A SNP molecular marker, primer and application thereof for identifying growth performance of goats

Abstract

The present invention belongs to the technical field of meat goat breeding, and more specifically, relates to a SNP molecular marker, primer and application thereof for identifying the growth performance of goats. The SNP marker provided by the present invention is significantly correlated with the weight, body length, body height and chest circumference traits of goats. The present invention verifies the effects of the SNP molecular marker on the weight, body length, body height and chest circumference traits of goats at multiple stages, and can be applied to the genetic improvement of large-sized goats, thereby improving the body shape of offspring goats. The SNP marker can be used for auxiliary selection of goat weight, body length, body height and chest circumference traits, and screen goats with large bodies, which has important practical application value for further improving the growth performance of goats and using goats as materials for variety or strain selection.

Description

Technical Field

[0001] The invention belongs to the technical field of meat goat breeding, and more specifically, relates to a SNP molecular marker, a primer and an application thereof for identifying the growth performance of goats. Background Art

[0002] In animal husbandry, improving the growth performance of excellent breeds can effectively improve animal production efficiency and significantly affect economic benefits. Large meat goats usually have a faster growth rate and good meat production performance, and can reach the weight required by the market in a shorter time, thereby improving the economic benefits of farmers. Growth performance parameters comprehensively describe the body data indicators of goats and are important indicators of bone development, overall health and structural integrity. Body weight is directly related to slaughter performance and meat production rate; parameters such as body height and body length are key to evaluating bone development; detailed evaluation of chest circumference, chest width and chest depth not only helps to understand bone development, but is also crucial to studying goat fattening. Therefore, by measuring the body size and shape of goats, their growth performance and meat production ability can be comprehensively evaluated.

[0003] Traditional goat breeding methods have defects such as long cycles and low efficiency, making it difficult to quickly improve reproductive performance. However, advances in genetics and molecular biology have brought revolutionary changes to animal breeding. Molecular marker-assisted selection technology eliminates the interference of environmental factors and directly selects the target genotype, which significantly improves the breeding efficiency and reduces the uncertainty in the breeding process. Single nucleotide polymorphisms are DNA sequence point mutations that are widely present in the genome. They are widely distributed, highly polymorphic, and genetically stable, providing an effective molecular tool for early selection and prediction of goat growth performance.

[0004] Therefore, it is necessary to develop a molecular marker that can screen goat growth traits for rapid identification and breeding of superior goat breeds. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker, primer and application thereof for identifying the growth performance of goats, so as to solve the above technical problems.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] The invention provides a SNP molecular marker for identifying the growth performance of goats, wherein the nucleotide sequence is shown in SEQ ID NO.1, wherein the 51st N of the sequence is a SNP site, and the polymorphism is T or G, and the body size and weight of goats with the TG genotype or TT genotype at the site are greater than those of goats with the GG homozygous genotype at the site.

[0008] The present invention uses Haimen goat blood genomic DNA as a template, detects genotypes by direct sequencing of PCR products, and determines the growth performance of goats by determining the SNP site polymorphism at position 37191325 of goat chromosome 19. In the Haimen goat breeding work, individuals with genotypes of TT and TG at the SNP marker site can be retained for breeding, and individuals with genotypes of GG can be eliminated, thereby gradually improving the growth performance of the Haimen goat population.

[0009] The present invention also provides a specific primer for amplifying the above SNP molecular marker, comprising an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0010] The present invention also provides a kit for detecting the growth performance of goats, and the kit comprises the above-mentioned specific primers.

[0011] Furthermore, the kit also includes 2×Taq Plus Master Mix.

[0012] The present invention also provides the use of the SNP molecular marker, the specific primer of the SNP molecular marker or the kit in identifying the body shape and weight traits of goats.

[0013] The present invention also provides the use of the above-mentioned SNP molecular marker, the above-mentioned specific primer or the above-mentioned kit in goat breeding or assisted goat breeding, wherein the assisted goat breeding is to cultivate goats with large size and heavy weight traits.

