Method for preparing protoplast from polygonatum sibiricum leaves
By preparing and transforming Polygonatum, the technical problems in the genetic transformation research of Polygonatum were solved, the subcellular localization of Polygonatum gene was achieved, and technical support was provided for the study of the medicinal value of Polygonatum.
Patent Information
- Application Number
- CN202411771961.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-04
- Publication Date
- 2025-03-21
AI Technical Summary
There is currently a lack of research on the isolation and transient transformation of Polygonatum, and it is unknown whether the genetic transformation of Polygonatum from model plants and key crops can be used for the genetic transformation of Polygonatum.
Protoplasts were prepared by soaking the leaves of Polygonatum in mannitol solution and enzymatically using a specific proportion of enzymatic solution under dark conditions. Then, transient transformation was performed using CaCl2, PEG and mannitol solutions, and the recombinant plasmid pHBT-GFP-NOS-PcAP2C was used as the test plasmid.
The Polygonatum protoplast was successfully prepared and a transient transformation system was established to realize the subcellular localization of the Polygonatum gene PcAP2C, providing a fast and effective method for subsequent verification of the subcellular localization of other Polygonatum target genes.
Smart Images
Figure CN119662515A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a method for preparing protoplasts by using polygonatum sibiricum leaves, and belongs to the field of plant cell engineering. Background Art
[0002] Plant protoplasts are plant single cells without cell walls and are only wrapped by plasma membranes. Plant protoplasts can absorb foreign DNA more effectively due to the lack of cell wall restrictions, which makes them an ideal platform for cell-level genetic transformation. In the process of separating plant protoplasts, two main methods are widely used: mechanical method and enzymatic method. Although the mechanical method is fast, it is inefficient and requires extremely high operating skills. It can only be successful when the cell vacuole degree is high, so it is more limited. The enzymatic method has become a more advantageous choice due to its simple operation, high protoplast acquisition rate and strong vitality. It is applicable to almost all plant tissues, so it has been widely used in protoplast separation research. The transient transformation protoplast technology of exogenous genes mainly includes polyethylene glycol (PEG)-mediated transformation method, electroporation transformation method, liposome-mediated transformation method and microinjection method. Among these methods, the PEG-mediated method is favored due to its simple operation, low cost, small cell damage and no reliance on complex instruments and equipment. At present, the research on plant protoplasts has made relatively mature progress in a variety of model plants and key crops such as Arabidopsis, tobacco, wheat, rice, corn and poplar.
[0003] Polygonatum kingianum is a perennial shade-loving plant of the genus Polygonatum in the family Asparagaceae. It has the advantages of being both a medicine and food and not occupying farmland. The rhizome of the genus Polygonatum does not contain starch, but is rich in nutrients and functional ingredients such as non-starch polysaccharides, oligosaccharides, saponins, flavonoids, and has important medicinal value. However, there is a lack of research on the isolation and transient transformation of protoplasts of Polygonatum. Moreover, it is unknown whether the above-mentioned model plants and key crop protoplasts can be used for the genetic transformation of Polygonatum. Therefore, how to prepare protoplasts of Polygonatum and establish a transient transformation system is of vital importance for studying the genetic transformation of Polygonatum and even further exploring the medicinal value of Polygonatum. Summary of the invention
[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides a method for preparing protoplasts using Polygonatum sibiricum leaves, aiming to solve the technical problems of whether the current model plants and key crop protoplasts can be used for the genetic transformation of Polygonatum sibiricum, as well as how to prepare Polygonatum sibiricum protoplasts and establish an instantaneous transformation system.
[0005] The first technical solution provided by the present invention is a method for preparing protoplasts of Polygonatum cyrtonema leaves, comprising the following steps:
[0006] S1, soak the leaves of Polygonatum cyrtonema in mannitol solution;
[0007] S2, placing the leaves soaked in step S1 on a shaker, and performing enzymatic hydrolysis with an enzymatic solution in the dark to prepare protoplasts;
[0008] The enzymatic hydrolysate includes 1.5 m / v% of cellulase RS, 0.4 m / v% of macerate R and 0.4 m / v% of pectinase. Specifically, m / v% means that 1 g of enzyme solid is dissolved in 100 mL of water.
[0009] In certain embodiments, the Polygonatum cyrtonema leaves are selected from leaves of new branches sprouting from rhizomes or 1-3 leaves below the top leaves to be expanded.
