Application of OsIAA9 gene in regulating crop deep root ratio

By using CRISPR/Cas9 technology to perform site-specific editing of the OsIAA9 gene, the technological gap in regulating the deep root ratio of rice has been filled, improving the drought resistance and growth capacity of rice under arid conditions.

CN119662658BActive Publication Date: 2026-02-03SHANGHAI AGROBIOLOGICAL GENE CENT +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411822380.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-11
Publication Date
2026-02-03
Estimated Expiration
2044-12-11

AI Technical Summary

Technical Problem

The lack of effective genes for regulating the deep root ratio in crops in existing technologies leads to insufficient ability of crops such as rice to absorb deep soil moisture under drought conditions, affecting drought resistance and grain yield.

Method used

By using CRISPR/Cas9 technology to perform site-specific editing of the OsIAA9 gene, an OsIAA9 gene mutant was obtained, which regulated the deep root ratio of rice and improved the crop's drought resistance.

Benefits of technology

It significantly increased the deep root ratio of rice, enhanced its drought resistance under arid conditions, and promoted the growth and development of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662658B_ABST
    Figure CN119662658B_ABST
Patent Text Reader

Abstract

The application provides application of an OsIAA9 gene in regulating deep root ratio of crops, and a nucleotide sequence of the OsIAA9 gene is shown in SEQ ID NO:1. The application edits the OsIAA9 gene in rice by using a CRIPSR / Cas9 gene editing method, and the deep root ratio of the obtained rice mutant is significantly increased. The rice OsIAA9 gene in the application plays a negative regulation function on the deep root ratio, and the method for editing the OsIAA9 gene provided by the application can be applied to drought-resistant breeding of rice, improvement of root configuration and improvement of drought resistance of rice.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and relates to a gene related to crop root growth, in particular to application of an OsIAA9 gene in regulating deep root ratio of crops. BACKGROUND

[0002] Natural disasters such as drought and water shortage occur frequently, which seriously affect global food production. Drought stress seriously affects crop growth and development, and even causes crop death, which is one of the main environmental factors causing food reduction. As one of the important staple foods, rice has a huge water consumption. According to statistics, the water consumption of rice accounts for about 65% of agricultural irrigation water in China. Cloning important drought-resistant genes of rice by using modern biological technology, and genetically modifying the drought-resistant genes of rice by using transgenic or gene editing technology to cultivate new varieties of water-saving and drought-resistant rice is an effective way to alleviate the pressure of global drought and water shortage and population growth on food production.

[0003] Rice drought resistance can be divided into drought tolerance, drought avoidance, recovery drought resistance and the like. Among them, drought avoidance refers to that rice maintains the water potential in the body by reducing the water loss of leaves or promoting the absorption of soil water by roots to avoid the damage caused by drought stress. Studies have shown that rice varieties with strong drought resistance often have more deep roots, so that they can absorb water in deep soil when drought occurs, thereby having stronger drought avoidance. In the research of gramineous crops, the ratio of the number of roots growing downward (with a horizontal angle of 50-90°) to the number of roots growing sideways (with a horizontal angle of 0-50°) is called deep root ratio. Generally, the more the deep root ratio of a plant, the stronger the ability to absorb deep water, and the stronger the drought resistance.

[0004] At present, the genes controlling the deep root ratio of rice have been genetically located and candidate genes have been excavated, and a small number of genes controlling the deep root ratio of rice have been identified, such as DRO1. Studies have shown that high expression of DRO1 can increase the growth angle of roots, making the growth direction more vertical, thereby giving rice a higher deep root ratio and a higher yield under drought stress. More genes regulating the deep root ratio of rice need to be identified for application in the cultivation of water-saving and drought-resistant rice.

[0005] Auxin is one of the main hormones to regulate the growth and development of plant root system. Auxin can induce the expression of a series of early response genes, including Aux / IAA, GH3 and SAUR. Among them, the Aux / IAA gene family is a typical representative of auxin response genes, which mainly interacts with ARF protein as a transcriptional repressor to regulate the expression of downstream genes in the auxin signaling pathway. There are 31 members in the Aux / IAA gene family of rice, and currently only a few members have been identified for their biological functions, such as OsIAA1, OsIAA3, OsIAA6 and OsIAA11. Studies have shown that these genes are related to plant height, tillering, sensitivity to auxin and other traits. In the previous genetic mapping study, our laboratory found that the OsIAA8 gene controls the deep root ratio of rice. The expression of OsIAA8 gene is induced by osmotic stress, abscisic acid and auxin. Overexpression of OsIAA8 can increase the deep root ratio of rice and thus enhance the drought resistance of rice. However, the regulatory effect of other members of the Aux / IAA gene family on the deep root ratio of rice has not been reported. SUMMARY

[0006] In view of the deficiencies in the prior art, the purpose of the present application is to provide an application of OsIAA9 gene in regulating the deep root ratio of crops.

