SiRNA of targeted PCSK9 gene and application of siRNA

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) of a targeted PCSK9 gene and an application of the siRNA. According to the invention, 92 siRNA sequences, namely siRNA-1 to siRNA-92, are respectively designed aiming at different initial positions of a nucleotide sequence of a PCSK9 gene. According to the invention, a 21 + 23 sequence pattern is innovatively adopted, and two non-complementary sequences are added at the 3'end of an antisense strand. The design has stronger sequence specificity, and the off-target efficiency is reduced. The maximum inhibition efficiency of the siRNA provided by the invention on the PCSK9 gene can exceed 80%, the effect is stronger, the siRNA can be reproduced in multiple cells, and the siRNA has good stability.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a siRNA targeting PCSK9 gene and an application thereof. Background Art

[0002] Proprotein convertase subtilisin kexin type 9 (PCSK9), as a protein closely related to cholesterol regulation, plays an important role in a variety of diseases including cardiovascular disease. Therapeutic strategies targeting PCSK9 have become an important means of treating hypercholesterolemia and other related diseases.

[0003] Current treatment strategies for PCSK9 mainly include small molecule and monoclonal antibody drugs. Small molecule and monoclonal antibody drugs need to recognize the complex spatial structure of specific proteins, and therefore need to precisely match these structures to exert their therapeutic effects. Summary of the invention

[0004] In order to solve the above-mentioned technical problems, the present invention provides a siRNA targeting the PCSK9 gene, which can effectively reduce the expression level of the PCSK9 gene, and the maximum inhibition efficiency can exceed 80%.

[0005] The technical solution adopted by the present invention is: an siRNA targeting the PCSK9 gene, wherein the siRNA is selected from at least one of 92 siRNAs from siRNA-1 to siRNA-92.

[0006] Among the siRNA-1 to siRNA-92, the nucleotide sequence of the sense strand of each of the 92 siRNAs corresponds to a SEQ ID NO: X from siRNA-1 to siRNA-92, respectively, where X is a single number ranging from 1 to 183;

[0007] Among the siRNA-1 to siRNA-92, the nucleotide sequence of the antisense strand of each of the 92 siRNAs corresponds to a SEQ ID NO: Y from siRNA-1 to siRNA-92, respectively, where Y is an even number ranging from 2 to 184.

[0008] Further, the siRNA is selected from at least one of siRNA-3, siRNA-4, siRNA-5, siRNA-6, siRNA-7, siRNA-9, siRNA-10, siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-17, siRNA-25, siRNA-51, siRNA-54, siRNA-60, siRNA-61, siRNA-62, siRNA-64, siRNA-65, siRNA-66, siRNA-67, siRNA-68, siRNA-70, siRNA-73, siRNA-75, siRNA-79, siRNA-84, siRNA-87, siRNA-89 and siRNA-92.

[0009] Furthermore, the siRNA is selected from at least one of siRNA-5, siRNA-6, siRNA-9, siRNA-10, siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-25, siRNA-51, siRNA-54, siRNA-60, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92.

[0010] Furthermore, the siRNA is selected from at least one of siRNA-12, siRNA-51, siRNA-54, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92.

[0011] Furthermore, the siRNA is selected from at least one of siRNA-65, siRNA-68, siRNA-79 and siRNA-92.

[0012] Furthermore, the siRNAs from siRNA-1 to siRNA-92 are unmodified nucleotides.

[0013] The invention provides an application of the siRNA targeting the PCSK9 gene in the preparation of an inhibitor for reducing the expression amount of the PCSK9 gene.

[0014] The invention provides an application of siRNA targeting PCSK9 gene in the preparation of blood lipid lowering drugs.