[0014] The present invention also provides a method for identifying the body shape and weight traits of goats, comprising the following steps:

[0015] (1) Extracting DNA from goats to be tested;

[0016] (2) using the extracted DNA as a template and using the above-mentioned specific primers to amplify to obtain an amplified product;

[0017] (3) Identifying the genotype at position 51 of the amplified product, and determining the weight and body shape traits of the goat based on the genotype.

[0018] Furthermore, the judgment method is: when the 51st genotype site of the amplified product is TG or TT genotype, it is judged that the goat to be tested has the traits of large size and large weight.

[0019] The present invention has the following beneficial effects:

[0020] The SNP marker provided by the present invention is significantly correlated with the weight, body length, body height and chest girth traits of goats. The present invention verifies the effects of the SNP molecular marker on the weight, body length, body height and chest girth traits of goats at multiple stages, and can be applied to the genetic improvement of large-sized goats, thereby improving the body shape of offspring goats. The SNP marker can be used for auxiliary selection of goat weight, body length, body height and chest girth traits, and screen goats with large body size, which has important practical application value for further improving the growth performance of goats and using goats as materials for variety or strain breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 These are the TT, TG and GG genotype sequencing peak graphs of the SNP marker site, where A is the TT genotype sequencing peak graph, B is the GG genotype sequencing peak graph, and C is the TG genotype sequencing peak graph. DETAILED DESCRIPTION

[0022] The present invention is described in detail with respect to specific examples below, but it should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0023] The English nouns described in the following examples are shown in Table 1.

[0024] Table 1: Comparison of Chinese and English nouns

[0025]

[0026] Example 1: Development of SNP molecular markers for growth traits of meat goats.

[0027] 1. Experimental animals and sample collection: The goats used in the present invention are from Haimen goats bred by the Haimen Yangtze River Delta White Goat Seed Conservation and Breeding Institute in Haimen District, Nantong City, Jiangsu Province and the Haimen Goat Research Institute of Nanjing Agricultural University. Blood samples were collected from healthy goats and basic phenotypic information such as growth trait data was collected for subsequent association analysis experiments.

[0028] The body size of goats was measured manually: using measuring rods, tape measures, and circular measuring instruments, the weight, height, length, chest circumference, chest width, and chest depth were measured in turn according to the ear tag number of each goat. When measuring body size, goats were required to stand on a flat surface with a natural posture. A total of 2,191 complete and valid goat body size data were used in this experiment; 624 Haimen goats were born, 562 were weaned at 2 months old, 553 were 6 months old, and 452 were one year old.

[0029] 2. Extraction of genomic DNA: 5 mL of jugular vein blood was collected from each experimental sample using a disposable vacuum negative pressure anticoagulation blood collection tube, and the blood genomic DNA extraction kit of Beijing Quanshijin Biotechnology Co., Ltd. was used to extract the genomic DNA of the goat blood samples.

[0030] 3. Main instruments: pipette, electronic balance, microwave oven, refrigerator, handheld centrifuge, vortexer, digital constant temperature water bath, high-speed refrigerated centrifuge, micro-spectrophotometer, PCR instrument, electrophoresis instrument, fully automatic digital gel imaging system.

[0031] 4. Main reagents: blood genomic DNA extraction kit, 50×TAE, agarose, 2×Taq Plus MasterMix, 10000×TS-GelRed nucleic acid gel dye, DL2000 Plus DNA Marker.

[0032] 5. Primer design: The Ensembl database (https: / / asia.ensembl.org / index.html) was used to search for the SNP sequence information of the IGF2BP1 gene. The nucleotide sequence is shown in SEQ ID NO.1. Genotyping primers were designed using PrimerPremier 5 software. The primer information is shown in Table 2.

[0033] SEQ ID NO. 1: GGTGATTTCAAAAGAAAGGCGCTTTTCCCCTAGATCTTTAAGGGTGTGTGNGGGGGGGTGGGGGTCTCGGCCTCCCCTACCCCAGCTCTAGGAGACTGTCT.

