of parent or secondary metabolites with feces and enters the environment. TC pollution not only destroys the ecological balance of the environment, but also exerts selection pressure on microorganisms, induces the production of drug-resistant bacteria and the horizontal transfer of resistance genes, and seriously endangers human life and health. Therefore, it is necessary to take reasonable technical means to control environmental TC pollution.

[0003] Microbial degradation is environmentally friendly and has low application costs. It is a very promising pollutant treatment technology. This method can achieve efficient degradation of pollutants by targeted screening of degradation bacteria, and is currently a research hotspot in TC pollution remediation. Sewage, soil, livestock and poultry manure, etc. can all be used as separation media for TC-degrading bacteria. The screened TC-degrading bacteria are mainly Pseudomonas, Klebsiella, Bacillus and Sphingomonas, etc., and their degradation rate of TC can usually reach more than 70%. Enterococcus faecalis is a type of Gram-positive bacteria widely present in the intestines of animals. It has strong adaptability and resistance to the environment and is harmless to the human and animal bodies. In response to environmental TC pollution, the present invention has isolated a strain of Enterococcus faecalis that can efficiently degrade TC from livestock and poultry manure for the first time. The bacteria can reduce the antibacterial activity of TC degradation products and has certain application prospects for the control of TC pollution. Summary of the invention

[0004] The present invention aims to provide a strain capable of degrading TC and the optimal conditions for degrading TC. The strain is isolated from livestock and poultry feces, identified as Enterococcus faecalis, and named SH01. The strain can degrade tetracycline.

[0005] Therefore, the present invention provides a strain of Enterococcus faecalis, whose deposit number is GDMCC NO:65588.

[0006] The invention provides a method for culturing the enterococcus faecalis, which comprises inoculating the enterococcus faecalis into LB culture medium for culturing.

[0007] Specifically, the culture conditions are as follows: the pH of the culture medium is 6.5-7.5, the culture temperature is 24-26° C., and the rotation speed of the constant temperature shaker is 120-180 rpm.

[0008] The invention provides the use of the Enterococcus faecalis in degrading tetracycline.

[0009] Specifically, the application is for degrading tetracycline pollutants in wastewater.

[0010] The invention provides a method for degrading tetracycline pollutants in wastewater, which comprises adding the enterococcus faecalis into the wastewater to be treated to degrade the tetracycline pollutants.

[0011] Specifically, the treatment temperature is 28-31°C, the pH value is 6.5-8.0, the inoculum volume is 0.5-1.5% (v / v) based on the volume ratio of the inoculum solution to the degradation system, and the tetracycline pollutant in the wastewater is adjusted to 25-45 mg·L -1 .

[0012] Preferably, the treatment temperature is 29-30°C, the pH value is 7.0-7.5, the inoculum volume is 0.8-1.2% (v / v) based on the volume ratio of the inoculum solution to the degradation system, and the tetracycline pollutant in the wastewater is adjusted to 38-41 mg·L -1 .

[0013] Wherein, the inoculation solution is obtained according to the aforementioned culture method.

[0014] The strain SH01 of the present invention can be cultured in LB medium, and the optimal conditions are pH 7, culture temperature 25°C, and the speed of the constant temperature shaker is 150rpm. The optimal conditions for the strain SH01 to degrade TC are temperature 29.67°C, pH 7.21, inoculation amount 1.01% (v / v, inoculation liquid volume / degradation system volume), and TC initial concentration 39.18mg·L -1 The degradation rate was as high as 86.04%. Therefore, the strain SH01 of the present invention has a high practical value.

[0015] Collection information:

[0016] Strain SH01 was deposited with Guangdong Microbiological Culture Collection Center (GDMCC for short, the deposit address is Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, China) on December 6, 2024, with the deposit number GDMCC NO: 65588 and the classification name Enterococcus faecalis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the colony morphology of strain SH01.

[0018] Figure 2 This is a scanning electron micrograph of strain SH01.

[0019] Figure 3This is the phylogenetic tree of strain SH01.

[0020] Figure 4 The effect of temperature on TC degradation by SH01.

[0021] Figure 5 This is the effect of pH on TC degradation by SH01.

[0022] Figure 6 This is the effect of inoculation size on TC degradation by SH01.

[0023] Figure 7 The effect of initial TC concentration on TC degradation by SH01.

[0024] Figure 8 The three-dimensional surface plot (a) and contour plot (b) of the response of the interaction between temperature and pH; the three-dimensional surface plot (c) and contour plot (d) of the response of the interaction between inoculum size and TC concentration.