[0015] The beneficial effects of the present invention are as follows: the present invention innovatively adopts the "21+23" sequence pattern, with two more non-complementary sequences at the 3' end of the antisense chain. This design has stronger sequence specificity and reduces off-target efficiency. At the same time, the 3' end of the sense chain is more suitable for coupling some targeted small molecules, such as GalNA. The maximum inhibition efficiency of the siRNA provided by the present invention on the PCSK9 gene can exceed 80%, and the effect is stronger. It can be reproduced in multiple cells and has good stability. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a western diagram showing the inhibition of PCSK9 protein expression in HepG2 cell line by different siRNAs in Example 1.

[0017] Figure 2 This is a western diagram showing the inhibition of PCSK9 protein expression in HELA cell lines by different siRNAs in Example 1. DETAILED DESCRIPTION

[0018] In order to better understand the above-mentioned technical scheme, the technical scheme of the embodiments of the present application is described in detail below through the accompanying drawings and specific embodiments. It should be understood that the embodiments of the present application and the specific features in the embodiments are detailed descriptions of the technical scheme of the embodiments of the present application, rather than limitations on the technical scheme of the present application. In the absence of conflict, the embodiments of the present application and the technical features in the embodiments may be combined with each other.

[0019] In the embodiment of the present invention, 92 siRNA sequences, namely siRNA-1 to siRNA-92, were designed respectively for different starting positions of the nucleotide sequence of the PCSK9 gene by using online design software.

[0020] It is understandable that siRNA has a natural advantage over small molecule therapies and antibody drugs because siRNA performs its function by performing Watson-Crick base pairing on mRNA, while small molecule and monoclonal antibody drugs need to recognize the complex spatial structure of specific proteins. Therefore, many diseases cannot be treated by small molecules and monoclonal antibodies because their target molecules are highly active and it is difficult to identify and design specific structures with affinity. In contrast, genes of interest can be targeted by siRNA, and the mechanism of action of siRNA gives it a shorter research and development cycle and a wider range of treatment than small molecule or antibody drugs.

[0021] Furthermore, siRNA was screened using HELA cell lines and HepG2 cell lines. In the first round of experiments, HELA cell lines were used for preliminary screening, and the final concentrations of siRNA-1 to siRNA-92 were all 50 nM, showing that 92 unmodified siRNA sequences all had inhibitory effects on PCSK9 gene expression. 31 siRNA sequences, including siRNA-3, had a strong inhibitory effect on the expression of PCSK9. In the second round of experiments, HepG2 cell lines were selected to further verify the knockdown efficiency of PCSK9. The 31 siRNA sequences, including siRNA-3, screened in the first round, were used as target sequences. The final concentrations of 31 siRNA sequences, including siRNA-3, were all 10 nM. It was found that the knockdown efficiency of 21 siRNA sequences, including siRNA-5, was higher than that of PCSK9. In the third round of experiments, HepG2 cell lines were used to test 21 siRNA sequences screened in the second round, including siRNA-5. The final concentrations of siRNA-5 and other 21 siRNAs were all 50nM. It was found that 12 siRNA sequences, including siRNA-51, had a strong inhibitory effect on PCSK9.

[0022] Furthermore, siRNA was screened by protein, and it was found that siRNA-65, siRNA-68, siRNA-79 and siRNA-92 had high knockdown efficiency on PCSK9.

[0023] It is understandable that the 92 siRNAs from siRNA-1 to siRNA-92 can be used alone, or any two or more siRNAs can be used in combination.

[0024] Example 1

[0025] (I) Design of siRNA

[0026] The present invention uses the online design software "DSIR" to design 92 siRNA sequences for different starting positions of the nucleotide sequence of the PCSK9 gene (as shown in Table 1), and there are two positive controls, one of which is the complete sequence of Inclisiran (Frank-Kamenetsky, Maria et al. "Therapeutic RNAi targeting PCSK9 acutelylowers plasma cholesterol in rodents and LDL cholesterol in nonhumanprimates." Proceedings of the National Academy of Sciences of the UnitedStates of America vol.105, 33(2008):11915-20.doi:10.1073 / pnas.0805434105) (PC1 in Table 1), and the other is a TT end sequence with good performance in the literature (https: / / www.accessdata.fda.gov / drugsatfda_docs / label / 2021 / 214012lbl.pdf) (PC2 in Table 1).