[0007] The purpose of the present application is achieved by the following technical solutions.

[0008] In the first aspect, the present application provides an application of OsIAA9 gene in regulating the deep root ratio of crops, wherein the nucleotide sequence of the OsIAA9 gene is shown in SEQ ID NO: 1.

[0009] As a preferred solution, the amino acid sequence encoded by the OsIAA9 gene is shown in SEQ ID NO: 2.

[0010] As a preferred solution, the application is to obtain an OsIAA9 gene mutant by site-directed editing of the nucleotide sequence of the OsIAA9 gene, and the OsIAA9 gene mutant is used to improve the deep root ratio of crops.

[0011] As a preferred solution, the amino acid sequence encoded by the OsIAA9 gene mutant is shown in SEQ ID NO: 6 or SEQ ID NO: 7; and / or

[0012] The nucleotide sequence of the OsIAA9 gene mutant is shown in SEQ ID NO: 4 or SEQ ID NO: 5.

[0013] As a preferred solution, the crop is rice.

[0014] As a further preferred solution, the rice variety includes Nipponbare.

[0015] In a second aspect, the present application provides an OsIAA9 gene mutant, wherein the amino acid sequence encoded by the OsIAA9 gene mutant is shown as SEQ ID NO: 6 or SEQ ID NO: 7; and / or

[0016] The nucleotide sequence of the OsIAA9 gene mutant is shown as SEQ ID NO: 4 or SEQ ID NO: 5.

[0017] In a third aspect, the present application provides a gene editing recombinant vector of an OsIAA9 gene, which is obtained by recombining a target sequence of OsIAA9 gene editing to a pCRISPR / Cas9 gene editing vector.

[0018] The target sequence is shown as SEQ ID NO: 3; and the nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO: 1.

[0019] In a fourth aspect, the present application provides a construction method of a gene editing recombinant vector of an OsIAA9 gene, comprising the following steps:

[0020] The target sequence of gene editing is designed according to the nucleotide sequence of the OsIAA9 gene, and then a DNA fragment of the target sequence is amplified by designing primers, and then the DNA fragment is cloned to the pCRISPR / Cas9 gene editing vector, thereby obtaining the gene editing recombinant vector of the OsIAA9 gene;

[0021] The target sequence is shown as SEQ ID NO: 3; and the nucleotide sequence of the OsIAA9 gene is shown as SEQ ID NO: 1.

[0022] The primer sequence for amplifying the DNA fragment of the target sequence is shown as SEQ ID NO: 10 and SEQ ID NO: 12.

[0023] In a fifth aspect, the present application provides an engineered bacterium comprising the gene editing recombinant vector of the OsIAA9 gene as described above.

[0024] As a preferred solution, the engineered bacterium is Agrobacterium EHA105 comprising the gene editing recombinant vector of the OsIAA9 gene.

[0025] As a preferred solution, the engineered bacterium is obtained by transforming the gene editing recombinant vector comprising the OsIAA9 gene into Agrobacterium EHA105.

[0026] In a sixth aspect, the present application provides an application of the gene editing recombinant vector of the OsIAA9 gene as described above or the engineered bacterium as described above in improving the deep root ratio of crops.

[0027] As a preferred solution, the crop is rice.

[0028] As a further preferred solution, the rice variety includes Nipponbare.

[0029] Compared with the prior art, the present application has the following beneficial effects:

[0030] By using the CRISPR / Cas9 technology to edit the target point of the OsIAA9 gene shown in SEQ ID NO. 2, a rice mutant with improved deep root ratio can be obtained, and the drought resistance of rice can be further enhanced. The OsIAA9 gene of the present application negatively regulates the deep root ratio of rice, and the gene editing can be applied to plant drought resistance breeding, improve the root configuration, and improve the stress resistance of plants.

[0031] The present application can be used to study the molecular method of obtaining transgenic plants by genetic transformation of the gene.