[0010] In certain embodiments, in step S1, the main veins of the Polygonatum cyrtonema leaves are removed and the leaves are cut into thin strips of 0.5-1 mm and then soaked.
[0011] In certain embodiments, in step S1, the concentration of the mannitol solution is 0.6 M, and the soaking time is 20-30 min.
[0012] In certain embodiments, in step S2, the ratio of the enzymatic hydrolysis solution to the leaves is such that 3-4 g of leaves can be enzymatically hydrolyzed per 10 mL of the enzymatic hydrolysis solution.
[0013] In certain embodiments, in step S2, the preparation method of the enzymatic hydrolysate is as follows: 1.5 m / v% cellulase RS, 0.4 m / v% macerator R, 0.4% m / v pectinase and 0.4 M D-mannitol are dissolved in 20 mmol / L MES buffer (pH = 5.8) containing 20 mmol / L KCl, heated in a 55°C water bath for 10 min, and after the enzymatic hydrolysate is cooled to room temperature, a final concentration of 10 mmol / L CaCl2, 5 μmol / L β-mercaptoethanol and 1 g / L BSA (bovine serum albumin) are added, and the volume is fixed with water.
[0014] In certain embodiments, in step S2, the shaking speed is 25-40 rpm.
[0015] In certain embodiments, in step S2, the enzymatic hydrolysis time is 2.5-4 h, preferably, the enzymatic hydrolysis time is 3.5 h.
[0016] The second technical solution provided by the present invention is a protoplast of Polygonatum cyrtonema leaf prepared by the method described in the first technical solution.
[0017] The third technical solution provided by the present invention is a method for instantaneous transformation of protoplasts from Polygonatum cyrtonema leaves, comprising the following steps:
[0018] (1) adding the protoplasts of Polygonatum cyrtonema leaves described in the second technical solution to a mixture of CaCl2, PEG, and 0.4 M mannitol solution;
[0019] (2) adding the test plasmid to step (1);
[0020] (3) Allow the transformation to stand in the dark for 30 min.
[0021] In certain embodiments, Ca 2+ The concentration is 0.1-0.6 mol / L, the test plasmid concentration is 1-4 μg / μL, and the PEG concentration is 40%-50%.
[0022] In certain embodiments, Ca 2+ The concentration was 0.6 mol / L, the test plasmid concentration was 4 μg / μL, and the PEG concentration was 40%.
[0023] In certain embodiments, the conversion time is 10 to 45 minutes, preferably, the conversion time is 30 minutes.
[0024] In certain embodiments, the test plasmid uses pHBT-GFP-NOS as an expression vector.
[0025] In certain embodiments, the test plasmid is the recombinant plasmid pHBT-GFP-NOS-PcAP2C.
[0026] Further, the preparation method of the recombinant plasmid pHBT-GFP-NOS-PcAP2C is as follows:
[0027] (1) Extract RNA from rhizomes of Polygonatum cyrtonema and reverse transcribe it into cDNA;
[0028] (2) Using the genomic DNA of Polygonatum cyrtonema as a template, the following specific primers containing the PcAP2C sequence that can be used for seamless cloning (underlined) were designed:
[0029] PcAP2C F:
[0030] TCAAGCTTCGAATTCTGCAGATGGAAGATGGCACAAGCTC
[0031] PcAP2C R:
[0032] CCTCGCCCTTGCTCACCATGttCAACAAAGGATCCCATAAACTTC
[0033] (3) PCR amplification was performed using S4 enzyme in a 20 μl reaction system;
[0034] (4) The amplified product was subjected to agarose electrophoresis and then cut and recovered according to the size of the target band, thereby obtaining a 609 bp DNA fragment containing the Polygonatum cyrtonema PcAP2C gene.
[0035] (5) The pHBT-GFP-NOS vector was double-digested with SalI and BamHI to recover the 4259 bp vector backbone fragment.
[0036] (6) The fragments PcAP2C and pHBT-GFP-NOS were connected by seamless cloning to obtain the recombinant plasmid pHBT-GFP-NOS-PcAP2C.
[0037] In certain embodiments, in step (3), the reaction procedure of the PCR amplification step is: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, 35 cycles, and final extension at 72°C for 10 min.