[0027] Table 1 siRNA sequences

[0028]

[0029]

[0030]

[0031]

[0032]

[0033] Notes: dTdT, terminal overhang; *, thio modification; m, 2'-OMe modification; / i2F / , 2'-F modification

[0034] (II) siRNA sequence synthesis

[0035] The 92 siRNA sequences designed in Table 1 were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0036] (III) Sequence screening - RNA

[0037] Cell types: HELA cells and HepG2 cells

[0038] Positive control: unmodified PC sense strand and antisense strand (sequences PC1 and PC2 in Table 1), also synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0039] Drug solvent: sterile enzyme-free water and Gibco DMEM medium.

[0040] 1. Experimental methods

[0041] qRT PCR was used to detect the inhibitory effect of the samples on the expression of PCSK9 gene mRNA in HELA cell lines and HepG2 cell lines.

[0042] 1.1) Cell culture

[0043] Take the HELA cell line and HepG2 cell line for subculture. Take 500 μl of logarithmically growing cells and add 50 ml of 10% fetal bovine serum DMEM culture medium (supplemented with 100× penicillin / streptomycin 10 μl / ml), place in a cell culture incubator at 37°C with 5% CO2, and culture for 14 days, changing the medium once a day. Digest and subculture with 0.25% trypsin, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add fresh 10% fetal bovine serum DMEM culture medium for subculture. Transfer the cells to a 48-well plate one day in advance.

[0044] 1.2) Cell transfection

[0045] Medium change: Replace the medium in the cells with Opti MEM, add 300 μl to each well.

[0046] Preparation of transfection mixture: Mix Lipofectamine 3000 and OptiMEM at a ratio of 3:50 (v / v) and vortex to mix.

[0047] Preparation of transfection reagent: According to the ratio of 1:1 (v / v), take 12.5 μl of siRNA solution diluted with Opti MEM (the concentration of the diluted siRNA solution is diluted according to the actual experimental concentration of the first, second and third rounds) and 12.5 μl of transfection mixture, vortex to mix, and let stand at room temperature for 15 minutes to obtain lipid nanoparticles (LNP).

[0048] Transfection reagent for blank control group: Take 12.5 μl of OptiMEM and 12.5 μl of transfection mixture, vortex to mix, and let stand at room temperature for 15 minutes.

[0049] Add the prepared transfection reagent and the blank control transfection reagent to a 48-well cell culture plate (25 microliters per well) to make the final siRNA concentration in each well 10nM or 50nM. (A total of three rounds of experiments were performed. The first round of experiments was a preliminary screening of HELA cells, and the final siRNA concentration was 50nM; the second round used HepG2 cells to test the knockdown efficiency in the first round, and the final siRNA concentration was 10nM; the third round used HepG2 cells to test the knockdown efficiency in the second round, and the final siRNA concentration was 50nM) After culturing for 6 hours, the culture medium was replaced with DMEM for 36 hours.

[0050] 1.3) PCSK9 mRNA detection

[0051] 1.3.1) RNA extraction

[0052] a) Aspirate the culture medium in the 48-well plate, add 0.5 ml 1× PBS to each well to wash the cells, and discard the PBS. Add 0.5 ml TRIzol reagent to the wells, blow the cells with a pipette tip to fully lyse, transfer to a 1.5 ml RNase-free EP tube, and let stand at room temperature for 5 minutes.

[0053] b) Add 0.1 ml of chloroform to each tube, shake vigorously for 15 seconds, and let stand at room temperature for 5 minutes. Centrifuge at 4°C, 16,000×g for 15 minutes, and take 200 μl of the supernatant into a new EP tube.

[0054] c) Add an equal volume of isopropanol, gently mix the liquid in the tube by inverting it upside down, let it stand at 20°C overnight, centrifuge at 4°C, 16,000×g for 15 minutes, and discard the supernatant.