[0032] The rice gene of the present application can be applied to plant stress resistance breeding. BRIEF DESCRIPTION OF DRAWINGS

[0033] Other features, objects and advantages of the present application will become more apparent from the following detailed description of non-limiting embodiments, made with reference to the following drawings:

[0034] Figure 1 For identification of the OsIAA9 gene knockout mutant, from top to bottom, in turn, are the schematic diagram of OsIAA9 at the end point mutation site of the mutant, the nucleic acid sequence near the CISPR / Cas9 target point and the gene sequencing peak diagram; NIP: wild type rice (Nipponbare), iaa9-1 and iaa9-2: OsIAA9 gene knockout rice mutant.

[0035] Figure 2 For the OsIAA9 gene knockout rice mutant of the present application and the deep root ratio comparison of wild type rice, wherein, Figure 2 A is a root growth photo; Figure 2 B is the deep root ratio result; Figure 2 C is the shallow root number result; Figure 2 D is the deep root number result; NIP: wild type rice (Nipponbare), iaa9-1 and iaa9-2: OsIAA9 gene knockout rice mutant. DETAILED DESCRIPTION

[0036] For the purposes of promoting an understanding of the principles of the application, reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the application is intended by the illustration of embodiments. Any alterations and further modifications in the described embodiments, and any further applications of the principles of the application as described herein are contemplated with the scope of the application as defined by the appended claims.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for describing particular embodiments only and is not intended to be limiting of the application. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0038] The present application is based on the previous research results, further by gene knockout and deep root ratio identification of multiple OsIAA8 homologous genes, only found that OsIAA9 participates in regulating the deep root ratio of rice. Thus the present application provides a method for improving the deep root ratio of rice by knocking out OsIAA9 gene.

[0039] The present application will now be described in detail by way of examples:

[0040] Example 1 Cloning of rice OsIAA9 gene

[0041] 1. Seedling cultivation

[0042] The rice (Nipponbare) seeds were placed at 30°C for germination for 48 hours, and then sowed in a greenhouse. When the rice leaves were 3-5, DNA or RNA was prepared.

[0043] 2. RNA isolation:

[0044] Extraction of RNA: The sampled leaf blades were ground into powder after being frozen with liquid nitrogen in a mortar, added to a 2 mL EP tube containing 1 mL of RNzol-A+ reagent (Tiangen Biotech Co., Ltd.), shaken well, and then placed at room temperature for 5 min. Then 0.2 mL of chloroform was added, shaken vigorously for 15 s, and then placed at room temperature for 3 min. After centrifugation at 4°C and 12000 rpm for 10 min, the supernatant was transferred to a new 2 mL EP tube, and an equal volume of isopropanol was added to precipitate the RNA. Then 100 μL of RNase-free ddH2O was added for dissolution. The quality of the total RNA was identified by electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0045] 3. Reverse transcription reaction

[0046] The synthesis of the first-strand cDNA was performed according to the instructions of the reverse transcription kit (EasyScript one-step gDNA Removal and cDNA Synthesis Super Mix). The following mixed liquid reaction system (20 μL) was prepared:

[0047]

[0048] The above reaction system was subjected to denaturation and annealing reaction on a PCR instrument:

[0049] 42°C for 15 min

[0050] 85°C for 5 s

[0051] Reverse transcription to synthesize the first-strand cDNA

[0052] The prepared cDNA can be used immediately or stored at -20°C for later use.

[0053] 4. Amplification of the rice OsIAA9 gene

[0054] Through searching the rice genome and full-length gene database, it was speculated that the OsIAA9 gene might be related to deep root ratio, and thus the predicted coding region cDNA sequence of the candidate gene LOC_Os02g56120 in the rice deep root ratio QTL interval was obtained. The upstream and downstream primers were designed according to the prediction information:

[0055] IAA9f (5’TCACAACTACTAGAAATCCAGCCA 3’, SEQ ID NO: 8) and IAA9r (5’AGCTCTTTCTCTCGTCCTAACA 3’, SEQ ID NO: 9),

[0056] OsIAA9 gene was cloned directly from cDNA, gel recovery, connected to pEASY-Blunt vector, identified and then sequenced, and the sequencing results were confirmed by BLAST comparison. The results show that the length of the coding region cDNA of rice OsIAA9 in the application is 549 bp, the detailed nucleotide sequence is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2.