[0025] Fig. 9 is the inhibition zone diameter of TC degradation products on Escherichia coli. DETAILED DESCRIPTION

[0026] The following is an introduction through the research and development process and specific implementation methods of the present invention, but does not constitute a limitation of the present invention.

[0027] Test materials and reagents

[0028] Tetracycline (TC) was purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). All other chemicals, including peptone, yeast extract powder, NaCl, K2HPO4, KH2PO4, MgSO4·7H2O, agar powder, and PBS buffer, were purchased from Guangzhou Chemical Reagent Factory.

[0029] LB medium: peptone 10 g L -1 , yeast extract powder 5g·L -1 , NaCl 10g·L -1 (Solid culture medium plus 15g·L -1 agar powder).

[0030] Inorganic salt medium (MM): K2HPO4 1.5g·L -1 , KH2PO4 0.5g·L -1 , NaCl 1g·L -1 , MgSO4·7H2O 0.2g·L -1 .

[0031] MM-P: MM medium supplemented with 10 g L -1 Peptone.

[0032] Livestock and poultry feces were obtained from an animal hospital.

[0033] Example 1: Screening, morphological observation and identification of degradation bacteria

[0034] 1. Screening of degradation bacteria

[0035] 1.1 Enrichment culture

[0036] Weigh 10g of fecal sample and add it to a conical flask containing 100mL of sterile water. Place the conical flask in a constant temperature shaker and shake at 150rpm for 30min at 30℃, then let it stand for 10min. Take 10mL of supernatant and add it to a conical flask containing 100mL of LB medium. Add TC solution so that the TC concentration in the medium reaches 20mg·L -1 Wrap the conical flask with tin foil to prevent TC photolysis and culture it in a constant temperature shaker at 30°C and 150rpm for 5 days. After 5 days of culture, take 10mL of culture solution and add it to new LB medium to continue culture. Each time the TC concentration in the LB medium is inoculated, it is increased by 20mg·L -1 , until it reaches 100mg·L -1 Each culture cycle was 5 days.

[0037] 1.2 Separation and purification

[0038] After the enrichment culture was completed, 1 mL of the enrichment culture solution was mixed in 9 mL of sterile water to form 10 -1 Repeat this process until the dilution reaches 10 -7 So far. Select 10 -5 ~10 -7 There are three dilutions in total. Take 100 μL of bacterial solution from each dilution and apply it on a plate containing TC (100 mg·L -1 ) on LB agar plates and cultured at 37°C. After colonies grew, single colonies with different appearances were selected and repeatedly streaked on LB agar plates to isolate and purify single strains.

[0039] 1.3 Determination of TC degradation rate by strains

[0040] Use an inoculation loop to pick up a small amount of purified single colony, inoculate it into LB medium, shake it thoroughly and culture it in a constant temperature shaker at 30℃, 150rpm in the dark for 3 days. Centrifuge the culture solution at 6000rpm for 5min, discard the supernatant, add sterile water and shake to wash the bacterial cells, then centrifuge, repeat twice. Add sterile water again and shake, measure the absorbance of the bacterial solution at 600nm in a visible spectrophotometer, and use OD 600 =1.0 as the standard for preparing the inoculum. Inoculate the inoculum into the MM-P medium (TC concentration is 50 mg·L) at a 5% inoculum volume. -1) and cultured in a constant temperature shaker at 25°C and 150 rpm in the dark for 3 days. After 3 days, samples were taken to determine the removal rate of TC in the culture medium, and strains with TC degradation ability were selected for subsequent experiments.

[0041] 2 Morphological observation of degradation bacteria

[0042] The morphological observation of degrading bacteria includes colony morphology observation and bacterial cell morphology observation.

[0043] The plate streak method was used to observe the morphology of the degrading bacteria colonies. A single colony of the degrading bacteria was picked up with an inoculation loop and streaked on an LB agar plate. The colony morphology of the strain was observed after culturing at 37°C for 24 hours.