[0038] In certain embodiments, the nucleotide sequence of the endogenous PcAP2C gene containing a nuclear localization signal in Polygonatum cyrtonema of the present invention is as shown in SEQ ID NO.1, and the above-mentioned Polygonatum cyrtonema PcAP2C gene expression sequence is derived from Polygonatum cyrtonema.
[0039] The fourth technical solution provided by the present invention is a Polygonatum sibiricum PcAP2C gene, and the nucleotide sequence of the Polygonatum sibiricum PcAP2C gene is shown in SEQ ID NO.1.
[0040] The fifth technical solution provided by the present invention is a recombinant vector carrying the gene described in the fourth technical solution.
[0041] Specifically, the recombinant vector uses pHBT-GFP-NOS as an expression vector.
[0042] The sixth technical solution provided by the present invention is a recombinant cell containing the gene described in the fourth technical solution, or transformed with the expression vector described in the fifth technical solution.
[0043] In certain embodiments, the recombinant cell uses the Polygonatum cyrtonema leaf protoplasts described in the second technical solution as a host cell.
[0044] The technical effects of the present invention are as follows:
[0045] The present invention screens out the most suitable factors for separating polygonatum protoplasts by adjusting factors such as enzyme types and ratios, enzymolysis time, etc. The present invention firstly clones the gene PcAP2C containing the endogenous nuclear localization signal of polygonatum to form a recombinant plasmid pHBT-GFP-NOS-PcAP2C as a test plasmid, and adjusts the concentration of PEG solution, Ca 2+ The optimal factors for efficient transformation of Polygonatum sibiricum protoplasts were screened out by adjusting factors such as concentration, ratio and test plasmid concentration; subcellular localization in Polygonatum sibiricum protoplasts was achieved by cloning and constructing an expression vector of the Polygonatum sibiricum gene PcAP2C containing a nuclear localization signal, providing a rapid and effective method for subsequent verification of the subcellular localization results of other Polygonatum sibiricum target genes. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 This is a plant diagram of the most suitable leaves selected for the present invention.
[0047] Figure 2 This is the most suitable blade selection diagram of the present invention.
[0048] Figure 3 FIG. 1 is a diagram of soaking the sliced leaves of the present invention in mannitol.
[0049] Figure 4 This is a picture of protoplasts obtained by enzymatic hydrolysis of leaves at the just-expanding stage.
[0050] Figure 5 This is a diagram of protoplasts obtained by enzymatic hydrolysis of leaves in the expansion stage of the top leaves.
[0051] Figure 6 This is a diagram of protoplasts obtained by enzymatic hydrolysis of the top leaf in the unexpanded stage.
[0052] Figure 7 This is a map of the pHBT-GFP-NOS-PcAP2C vector of the present invention.
[0053] Figure 8 This is a protoplast diagram after being placed for 13 hours after transformation of the present invention.
[0054] Fig. 9 The fluorescence image (Ca) of the protoplasts after 13h transformation of the present invention is shown in FIG. 2+ concentration (0.6 mol / L), plasmid concentration (4 ug / L), PEG concentration (40%)).
[0055] Fig.10 This is the protoplast subcellular localization map of the present invention. DETAILED DESCRIPTION
[0056] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.
[0057] Test method:
[0058] 1. Cell number: Use a blood cell counting plate to count the number of protoplasts. Pipette 10 μl of the suspended protoplasts on the edge of one side of the cover glass, and let it penetrate into the counting chamber along the gap between the cover glass and the counting plate until the entire counting chamber is filled with suspension. Count the protoplast yield. Protoplast yield (pieces / g) = protoplast density (pieces / ml) × total volume of protoplast suspension (ml) / fresh weight of material (g).
[0059] 2. Cell transformation efficiency: The proportion of fluorescent cells under a fluorescence microscope is the transfection efficiency, and three fields of view are taken for counting.
[0060] 3. Subcellular localization: Observe the green excitation light position of cells under the irradiation of 488nm emission light under confocal fluorescence microscope.
[0061] The raw materials used in the embodiment:
[0062] 1. Cellulase RS was purchased from Yakult (Japan); the enzyme activity was 16000 U / g.
[0063] 2. Morpholineethanesulfonic acid (MES) and macrozyme R-10 were purchased from Coollebo; the enzyme activity was 3000 U / g.
[0064] 3. Pectinase Y-23 was purchased from Yuanye Biotechnology; the enzyme activity was 300,000 U / g.