[0034] Table 2: SNP primer sequences

[0035]

[0036] 6. The PCR amplification system includes: 2×Taq Plus Master Mix 10μL; upstream and downstream primers 0.4μL each; template DNA 1μL; deionized water 8.2μL. The PCR amplification program includes: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 55℃ annealing for 20s, 72℃ extension for 30s, a total of 35 cycles; 72℃ extension for 5min; 4℃ storage after PCR.

[0037] 7. Sample PCR product sequencing and result determination: The above PCR products and primers were sent to Qingke Biotechnology for sequencing, and the sequencing results were compared and analyzed using SnapGene software. Figure 1As shown, the genotype is determined based on the sequencing peak graph: when the peak graph shows a single peak T / G, the genotype is TT / GG; when the peak graph shows a double peak of T and G, the genotype is TG.

[0038] The above results show that the use of primers to amplify goat genomic DNA by PCR and interpret the genotype by direct sequencing can quickly and accurately genotype the goat IGF2BP1 gene SNP site.

[0039] 8. Verification analysis of SNP markers of IGF2BP1 gene in meat goats: One-way ANOVA in SPSS software was used to conduct association analysis between genotype and body weight. The specific linear analysis model calculation formula is as follows:

[0040] Y ij =μ+G i +E ij .

[0041] Among them, Y ij is the individual phenotypic record; μ is the population mean; G i is the genotype effect of each site; E ij The results are expressed as “least square mean ± standard deviation”.

[0042] The results of the association analysis between the IGF2BP1 gene SNP locus and the growth traits of Haimen goats at birth are shown in Table 3. The data in Table 3 show that there is genetic dimorphism at this locus, with a total of three genotypes. By comparing the differences in growth traits between different genotypes through one-way analysis of variance, it was found that in the newborn Haimen goat ram group, the weight of Haimen goats with TT genotype and TG genotype was significantly higher than that of goats with GG genotype, while the weight difference between Haimen goats with TT genotype and Haimen goats with TG genotype was not significant; the body length and chest circumference traits of Haimen goats with TT genotype and TG genotype were significantly higher than those of Haimen goats with GG genotype, while the body length and chest circumference traits of Haimen goats with TT genotype and Haimen goats with TG genotype were not significantly different; the body height trait of Haimen goats with TG genotype was significantly higher than that of Haimen goats with GG genotype, while the body height difference between Haimen goats with TT genotype and Haimen goats with TG genotype was not significant. In the group of newborn Haimen goat ewes, the weight of Haimen goats with GG genotype was significantly lower than that of Haimen goats with TG and TT genotypes; in terms of body height trait, the body height trait of TT genotype and TG genotype was significantly higher than that of GG genotype, while there was no significant difference in body height trait between TT genotype and TG genotype; in terms of chest circumference trait, the chest circumference of GG genotype lambs was significantly lower than that of TT genotype lambs, while there was no significant difference in chest circumference trait between TT genotype and TG genotype; there was no significant difference in body length trait among the three genotype lambs, but the body length index of TT genotype and TG genotype was higher than that of GG genotype.

[0043] Table 3: Results of association analysis between IGF2BP1 gene SNP loci and growth traits of Haimen goats at birth

[0044]

[0045] Note: The lowercase letters in the table represent the intra-group difference analysis of the same trait in the same sex, and the significance is p <0.01.

[0046] The results of association analysis between the IGF2BP1 gene SNP loci and the growth traits of 2-month-old Haimen goats are shown in Table 4. As shown in Table 4, in the ram population, the weight traits of Haimen goats with TT genotype and TG genotype were significantly higher than those with GG genotype, while the weight traits of Haimen goats with TT genotype and TG genotype were not significantly different; the body length, body height and chest circumference traits of Haimen goats with TG genotype were significantly higher than those with GG genotype, while the body length, body height and chest circumference traits of Haimen goats with TG genotype were not significantly different from those of Haimen goats with TT genotype. In the ewe population, the weight, body length and chest circumference traits of Haimen goats with TT genotype and TG genotype were significantly higher than those with GG genotype, while the weight, body length and chest circumference traits of Haimen goats with TT genotype and TG genotype were not significantly different; the body height traits of TT genotype and TG genotype were higher than those of GG genotype.