[0055] d) Add 0.5 ml of 75% ethanol to gently wash the RNA precipitate, centrifuge at 16,000 × g for 5 minutes at 4°C, discard the ethanol, and remove any remaining ethanol with a micropipette.

[0056] e) Dry the residual ethanol at room temperature for 23 minutes, add 10 μl RNase free ddH2O and dissolve.

[0057] 1.3.2) RNA concentration detection

[0058] Use nanodrop to test RNA concentration. Use 1 μl RNasefree ddH2O as blank control and 1 μl RNA sample obtained in step 1.3.1) for each test. Record the sample concentration.

[0059] 1.3.3) Quantitative detection of PCSK9 mRNA

[0060] The mRNA quantification in this study was performed using IIOne Step qRT-PCRSYBR Green Kit (cat#Q221). The experimental protocol was carried out according to the instructions. In brief, each detection well contained 5 μl 2×One StepSYBR Green Mix, 0.5 μl One Step SYBR Green Enzyme Mix, 0.2 μl 50×ROX ReferenceDye1, 1 μl primer (primer sequence of PCSK9 or primer sequence of GAPDH is shown in Table 2), 2.3 μl enzyme-free water, and 1 μl RNA sample obtained in step 1.3.1). Each sample was repeated twice. This step was operated on ice to maintain low temperature conditions.

[0061] Place the plate into the qPCR instrument and run the following program:

[0062] Reverse transcription: 50°C, 3 minutes;

[0063] Pre-denaturation: 95°C, 30 seconds;

[0064] Cyclic reaction: 95°C, 10 seconds; 60°C, 30 seconds; 40 cycles;

[0065] Melting curve: 95°C, 15 sec; 60°C, 60 sec; 95°C, 15 sec.

[0066] Running time is approximately 1 hour and 20 minutes.

[0067] Analyze the experimental results and calculate 2 ΔΔCt That is the relative expression of mRNA.

[0068] Table 2

[0069] PCSK9-q-F GGGCATTTCACCATTCAAACAG PCSK9-q-R GCACGGAACAAGAGCTCAATA GAPDH-q-F ATTCCATGGCACCGTCAAGGCT GAPDH-q-R TCAGGTCCACCACTGACACGTT

[0070] 2. Data processing

[0071] The PCSK9 mRNA expression rate (%) was calculated as follows:

[0072] Expression rate = (relative expression of PCSK9 mRNA in the siRNA group / relative expression of PCSK9 mRNA in the blank control group) × 100%;

[0073] 3. Experimental results

[0074] The results of the inhibitory effect of the synthesized unmodified oligonucleotide siRNA on PCSK9 gene expression are shown in Table 3.

[0075] Table 3 PCSK9 mRNA expression rate (%)

[0076]

[0077]

[0078]

[0079] The 92 unmodified oligonucleotides synthesized had an inhibitory effect on PCSK9 gene expression, and the experimental results are shown in Table 3. Different sequences have very different PCSK9 gene expression rates. Generally speaking, sequences with an expression rate lower than 52% can be optimized as lead compounds, and sequences with an expression rate between 52-70% have little significance for optimization. Sequences with an expression rate of more than 70% show very poor effects and do not need to be considered.

[0080] 3.1) First round of screening

[0081] In the first round, HELA cells were used for preliminary screening. The final concentrations of siRNA-1 to siRNA-92 were all 50 nM, and the assay was performed in parallel twice.