[0057] Example 2: Obtaining of rice mutant with OsIAA9 gene knocked out by CRISPR / Cas9

[0058] 1. Construction of OsIAA9 gene CRISPR / Cas9 knockout vector

[0059] According to the CDS sequence of OsIAA9 gene, the target point of gene editing is selected, and the selected gRNA target point is GGATTCAGGGAGGCGTTCC, as shown in SEQ ID NO:3. According to this target point, the primers of OsU6a-target and gRNA-target are designed and synthesized:

[0060] F: GGAACGCCTCCCTGAATCC CGGCAGCCAAGCCAGCA (SEQ ID NO:10)

[0061] R: GGATTCAGGGAGGCGTTCC GTTTTAGAGCTAGAAAT (SEQ ID NO:11)

[0062] The reaction system used is as follows:

[0063]

[0064]

[0065] Taking pYLgRNA-OsU6a / LacZ plasmid as a template, F and gR-R

[0066] (CGGAGGAAAATTCCATCCAC, SEQ ID NO:12), U-F(

[0067] CTCCGTTTTACCTGTGGAATCG, SEQ ID NO:13) and R are primers, and the amplification of OsU6a-target fragment and gRNA-target fragment is carried out in the above two reaction systems, respectively. KOD plus polymerase is used for PCR reaction, 25 cycles: 94℃ 10s, 58℃ 15s, 68℃ 20s. The PCR products are detected by electrophoresis.

[0068] Take 1 μL of each of the two PCR products of the first round as a template, and use primers U-GAL

[0069] The second round of PCR was performed using the primers Pgs-GAR-F (ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG, SEQ ID NO: 14) and Pgs-GAR-R (TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCCATCCACTCCAAGCTCTTG, SEQ ID NO: 15) with KOD plus polymerase for 30 cycles of 94°C for 10 s, 58°C for 15 s, and 68°C for 20 s. The product was recovered by gel electrophoresis and the gRNA expression cassette was obtained.

[0070] The reaction system used in the second round of PCR was as follows:

[0071]

[0072] Recombination of the gRNA expression cassette and pYLCRISPR / Cas9:

[0073] Linearization of the pYLCRISPR / Cas9 vector: 20 U of Bsa I was used to cut ~2 μg of the pYLCRISPR / Cas9 vector in a 50 μl reaction for about 30 min. 2 μL (~80 ng) was electrophoresed to confirm the ccdB band. The recombination reaction system was prepared according to the following table and the recombination reaction was performed:

[0074]

[0075] The reaction was performed at 37°C for 30 min, and then the transformation was directly performed. The positive clones were selected on LB plates containing kanamycin, and the next day, the positive clones were shaken and detected by PCR using the 1300F / 1300R primers and sequenced. The identified positive clones were used for plasmid extraction, and the obtained plant expression vector plasmid DNA was used for rice genetic transformation.

[0076] 2. Agrobacterium transformation

[0077] (1) Preparation of Agrobacterium tumefaciens (EHA105) competent cells:

[0078] The Agrobacterium tumefaciens bacterial solution was cultured at 28°C until the OD600 was 0.5, and then centrifuged at 4°C to collect the bacterial cells. The bacterial cells were resuspended in 500 μL of 0.1 mol / L ice bath CaCl2, and then centrifuged after ice bath for 30 min. The supernatant was removed, and the bacterial cells were resuspended in 100 μL of 0.1 mol / L ice CaC12, and then stored at 4°C.

[0079] (2) Agrobacterium transformation by freeze-thaw method:

[0080] To the Agrobacterium competent cells (100 μL), add 5 μL plant expression vector plasmid DNA, mix gently, ice water bath for 30 min, then freeze in liquid nitrogen for 2 min; add 400-800 μL YEP culture solution (containing kanamycin, Kan); 28°C, 200 r / min shaking culture for 3-5 h; room temperature centrifugation (5000 r / min, 5 min), reserve 100 μL supernatant to resuspend the bacterial cells, spread on LB solid medium (containing Kan), 28°C inverted culture for 2 days until the appropriate size of the colonies, pick single colonies for PCR detection, and obtain positive strains.

[0081] 3. Callus induction: Nipponbare seeds are rinsed with sterile water for 15-20 min, then sterilized with 75% ethanol for 1 min, then oscillated with 1.5% effective concentration of sodium hypochlorite solution for 20 min. Finally, rinse with sterile water for 5 times. The washed seeds are dried with water-absorbing paper and inoculated in callus induction medium, and cultured in dark at 25°C for 2 weeks.

[0082] Induction of callus medium: use the induction medium in Table 1, add 0.3 g proline, 0.6 g hydrolyzed casein enzyme, 30 g sucrose and 2.5 mL 2,4-D (concentration 1 mg / mL), make 1 L solution, adjust pH to 5.9, add 7 g agar powder, high temperature and high pressure sterilization.