[0065] 4. Mannitol was purchased from Sigma (USA); polyethylene glycol 4000 (PEG4000) was purchased from MCE (USA).
[0066] 5. Plasmid pHBT-GFP-NOS and Escherichia coli DH5α are commercial plasmids and strains.
[0067] 6. LB liquid medium: 10g / L peptone, 10g / L sodium chloride, 5g / L yeast powder.
[0068] Example 1 Preparation of Polygonatum cyrtonema Leaf Protoplasts
[0069] The steps include:
[0070] (1) Select leaves at different growth stages and locations as shown in Table 1 (plants and leaves such as Figure 1 , 2 As shown), the leaves are required to be strong, tender and of moderate size;
[0071] (2) Remove the main veins from the leaves, cut them into 0.5-1 mm thin strips with a blade, transfer them to 0.6 M mannitol solution and soak for 20-30 min (such as Figure 3 shown).
[0072] (3) The leaves were transferred to a centrifuge tube containing enzymolysis solution, and placed on a shaker in the dark for enzymolysis. After a period of time, it was found that there were no complete leaves in the enzymolysis solution, and after the solution became turbid, the solution was placed under a microscope for observation, and a large number of round protoplasts appeared in the field of vision; wherein the enzymolysis solution formula is: Cellulase RS (1.5%), Macrozyme R-10 (0.4%), pectinase (0.4%-0.6%) and D-Mannitol (0.4M), dissolved in 20mmol / L MES buffer (pH=5.8) containing 20mmol / L KCl, and heated in a water bath at 55°C for 10min. After the enzymolysis solution was cooled to room temperature, 10mmol / L CaCl2, 5μmol / L β-mercaptoethanol and 1g / L BSA (bovine serum albumin) were added to the final concentration, and the volume was fixed to 10mL with water.
[0073] Wherein, the rotation speed of the dark culture shaker in step (3) is 25-40 rpm.
[0074] In the above method, the enzymatic hydrolysis time of the leaves in step (3) is 3.5 hours.
[0075] Table 1 Selection of blades
[0076] Growth period Location <![CDATA[Yield (×10 6 individuals / g)]]> 2-3 leaves just developed Top blade 0.59 Parietal lobe has not yet expanded 2-3 pieces below the parietal lobe 3.21 Parietal expansion stage Parietal lobe and 2-3 pieces below parietal lobe 1.85
[0077] The results are as follows Figures 4 to 6 This indicates that when the top leaf has not yet unfolded, the maximum number of protoplasts can be obtained by enzymatic hydrolysis of 2-3 leaves below the top leaf.
[0078] Example 2 Orthogonal Experimental Design Transient Transformation of Polygonatum cyrtonema Leaf Protoplasts
[0079] The specific steps are as follows:
[0080] 1. Obtaining exogenous plasmids
[0081] 1. Construction of recombinant plasmid pHBT-GFP-NOS-PcAP2C
[0082] The steps include:
[0083] (1) Extract RNA from Polygonatum sibiricum rhizomes and reverse transcribe it into cDNA.
[0084] (2) Using the genomic DNA of Polygonatum cyrtonema as a template, the following specific primers containing the PcAP2C sequence that can be used for seamless cloning (underlined) were designed:
[0085] PcAP2C F:
[0086] TCAAGCTTCGAATTCTGCAGATGGAAGATGGCACAAGCTC
[0087] PcAP2C R:
[0088] CCTCGCCCTTGCTCACCATGttCAACAAAGGATCCCATAAACTTC
[0089] (3) PCR amplification was performed using S4 enzyme in a 20 μl reaction system. The reaction procedure of the PCR amplification step was as follows: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, 35 cycles, and final extension at 72°C for 10 min.
[0090] (4) The amplified product was subjected to agarose electrophoresis and then cut and recovered according to the size of the target band, thereby obtaining a 609 bp DNA fragment containing the Polygonatum cyrtonema PcAP2C gene.
[0091] (5) The pHBT-GFP-NOS vector was double-digested with SalI and BamHI to recover the 4259 bp vector backbone fragment.
[0092] (6) The fragments PcAP2C and pHBT-GFP-NOS were connected by seamless cloning to obtain the recombinant vector pHBT-GFP-NOS-PcAP2C (such as Figure 7 shown).