[0082] As can be seen from Table 3, the first round of unmodified sequence siRNA-1 to siRNA-92 all had an inhibitory effect on PCSK9 gene expression. Among them, 31 siRNAs including siRNA-3, siRNA-4, siRNA-5, siRNA-6, siRNA-7, siRNA-9, siRNA-10, siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-17, siRNA-25, siRNA-51, siRNA-54, siRNA-60, siRNA-61, siRNA-62, siRNA-64, siRNA-65, siRNA-66, siRNA-67, siRNA-68, siRNA-70, siRNA-73, siRNA-75, siRNA-79, siRNA-84, siRNA-87, siRNA-89 and siRNA-92 and the positive controls PC1 and PC1 had a strong inhibitory effect on the expression of PCSK9. In particular, siRNA-5, siRNA-6, siRNA-7, siRNA-9, siRNA-10, siRNA-14, siRNA-15, siRNA-25, siRNA-51, siRNA-64, siRNA-66, siRNA-67, siRNA-68, siRNA-79 and siRNA-92 had higher knockdown efficiencies than PC, among which, with sequences such as siRNA-6, siRNA-9, siRNA-14, siRNA-15, siRNA-25, siRNA-64, siRNA-66, siRNA-68 and siRNA-92, the expression of PCSK9 in HELA cells was only 10-20% of the original level.

[0083] 3.2) Second round of screening

[0084] In order to verify different cell lines, the application selects HepG2 cells, and further verifies the knockdown efficiency of PCSK9 with the siRNA screened in the first round. Knockdown experiments were performed using 10nM siRNA (31 kinds of siRNA-3 screened in the first round). After the experiment, it was found that 21 kinds of siRNAs such as siRNA-5, siRNA-6, siRNA-9, siRNA-10, siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-25, siRNA-51, siRNA-54, siRNA-60, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92 had a strong inhibitory effect on PCSK9. Due to the low concentration of the siRNA selected, this round of screening has expanded some scopes. Analysis of the expression levels corresponding to the above sequences revealed that the knockdown efficiency of siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-25, siRNA-51, siRNA-54, siRNA-60, siRNA-61, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-84 and siRNA-87 was higher than that of PC. Among them, after siRNA-11, siRNA-12, siRNA-13, siRNA-51, siRNA-54, siRNA-60 and siRNA-68 were treated with HepG2, the expression level was only 33-50% of the original (since only 10 nM siRNA was used, the knockdown efficiency was lower than that of the first and third rounds).

[0085] 3.3) Third round of screening

[0086] In the third round, 21 siRNAs including siRNA-5 screened in the second round were used to perform knockdown experiments on HepG2 cells at 50nM. After the experiment, it was found that 12 siRNAs including siRNA-12, siRNA-51, siRNA-54, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92 had a strong inhibitory effect on PCSK9. Among them, siRNA-70 had the highest knockdown efficiency. The cell expression level after treatment with the siRNA-70 sequence was 13%, while the corresponding PC treatment cell expression level was 35%. In addition, siRNA-65, siRNA-68, siRNA-79 and siRNA-92 also have potential. After these siRNAs were treated, the PCSK9 expression level of HepG2 cells was 20-33% of the original.

[0087] (IV) Sequence screening - protein

[0088] 1. Experimental Materials

[0089] Cell types: HELA cells and HepG2 cells

[0090] Positive control: unmodified PC sense strand and antisense strand (sequences PC1 and PC2 in Table 1), also synthesized by Sangon.

[0091] Drug solvent: sterile enzyme-free water and Gibco DMEM medium

[0092] Other reagents and consumables: 0.45 μm PVDF membrane (purchased from Millipore); 10× Tris-glycine-SDS electrophoresis buffer (purchased from Rambolide); 20× rapid transfer buffer (purchased from Rambolide); 20× TBST buffer (purchased from Easybio); 10% one-step AB liquid rapid gel kit (purchased from Rambolide); protein marker (purchased from Thermo Fisher); skim milk powder (purchased from Rambolide); bovine serum albumin (purchased from McLean); 5× SDS-Loading buffer (purchased from Rambolide); PBS buffer (pH 7.4) (purchased from Gibco); trypsin (purchased from Vivacell); fetal bovine serum (purchased from PAN); penicillin-streptomycin double antibody (purchased from McLean); Lipo 3000 (purchased from Thermo Fisher); Opti-MEM (purchased from Gibco); anti-GAPDH antibody rabbit anti-antibody (purchased from ABclonal); anti-Histone3 antibody rabbit anti-antibody (purchased from ABclonal); anti-snRNP70 antibody rabbit anti-antibody (purchased from ABclonal); anti-YTHDC1 antibody rabbit anti-antibody (purchased from ABclonal); goat anti-rabbit secondary antibody linked to horseradish enzyme (purchased from ABclonal); Western-blot electrophoresis equipment (Tianneng); 1.5 ml Eppendorf (EP) tube (purchased from Axygen); 2.0 ml Eppendorf (EP) tube (purchased from Axygen).