[0083] 4. Subculture: cut the embryonic callus and inoculate into subculture medium, and cultured in dark at 25°C for 2 weeks.

[0084] Subculture medium: use the subculture medium in Table 1, add 0.5 g proline, 0.6 g hydrolyzed casein enzyme, 30 g sucrose and 2 mL 2,4-D (concentration 1 mg / mL), make 1 L solution, adjust pH to 5.9, add 7 g agar powder, high temperature and high pressure sterilization.

[0085] 5. Agrobacterium infiltration and co-culture of callus: Agrobacterium after transformation in step 2, pick positive single colonies, in 1 mL Agrobacterium culture solution (containing antibiotics), 28°C culture overnight; take the above culture, add 50 mL Agrobacterium culture solution (containing antibiotics), 28°C culture to OD600=0.6-1.0. Centrifuge the obtained Agrobacterium solution, add the collected bacterial cells to the suspension culture solution, shake culture for 30 min to OD600=0.6-1.0. Then put the callus into the suspension culture solution containing Agrobacterium solution, shake culture for about 20 min. Dry the callus after shaking culture on sterile filter paper, transfer to co-culture medium, 25°C dark culture for 5 d.

[0086] Suspension culture medium: Using the suspension culture medium in Table 1, add 0.08 g hydrolyzed casein, 2 g sucrose, and 0.2 mL 2,4-D (concentration 1 mg / mL) to prepare a 100 mL solution. Adjust the pH to 5.4, divide into two bottles (50 mL each), and autoclave. Before use, add 1 mL 50% glucose and 100 μL AS (100 mM).

[0087] Co-culture medium: Use the co-culture medium in Table 1, add 0.8 g hydrolyzed casein, 20 g sucrose and 3.0 mL 2,4-D (concentration 1 mg / mL) to prepare a 1 L solution, adjust the pH to 5.6, add 7 g agar powder, and autoclave. Before use, add 20 mL 50% glucose and 1 mL AS (100 mM).

[0088] 6. Screening culture: After co-culturing for 3 days, select good callus tissues, transfer them to screening culture medium, and incubate in the dark at 25℃ for 2 weeks, and screen twice.

[0089] Screening medium: The screening medium in Table 2 was used. 0.6 g hydrolyzed casein, 30 g sucrose, and 2.5 mL 2,4-D (concentration 1 mg / mL) were added to prepare a 1 L solution. The pH was adjusted to 6.0, and 7 g agar powder was added. The solution was then autoclaved. Before use, 1 mL Hn and 1 mL Cn (100 ppm) were added.

[0090] 7. Differentiation culture: Embryogenic callus tissue was picked and inoculated into differentiation medium, and cultured at 24℃ for 16h / 8h light and dark to induce differentiated shoots (4-6 weeks).

[0091] Differentiation medium: The differentiation medium in Table 2 was used. 2.0 mg / L 6-BA, 2.0 mg / L KT, 0.2 mg / L NAA, 0.2 mg / L IAA, 1.0 g hydrolyzed casein and 30 g sucrose were added to prepare a 1 L solution. The pH was adjusted to 6.0, 7 g agar powder was added, and the solution was autoclaved at high temperature.

[0092] 8. Rooting culture: When the bud grows to about 2cm, cut off the bud and insert it into the rooting culture medium. Induce rooting by culturing at about 25℃ for 16h / 8h in light and dark.

[0093] Rooting medium: Use the rooting medium in Table 2, add 30g of sucrose to make 1L solution, adjust the pH to 5.8, add 7g of agar powder, and autoclave.

[0094] 9. Transgenic plant culture: After the root system is well developed, open the test tube, add sterile water to harden the seedlings for 2-3 days, then take out the plants, wash off the attached solid culture medium with sterile water, and transfer them into the soil. Initially, provide shade and shelter from the wind. After the plants are strong, carry out conventional field or greenhouse management and culture to obtain transgenic plants.

[0095] Table 1. Components of the basic culture medium

[0096]

[0097] Table 2. Components of the basic culture medium

[0098]

[0099] 10. Positive detection of CRISPR / Cas9 knockout vector transgenic rice

[0100] (1) Genomic DNA extraction (crude extraction method): According to the instructions of the plant genomic DNA rapid extraction kit (Beijing TransGen Biotechnology Co., Ltd.), take leaves, cut them into pieces, add 20 μL of extraction solution P1, centrifuge briefly at 95℃ for 5 min, add 20 μL of neutralization solution P2, and centrifuge briefly.