[0093] SEQ ID NO.1:
[0094] ATGGAAGATGGCACAAGCTCTCCCCGATTATGCTCCAAGCGCCGAGATGGAACTCCATTTGCTTATATTGGGGTAAGAAAAAGGAAATGGGGAAAGTGGGTTTCAGAAATCAGAGAACCAGGGAAGAAAACACGTATTTGG TTGGGATCATTTGAGACGCCTGAGATGGCAGCTGTTGCACATGACGTCGCCGCTTTTTGGTTGAGGGGTCAAGATGCAAGATTAAACTTCCCTGACTCAGTGGATAGGCTGCCCAGACCTACTTCGTCGGATCCAAATGATA TACGTTCAGCTGCACTTGAAGCTGCTCTTGATGTAAAGTTTAGGCAGTCAACCGCACCGAGTGAGGCAGCCTCTAGCGCGTCCACAACTCTTCAGCGGGTGGGTAGTGAGTCTTCCTCTGACATGAGTTTCAATCTCTGTGT TGAATGAATGGCTAGTGACTCTCCAAAAATGTGGAGAGAGCTTGCTGAAGCAATGCTCCTGGCGCCACCTCAAGGTCTATCTGGCTGTGAAATGAATGAAGTGTGAAATTCTAGAGCAAGGAAGTTTATGGGATCCTTTGTTG
[0095] 2. The above plasmids were transformed into E. coli DH5α competent cells, and the transformed E. coli were cultured overnight in LB liquid medium (150 mL) containing ampicillin (50 μg / mL) for plasmid extraction.
[0096] 3. Perform plasmid extraction before protoplast cell preparation so that the extracted plasmid can be directly used for transformation reaction. After plasmid extraction, dissolve it in TE Buffer with pH 8.0 to make the pHBT-GFP-NOS-PcAP2C plasmid concentration equal to about 4000ng / μL, the plasmid purity A260 / A280 ratio is 1.9, and the A260 / A230 ratio is 2.35.
[0097] Screening of transient transformation conditions of Polygonatum cyrtonema protoplasts:
[0098] 1. Set the gradient for the conditions involved in the transformation reaction, and perform orthogonal combinations to detect the transformation rate of each combination. The screening conditions are shown in Table 2. The test plasmids used are pHBT-GFP-NOS-PcAP2C; set the plasmid / Ca2+ Ca in solution 2+ The concentration gradient was 0.1mol / L, 0.3mol / L, and 0.6mol / L respectively; the plasmid / Ca 2+ The concentration gradient of the plasmid in the solution was 1 μg / μL, 2.0 μg / μL, and 4 μg / μL, respectively; the PEG concentration gradient was set to 40%, 45%, and 50%. In addition to the above conditions, the transformation reaction was completed as follows:
[0099] (1) The protoplast suspension of Polygonatum cyrtonema obtained in Example 1 was used for plasmid transformation, using 100 μL of the cell suspension.
[0100] (2) Take 10 μL of pHBT-GFP-NOS-PcAP2C plasmid and mix it with 110 μL of PEG-CaCl2 solution (concentration refer to Table 2), and then place it in a 10 mL round-bottom centrifuge tube.
[0101] (3) Add 100 μL of the cell suspension in step (1) to the centrifuge tube in step (2), mix well and let stand for 30 min.
[0102] (4) After the predetermined time, add an equal volume of W5 solution to the cells, quickly shake the bottom of the tube slightly to mix them to stop the reaction, collect the cells by centrifugation and remove the supernatant. Add 1 mL of W5 solution, centrifuge and remove the supernatant. The centrifugation conditions are: centrifugal force 100g; centrifugation time 3min. Then, gently add 2 mL of W5 incubation solution to resuspend the cells, and incubate at 25℃ in the dark for 16h.
[0103] Table 2 Factors and levels of orthogonal experiment for transient transformation of protoplasts from Polygonatum cyrtonema leaves
[0104]
[0105] The screening results of the transformation conditions are shown in Table 3.
[0106] Table 3 Transient transformation results of protoplasts from Polygonatum cyrtonema leaves
[0107]
[0108] As can be seen from Table 3, in the above method, leaf transformation is preferred: Ca 2+ concentration (0.6 mol / L), plasmid concentration (4 μg / L), PEG concentration (40%), the highest conversion rate can reach about 55%.