[0047] Table 4: Results of association analysis between IGF2BP1 gene SNP loci and growth traits of 2-month-old Haimen goats

[0048]

[0049] Note: The lowercase letters in the table represent the intra-group difference analysis of the same trait in the same sex, and the significance is p <0.01.

[0050] The results of association analysis between the IGF2BP1 gene SNP loci and the growth traits of 6-month-old Haimen goats are shown in Table 5. As can be seen from Table 5, in the ram population, the weight, height and chest circumference of Haimen goats with TT genotype and TG genotype were significantly higher than those of Haimen goats with GG genotype, while there was no significant difference in weight, height and chest circumference between Haimen goats with TT genotype and TG genotype; the body length trait of Haimen goats with TT genotype was significantly higher than that of Haimen goats with GG genotype and TG genotype. In the ewe group, the weight trait of Haimen goats with TT genotype and TG genotype was significantly higher than that of Haimen goats with GG genotype, while there was no significant difference in weight trait between Haimen goats with TT genotype and TG genotype; in terms of body length trait, the body length trait of Haimen goats with TT genotype and TG genotype was significantly higher than that of Haimen goats with GG genotype, but there was no significant difference in body length trait between Haimen goats with TT genotype and TG genotype; in terms of body height trait, the body length trait of Haimen goats with TT genotype and TG genotype was significantly higher than that of Haimen goats with GG genotype, but there was no significant difference in body height trait between Haimen goats with TT genotype and TG genotype; the chest circumference trait of Haimen goats with TT genotype and TG genotype was higher than that of Haimen goats with GG genotype.

[0051] Table 5: Results of association analysis between IGF2BP1 gene SNP loci and growth traits of 6-month-old Haimen goats

[0052]

[0053] Note: The lowercase letters in the table represent the intra-group difference analysis of the same trait in the same sex, and the significance is p <0.01.

[0054] As shown in the results of Table 6, the results of growth trait analysis of adult Haimen goat ewes showed that the weight and body size traits of adult Haimen goats with TT genotype and TG genotype were significantly higher than those with GG genotype.

[0055] Table 6: Association analysis between IGF2BP1 gene SNP loci and growth traits of adult Haimen goat ewes

[0056]

[0057] Note: The lowercase letters in the table are the intra-group difference analysis of the same trait, and the significance is p <0.01.

[0058] In the breeding of Haimen goats, individuals with the genotype of the SNP marker site TT can be retained for breeding and individuals with the genotype of GG can be eliminated. TT genotype individuals can also be bred with TG genotype individuals to obtain more TT genotype individuals until GG genotype individuals are eliminated, thereby gradually improving the weight and growth performance of the Haimen goat population, and further realizing the breeding of large-bodied goats to increase production and improve quality and efficiency.

[0059] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

Claims

1. A SNP molecular marker for identifying the growth performance of Haimen goats, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1. The N at position 51 of the sequence is a SNP site, and the polymorphism is T or G. The body size and weight of Haimen goats with TG genotype or TT genotype at the site are greater than those with GG homozygous genotype at the site.

2. Use of the detection reagent for the SNP molecular marker according to claim 1 in identifying the body shape and weight traits of Haimen goats.

3. The use of the SNP molecular marker detection reagent according to claim 1 in Haimen goat breeding or assisting Haimen goat breeding, characterized in that: The auxiliary Haimen goat breeding is to cultivate Haimen goats with large size and large weight traits in which the 51st site of the SEQ ID NO.1 sequence is a TG genotype or a TT genotype.

4. A method for identifying the body shape and weight traits of Haimen goats, characterized in that: The following steps are involved: (1) Extracting DNA of Haimen goats to be tested; (2) amplifying the extracted DNA as a template to obtain an amplified product sequence as shown in SEQ ID NO.1; (3) Identifying the genotype at position 51 of SEQ ID NO.1 and determining the weight and body shape traits of Haimen goats based on the genotype; (4) The judgment method is: when the genotype site at position 51 of the amplified product SEQ ID NO.1 is TG or TT genotype, it is judged that the Haimen goat to be tested has the traits of large size and large weight.

Images