[0093] 2. Experimental methods

[0094] Western-blot was used to detect the inhibitory effects of the samples on PCSK9 gene mRNA expression in HELA cell lines and HepG2 cell lines.

[0095] 2.1) Cell culture

[0096] Take the HELA cell line and HepG2 cell line for subculture. Take 500 μl of logarithmically growing cells and add 50 ml of 10% fetal bovine serum DMEM culture medium (supplemented with 100× penicillin / streptomycin 10 μl / ml), place in a cell culture incubator at 37°C containing 5% CO2, and culture for 14 days, changing the medium once a day. Digest and subculture with 0.25% trypsin, centrifuge at 1000r / min for 5 minutes, discard the supernatant, and add fresh 10% fetal bovine serum DMEM culture medium for subculture. Transfer the cells to a 24-well plate one day in advance.

[0097] 2.2) Cell transfection

[0098] Medium change: replace the medium in the cells with Opti MEM and add 500 μl to each well.

[0099] Preparation of transfection mixture: Mix Lipofectamine 3000 and Opti MEM at a ratio of 3:50 (v / v) and vortex to mix.

[0100] Preparation of transfection reagent: According to the ratio of 1:1 (v / v), take 25 μl of siRNA solution diluted in OptiMEM and 25 μl of transfection mixture, vortex mix, and let stand at room temperature for 15 minutes to obtain lipid nanoparticles (LNP).

[0101] Transfection reagent for blank control group: Take 25 μl of OptiMEM and 25 μl of transfection mixture, vortex to mix, and let stand at room temperature for 15 minutes.

[0102] The prepared transfection reagent and the blank control group transfection reagent were added to a 24-well cell culture plate (25 μl per well) to make the final siRNA concentration in each well 50 nM. After 6 hours of culture, the culture medium was replaced with DMEM for 36 hours.

[0103] 2.3) Western-blot

[0104] a) Sample processing

[0105] Aspirate the culture medium in the 24-well plate, add 0.5 ml 1×PBS to each well to wash the cells, and discard the PBS. Add 0.1 ml 2×SDS-Loading buffer to the wells, scrape the cells with a pipette tip, and then transfer to a clean 1.5 μl EP tube, boil the sample in a 95℃ water bath for 5 minutes, and then immediately put it on ice.

[0106] b) Gel preparation, sample loading, membrane transfer

[0107] Prepare 15-well 10% SDS-PAGE gel and upper separation gel, load samples in the order of 26616 marker, siRNA-12, siRNA-51, siRNA-54, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92, mock PC, and 26619 marker, set the voltage to 135 V and the time to 1 hour, use methanol to activate PVDF membrane to prepare the transfer sandwich, set the transfer current to 350 mA, and the time to 40 minutes.

[0108] c) Sealing and cutting membrane

[0109] The PVDF membrane was blocked in 5% skim milk powder-TBST solution at room temperature for 1 hour. Then, the membrane of the GAPDH segment and PCSK9 region was cut open, and the PVDF membrane was washed three times with TBST, each time for more than 5 minutes.

[0110] d) Primary and secondary antibody incubation

[0111] Place the membrane of the corresponding section in the corresponding antibody and incubate overnight at 4°C. Wash the PVDF membrane three times with TBST, each time for more than 5 minutes. Place the membrane in the secondary antibody, incubate at room temperature for 1 hour, and wash the PVDF membrane three times with TBST, each time for more than 5 minutes.