[0109] Example 3 Subcellular localization of the Polygonatum cyrtonema gene PcAP2C in Polygonatum cyrtonema protoplasts
[0110] Referring to the experimental steps of Example 2, select Ca2+ The concentration is 0.6 mol / L, the test plasmid concentration is 4 μg / L, the PEG concentration is 40%, the test plasmid selects the recombinant plasmid pHBT-GFP-NOS-PcAP2C, and the other conditions are consistent with implementation 2. The recombinant plasmid pHBT-GFP-NOS-PcAP2C is transformed into the protoplasts of Polygonatum cyrtonema leaves. The recombinant plasmid pHBT-GFP-NOS-PcAP2C contains a green fluorescent protein (GFP) tag. PcAP2C is a protein located in the cell nucleus. After successful transformation, the cell nucleus can show green fluorescence under 488nm emission light.
[0111] The results are as follows Figure 8 , 9 , as shown in 10, Fig. 9 The conversion conditions are Ca 2+ The correspondence between fluorescence (left) and bright field (right) under the concentration (0.6 mol / L), plasmid concentration (4 μg / L), and PEG concentration (40%) shows that the transformation efficiency of protoplasts is 55%; Fig.10 Fluorescence localization in the nucleus was shown for protoplasts under confocal microscopy.
[0112] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. A method for preparing protoplasts from Polygonatum cyrtonema leaves, characterized in that: The steps include: S1, select the leaves of Polygonatum cyrtonema from the new branches sprouting from the rhizome or 1-3 leaves of Polygonatum cyrtonema below the top leaves to be unfolded and soak them in mannitol solution; S2, placing the leaves soaked in step S1 on a shaker, and performing enzymatic hydrolysis with an enzymatic solution in the dark to prepare protoplasts; The enzymatic hydrolysate comprises 1.5 m / v% of cellulase RS, 0.4 m / v% of macerate R and 0.4 m / v% of pectinase.
2. The method according to claim 1, characterized in that In step S1, the concentration of the mannitol solution is 0.6 M, and the soaking time is 20-30 min.
3. The method according to claim 1, characterized in that In step S2, the ratio of the enzymatic hydrolysis solution to the leaves is that 3-4 g of leaves can be enzymatically hydrolyzed per 10 mL of the enzymatic hydrolysis solution; The preparation method of the enzymatic hydrolysate is as follows: 1.5m / v% cellulase RS, 0.4m / v% macerator R, 0.4%m / v pectinase and 0.4M D-mannitol are dissolved in 20mmol / L MES buffer containing 20mmol / L KCl and pH 5.8, heated in a 55°C water bath for 10min, and after the enzymatic hydrolysate is cooled to room temperature, 10mmol / L CaCl2, 5μmol / L β-mercaptoethanol and 1g / L BSA are added to the enzymatic hydrolysate to a final concentration, and water is added to the fixed volume; The enzymatic hydrolysis time is 2.5-4h.
4. A protoplast from Polygonatum cyrtonema leaf prepared by the method according to any one of claims 1 to 3.
5. A method for transient transformation of protoplasts from Polygonatum cyrtonema leaves, characterized in that: The following steps are involved: (1) adding the Polygonatum cyrtonema leaf protoplasts described in claim 4 to a mixture of 0.1-0.6 mol / L CaCl2, 40%-50% PEG, and 0.4 M mannitol solution; (2) Add 1-4 μg / μL of the test plasmid to step (1); (3) Allow the transformation to stand in the dark for 30 min.
6. The method according to claim 5, characterized in that Ca 2+ The concentration was 0.6 mol / L, the test plasmid concentration was 4 μg / μL, and the PEG concentration was 40%.
7. The method according to claim 5, characterized in that In step (2), the test plasmid is the recombinant plasmid pHBT-GFP-NOS-PcAP2C, and the recombinant plasmid pHBT-GFP-NOS-PcAP2C is obtained by inserting the Polygonatum sibiricum PcAP2C gene into the plasmid pHBT-GFP-NOS, and the nucleotide sequence of the Polygonatum sibiricum PcAP2C gene is shown in SEQ ID NO.
1.
8. A Polygonatum cyrtonema PcAP2C gene, characterized in that: The nucleotide sequence of the Polygonatum sibiricum PcAP2C gene is shown in SEQ ID NO.
1.
9. A recombinant vector carrying the gene according to claim 8.
10. A recombinant cell containing the gene according to claim 8 or transformed with the expression vector according to claim 9.