[0101] (2) Primers were designed based on the vector selection marker HptII (HptF: CGTTATGTTTATCGGCACTTTG, SEQ ID NO: 16; HptR: TTGGCGACCTCGTATTGG, SEQ ID NO: 17). PCR was performed using crude DNA as a template to detect whether the transgenic plants were positive. The DNA of most transgenic plants amplified the expected PCR products, indicating that they were positive plants.

[0102] 11. Identification of knockout targets in CRISPR / Cas9 knockout IAA9 transgenic rice

[0103] Primers IAA9CF:TCAGATCATCGGCATGGAGC (SEQ ID NO:18) and IAA9CR:TAGCTACTGACCTTGGTGGT (SEQ ID NO:19) were designed based on the knockout target. PCR was performed using crude DNA as a template, and the PCR products were sequenced. The determined sequences were then compared with the gene sequences in the wild-type (NIP) genome. Results are as follows: Figure 1 The results showed that different numbers of bases were deleted from the target site in some strains (iaa9-1 and iaa9-2), indicating that OsIAA9 knockout mutants were obtained. The nucleotide sequence of the target gene in the iaa9-1 mutant is shown in SEQ ID NO:4, and the encoded amino acid sequence is shown in SEQ ID NO:6 (translation extraction was terminated due to the mutation). The nucleotide sequence of the target gene in the iaa9-2 mutant is shown in SEQ ID NO:5, and the encoded amino acid sequence is shown in SEQ ID NO:7 (translation extraction was terminated due to the mutation).

[0104] Example 3: Determination of the deep root ratio of transgenic rice (basket method)

[0105] Seeds of OsIAA9 gene knockout mutants (iaa9-1 and iaa9-2) and wild-type (NIP) seeds were dehulled and sterilized (treated with 75% alcohol for 1 min, 1.5% NaClO for 20 min, and washed 5 times with sterile water), and sown on hygromycin-free 1 / 2 MS medium. After germination for 2-3 days, seeds with good germination and uniform growth were selected and transferred to baskets containing soil and placed in a water tank for planting. After about one month of growth, the baskets were removed from the field, and the number of roots extending beyond the bottom (deep roots) and sides (shallow roots) of the baskets were counted, and the deep root ratio was calculated (deep root ratio = number of deep roots / (number of deep roots + number of shallow roots) * 100).

[0106] The experimental results show that the number of deep roots in the OsIAA9 gene knockout mutant is increased to varying degrees, and its deep root ratio is significantly higher than that of the wild-type plant. Figure 2 The results indicate that knocking out OsIAA9 increases the deep root ratio in rice.

[0107] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0108] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A kind OsIAA9 The application of genes in regulating crop root depth ratio is characterized by, The OsIAA9 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The application described is by... OsIAA9 The nucleotide sequence of a gene is edited at specific sites to obtain... OsIAA9 Gene knockout mutants are used to increase the deep root ratio in crops; The crop in question is rice.

2. The application according to claim 1, characterized in that, The OsIAA9 The amino acid sequence encoded by the gene mutant is shown in SEQ ID NO:6 or SEQ ID NO:7; and / or The OsIAA9 The nucleotide sequence of the gene mutant is shown in SEQ ID NO:4 or SEQ ID NO:

5.

3. A kind OsIAA9 The application of gene editing and recombinant vectors in regulating crop root depth ratio is characterized by, The OsIAA9 Gene editing recombinant vectors, through gene editing, recombinant vectors, OsIAA9 The gene editing target sequence was obtained by recombination into the pCRISPR / Cas9 gene editing vector; The target sequence is shown in SEQ ID NO:3; OsIAA9 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The crop in question is rice.

4. A kind OsIAA9 The application of a method for constructing gene-editing recombinant vectors in regulating the deep root ratio of crops is characterized by, Includes the following steps: according to OsIAA9 The nucleotide sequence of the gene is used to design the target sequence for gene editing. Then, primers are designed to amplify the DNA fragment of the target sequence, which is then cloned into the pCRISPR / Cas9 gene editing vector to obtain the gene. The target sequence is shown in SEQ ID NO:3; OsIAA9 The nucleotide sequence of the gene is shown in SEQ ID NO:1; The crop in question is rice.

5. The application of an engineered bacterium in regulating the deep root ratio of crops, characterized in that, The engineered bacteria contain the species as described in claim 3. OsIAA9 Gene editing and recombination vectors; The crop in question is rice.