[0112] e) Color rendering and image processing

[0113] The PVDF film was exposed using Tanon-5200, and the image was processed using AI.

[0114] f) Data processing

[0115] 3. Experimental results

[0116] like Figure 1 As shown, Western-blot detection was performed on HELA cells and HepG2 cells after the third round of siRNA knockdown treatment in (III) sequence screening-RNA. The results showed that in HepG2 cells, siRNA-12, siRNA-51, siRNA-54, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92 siRNAs found that after PCSK9 minus GAPDH, the gray value was smaller than the gray value of PC minus GAPDH, which can verify the results of qPCR, that is, the siRNA sequences with higher knockdown efficiency are siRNA-65, siRNA-68, siRNA-79 and siRNA-92.

[0117] like Figure 2 As shown, HELA cells were used to verify siRNA, and siRNAs siRNA-25, siRNA-51, siRNA-64, siRNA-68, siRNA-70, siRNA-75, siRNA-79 and siRNA-92 were found. Similarly, it was found that the results of qPCR could be verified, that is, the siRNA sequences with higher knockdown efficiency were siRNA-65, siRNA-68, siRNA-79 and siRNA-92.

[0118] It is easy for those skilled in the art to understand that, under the premise of no conflict, the above-mentioned advantageous methods can be freely combined and superimposed. The above are only preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application. The above are only preferred implementation methods of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and variations can be made without departing from the technical principles of the present application, and these improvements and variations should also be regarded as the protection scope of the present application.

Claims

1. A siRNA targeting PCSK9 gene, characterized in that: The siRNA is selected from at least one of siRNA-1 to siRNA-92; In the siRNA-1 to siRNA-92, the nucleotide sequence of the sense strand of each siRNA from siRNA-1 to siRNA-92 corresponds to a SEQ ID NO: X, where X is a single number ranging from 1 to 183; In the siRNA-1 to siRNA-92, the nucleotide sequence of the antisense strand of each siRNA corresponds to a SEQ ID NO: Y from siRNA-1 to siRNA-92, respectively, where Y is an even number ranging from 2 to 184.

2. The siRNA targeting PCSK9 gene according to claim 1, characterized in that The siRNA is selected from siRNA-3, siRNA-4, siRNA-5, siRNA-6, siRNA-7, siRNA-9, siRNA-10, siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-17, siRNA-25, siRNA-51, siRNA-54, siRNA- 60. At least one of siRNA-61, siRNA-62, siRNA-64, siRNA-65, siRNA-66, siRNA-67, siRNA-68, siRNA-70, siRNA-73, siRNA-75, siRNA-79, siRNA-84, siRNA-87, siRNA-89 and siRNA-92.

3. The siRNA targeting PCSK9 gene according to claim 2, characterized in that: The siRNA is selected from at least one of siRNA-5, siRNA-6, siRNA-9, siRNA-10, siRNA-11, siRNA-12, siRNA-13, siRNA-14, siRNA-25, siRNA-51, siRNA-54, siRNA-60, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92.

4. The siRNA targeting PCSK9 gene according to claim 3, characterized in that: The siRNA is selected from at least one of siRNA-12, siRNA-51, siRNA-54, siRNA-64, siRNA-65, siRNA-66, siRNA-68, siRNA-70, siRNA-75, siRNA-79, siRNA-87 and siRNA-92.

5. The siRNA targeting PCSK9 gene according to claim 4, characterized in that: The siRNA is selected from at least one of siRNA-65, siRNA-68, siRNA-79 and siRNA-92.

6. The siRNA targeting PCSK9 gene according to any one of claims 1 to 5, characterized in that: The siRNAs from siRNA-1 to siRNA-92 are unmodified nucleotides.

7. Use of the siRNA targeting the PCSK9 gene according to any one of claims 1 to 6 in the preparation of an inhibitor for reducing the expression level of the PCSK9 gene.

8. Use of the siRNA targeting PCSK9 gene according to any one of claims 1 to 6 in the preparation of lipid-lowering drugs.

Images