[0044] The morphology of the bacterial cells of the degradation bacteria was observed by scanning electron microscopy. After the degradation bacteria were inoculated in LB medium and cultured for 3 days, the culture solution was centrifuged at 6000rpm for 5min, and the supernatant was discarded to obtain the bacterial cell sample. The bacterial cell sample was scanned by electron microscopy according to the following process: ①Fix the sample with 2.5% glutaraldehyde solution; ②Rinse the sample three times with phosphate buffer (0.1M, pH 7.0); ③Fix the sample with 1% osmium acid solution; ④Rinse the sample three times with phosphate buffer (0.1M, pH 7.0); ⑤Dehydrate with gradient concentration (30%, 50%, 70%, 80%, 90%) ethanol solution once each, and treat with 100% ethanol twice; ⑥Critical point drying; ⑦Plating and observation. The final sample was observed using a field emission scanning electron microscope (Thermo Fisher Scientific (USA), model Verios 460).

[0045] 3. Identification of 16S rRNA of Degrading Bacteria

[0046] 16S rRNA sequencing was used to identify the degrading bacteria. The operation process included DNA extraction, PCR amplification and PCR product sequencing.

[0047] The steps of DNA extraction are as follows: ① Add 200μL Buffer ATL and 20μL proteinase K to the grinding tube, add half a spoon of 3mm zirconium beads / one 5mm steel ball (depending on the status of the bacterial plate, bacteria can be added with zirconium beads, fungal hyphae and anaerobic bacteria need to add steel beads), take a single colony from the bacterial plate into the grinding tube, put it on the automatic grinder and grind it at 60hz for 2min; ② Instant centrifugation, add 200μL Buffer AL, and mix thoroughly; ③ In a 70℃ water bath for 15min, shake and mix twice during the period, centrifuge at 12000rpm for 3min after lysis, take 400μL supernatant and transfer to a new deep-well plate, add 300μL Buffer BD and 20μL magnetic beads to the deep-well plate, and put it into the extractor station 2; ④ Take a new extraction plate and dispense 300μL Buffer into each well Place BW1 at station 3 of the extractor, divide the two plates into 75% ethanol at 500 μL / well and place them at station 4 and 5 respectively, divide the elution plate into 100 μL / 80 μL / 60 μL per well (divide the corresponding volume according to the sample status) and place the elution solution at station 6; ⑤ Select the corresponding program, check the instrument status and extraction plate information and run it; ⑥ After the operation is completed, take out the elution plate for DNA concentration and electrophoresis gel detection, and store it at 4°C.

[0048] The composition of the PCR amplification system is shown in Table 1, wherein the upstream primer is 27F (AGAGTTTGATCCTGGCTCAG) and the downstream primer is 1492R (TACGGYTACCTTGTTACGACTT).

[0049] Table 1. PCR amplification system (30 μL)

[0050]

[0051] The PCR amplification program was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 1 min, 30 cycles; 72°C final extension for 5 min. The above operations were completed by Wuhan Tianyi Huayu Gene Technology Co., Ltd.

[0052] The good PCR products whose electrophoresis bands meet the theoretical target size are sent for Sanger sequencing, and the sequencing platform is ABI's 3730xL DNA Analyzer sequencer.

[0053] 4 Experimental results

[0054] Multiple strains were isolated from livestock and poultry feces, and four strains with significantly different appearances were selected. Among them, strain SH01 had the highest degradation rate of TC, which was 58.19%. Therefore, strain SH01 was selected for subsequent experiments.

[0055] The colonies of strain SH01 are milky white, thick, smooth and moist, with neat edges, and single colonies are round ( Figure 1 ); Its bacterial cells are ellipsoidal with a dent in the middle, with a slightly rough surface, and an average size of 0.5×1.0μm ( Figure 2 ).

[0056] The total length of the 16S rRNA sequence of strain SH01 was 1407 bp, which was submitted to the NCBI database for BLAST comparison, and the strain sequences with higher similarity were selected to construct a phylogenetic tree ( Figure 3 ), the results showed that strain SH01 belonged to the genus Enterococcus and clustered with Enterococcus faecalis, so strain SH01 was identified as Enterococcus faecalis. The strain was deposited with Guangdong Microbiological Culture Collection Center on December 6, 2024, with the deposit number GDMCC NO: 65588, and the classification name was Enterococcus faecalis.

[0057] In existing reports, most of the isolated TC-degrading bacteria are Pseudomonas, Klebsiella, Sphingomonas and Bacillus, etc., and there is no report on Enterococcus faecalis degrading TC. The present invention is the first to isolate a strain of Enterococcus faecalis that can degrade TC, enriching the microbial resources for bioremediation of TC pollution.

[0058] Example 2: Study on the degradation performance of strain SH01

[0059] 1 Single factor experiment

[0060] 1.1 Effect of temperature on TC degradation by strains

[0061] Set up four different temperature gradients, 15, 20, 25, and 30°C. Add 20 mL of MM-P medium into a 50 mL conical flask, adjust the pH to 7, and sterilize at 121°C for 20 min. The initial TC concentration is 30 mg·L -1 , add inoculum according to 2% inoculum volume (v / v, inoculum volume / degradation system volume), seal the bottle mouth with a rubber stopper, and wrap the conical flask with tin foil to prevent the influence of light degradation on the experimental results. Place the conical flask in a constant temperature shaker and culture at 15, 20, 25, 30℃, 150rpm for 3 days. Samples are taken at 12, 24, 36, 48, 60, and 72h, respectively, and the samples are stored in a -20℃ refrigerator for testing.

[0062] 1.2 Effect of pH on TC degradation by strains

[0063] Set 6 different pH values, namely 4, 5, 6, 7, 8, and 9. The rest of the operation procedures are shown in 1.1.

[0064] 1.3 Effect of inoculum size on TC degradation by strains

[0065] Set 5 different inoculation volumes, namely 1%, 2%, 3%, 5%, and 9%. The rest of the operation procedures are as in 1.1.

[0066] 1.4 Effect of initial TC concentration on TC degradation by strains

[0067] Five different TC initial concentrations were set, namely 10, 20, 30, 40, and 50 mg·L -1 The rest of the operation process is shown in 1.1.

[0068] Optimization of 2TC degradation conditions

[0069] The response surface methodology was used to explore the optimal conditions for TC degradation by strain SH01. A series of optimization experiments were designed using Design-Expert software. The specific setting parameters are shown in Table 2.

[0070] Table 2. Box-Behnken design of TC degradation by SH01

[0071]

[0072]

[0073] 3 Experimental results

[0074] 3.1 Effects of different degradation conditions on TC degradation by SH01

[0075] The effect of temperature on TC degradation by SH01 is shown in Figure 4 . Within the experimental setting range (15-30℃), the degradation rate of TC by SH01 increased with the increase of temperature. When the culture temperature was 30℃, the degradation rate of TC by SH01 was the highest, which was 84.00%. In addition, when the culture temperature was lower (15℃), SH01 still had a certain degradation effect on TC, with a degradation rate of 65.28%, which may be related to the strong environmental adaptability of Enterococcus faecalis itself.

[0076] The effect of pH on TC degradation by SH01 is shown in Figure 5 When the pH value increased from 4 to 7, the degradation rate of TC by SH01 gradually increased; when the pH value increased from 7 to 9, the degradation rate of TC by SH01 gradually decreased. That is, when the pH value was 7, the degradation rate of TC by SH01 was the highest, which was 69.25%.

[0077] The effect of inoculation amount on TC degradation by SH01 is shown in Figure 6When the inoculation amount increased from 1% to 2%, the degradation rate of TC by SH01 increased slightly; and when the inoculation amount increased from 2% to 5%, the degradation rate of TC by SH01 decreased rapidly. That is, when the inoculation amount was 2%, the degradation rate of TC by SH01 was the highest, which was 66.40%.

[0078] The effect of initial TC concentration on TC degradation by SH01 is shown in Figure 7 As the initial TC concentration increased from 10 mg·L -1 Increase to 40mg·L -1 , the degradation rate of TC by SH01 increased rapidly; when the initial TC concentration increased from 40 to 50 mg·L -1 , the degradation rate of TC by SH01 began to slowly decrease. That is, the initial concentration of TC was 40 mg·L -1 When , the degradation rate of TC by SH01 was the highest, which was 74.30%.

[0079] 3.2 Optimization of TC degradation conditions by strain SH01

[0080] Design-Expert software was used to analyze the mutual influence of degradation conditions such as temperature, pH, inoculation amount and initial TC concentration on SH01 degradation of TC, and the equation of TC degradation model was obtained as follows:

[0081] Y=-115.3301+4.43544A+32.33125B+0.832917B+0.502646D+0.0285AB-0.062833AC+0.003967AD+0.146250BC+0.039812BD-0.019875CD-0.069593A 2 -2.40427B 2 -0.312708C 2 -0.011508D 2

[0082] Where: Y is the predicted TC degradation rate, A, B, C and D are temperature, pH, inoculum size and TC initial concentration respectively.

[0083] Based on this equation, the response surface ( Figure 8 ). The response surface model predicted that within the experimental setting range, the degradation rate of TC by SH01 increased with the increase of temperature and decreased with the increase of inoculum size; with the increase of pH or initial TC concentration, the degradation rate of TC by SH01 showed a trend of first increasing and then decreasing. According to the degradation model prediction, the optimal conditions for strain SH01 to degrade TC were temperature 29.67℃, pH 7.21, inoculum size 1.01% and initial TC concentration 39.18mg·L -1 , the highest degradation rate is 86.04%.

[0084] Previous studies have shown that Trichosporonmycotoxinivorans XPY-10 can degrade TC by 78.28% within 7 days (Huang et al., 2016); Pseudomonas sp. TC952 can degrade 72.8% of TC (50 mg·L) within 6 days. -1 )(Tan et al., 2022); The optimal degradation condition of TC by Klebsiella sp. SQY5 was TC concentration of 61.27 mg·L -1 , temperature 34.96℃, pH 7.17 and inoculation amount 29.89%, the highest degradation rate was 78.78%. Compared with previous studies, it can be seen that the degradation rate of TC by strain SH01 (86.04%) reached a relatively high level.

[0085] Example 3: Antibacterial activity analysis of TC degradation products

[0086] 1 Experimental methods

[0087] The antibacterial activity of TC degradation products was determined by the punch method. 30 mg·L -1 TC, 2% degradation bacteria and 30mg·L -1 TC, 2% degradation bacteria, the final volume of each treatment is 20mL, placed in a constant temperature shaker at 25℃, 150rpm for 72h. Take 2mL of culture solution at 0, 24, 48, and 72h, centrifuge at 6000rpm for 5min, and filter the supernatant with a 0.22μm nylon filter. Punch a hole in the center of the LB agar plate and add 100μL of supernatant to the hole, spread Escherichia coli on the agar plate (Escherichia coliATCC 25922, purchased from Beijing Biobo Biotechnology Co., Ltd.), and measure the inhibition zone diameter of Escherichia coli after culturing at 37℃ for 24h. The size of the inhibition zone diameter of Escherichia coli reflects the antibacterial activity of TC degradation products, and the antibacterial activity is used as a parameter to evaluate the toxicity of TC degradation products.

[0088] 2 Experimental results

[0089] Since the addition of degrading bacteria did not show an inhibitory effect on Escherichia coli, Fig. 9 As shown in Fig. 9 As shown in the figure, when the degradation time reached 72h, the diameter of the inhibition zone in the treatment with TC+SH01 decreased from 14.20mm at 0h to 12.16mm, which was also lower than the diameter of the inhibition zone in the treatment with TC at 72h (15.99mm), indicating that the antibacterial activity of TC degradation products in the treatment with TC+SH01 was reduced, and the biodegradation process of SH01 could reduce the toxicity of TC degradation products.

Claims

1. A strain of Enterococcus faecalis, characterized in that: Its deposit number is GDMCC NO:65588.

2. A method for culturing the Enterococcus faecalis according to claim 1, characterized in that: The cells were inoculated into LB medium and cultured.

3. The method according to claim 2, characterized in that The culture conditions are as follows: the pH of the culture medium is 6.5-7.5, the culture temperature is 24-26°C, and the rotation speed of the constant temperature shaker is 120-180 rpm.

4. Use of the Enterococcus faecalis as claimed in claim 1 in degrading tetracycline.

5. The use according to claim 4, characterized in that The application is to degrade tetracycline pollutants in wastewater.

6. A method for degrading tetracycline pollutants in wastewater, characterized in that: The Enterococcus faecalis as claimed in claim 1 is added to the wastewater to be treated to degrade the tetracycline pollutant.

7. The method according to claim 6, characterized in that The treatment temperature is 28-31°C, the pH value is 6.5-8.0, the inoculum volume is 0.5-1.5% (v / v) based on the volume ratio of the inoculum solution to the degradation system, and the tetracycline pollutant in the wastewater is adjusted to 25-45 mg·L -1 .

8. The method according to claim 6, characterized in that The treatment temperature is 29-30°C, the pH value is 7.0-7.5, the inoculum volume is 0.8-1.2% (v / v) based on the volume ratio of the inoculum solution to the degradation system, and the tetracycline pollutant in the wastewater is adjusted to 38-41 mg·L -1 .

9. The method according to claim 7 or 8, characterized in that The inoculum is obtained according to the culture method as claimed in claim 2 or 3.

Images