Method for detecting common pollution indicator bacteria in MSC preparation

Abstract

The invention discloses a method for detecting common pollution indicator bacteria in a cell preparation, and belongs to the technical field of biological preparation detection. Compared with a direct inoculation method, a membrane filtration method and a fluorescent quantitative PCR method, the detection method provided by the invention has remarkable advantages, the detection time of the direct inoculation method and the membrane filtration method is 14d and does not meet the release detection standard of the cell preparation (less than 6h), the cost of the fluorescent quantitative PCR method is high, and the application technology of the method is not mature. According to the detection method, after the influence of the MSC is removed, the indicator bacterium genome is extracted for PCR verification, the detection result can be obtained only by 4-5 h in the whole operation process, the detection limit can be smaller than or equal to 100 CFU / mL, and the detection method has important application value for detecting common pollution indicator bacteria in the MSC preparation.

Description

Technical Field

[0001] The invention belongs to the technical field of biological preparation detection, and in particular relates to a method for detecting common contamination indicator bacteria in MSC preparations. Background Art

[0002] With the rapid development of biotechnology, emerging biological products have provided possibilities for preventing and treating diseases, enhancing immune function, and delaying aging. As emerging drug preparations with living cells as carriers, cell preparations can utilize the active tropism, low immunogenicity, and deformability of living cells to achieve efficient retention of drugs in the body and effective enrichment of target sites, and have broad application prospects for the treatment of targeted diseases. At present, the research on living cell carriers is mostly focused on stem cells, T cells, monocytes, macrophages, neutrophils, red blood cells, and platelets. Different cell carriers are selected according to needs. Among them, mesenchymal stem cells (MSC) have become a research boom in the field of cytology because of their multidirectional differentiation, immune regulation, delaying aging, and disease treatment. However, MSC preparations often have the hidden danger of microbial contamination. Once MSC preparations are infected with pathogenic microorganisms, they will cause the MSC preparations to deteriorate at the least, and induce inflammatory reactions at the worst, which seriously threatens the health of patients.

[0003] MSC preparations strictly control the number of microorganisms (≤100 CFU / mL), but the poor timeliness of microbial detection has become a key factor restricting the release and clinical application of cell preparations. The classic sterility detection method is time-consuming and cannot detect the contamination status of cell preparations in real time. The detection data is seriously lagging, which is difficult to meet the risk assessment system of modern medicine. With the rapid development of molecular biology, PCR identification technology has been widely used in sterility detection. This method is not only highly sensitive and broad-spectrum, but also can greatly shorten the detection time. However, the establishment of this method is based on the premise of obtaining a stable genome; bacteria and fungi are the main sources of microbial contamination in cell preparations, and their simple genomes are difficult to obtain, which seriously hinders the application of PCR detection. Therefore, exploring a method that can stably extract the genome of contaminating bacteria in infected MSC preparations plays an important foundation for the sterility detection of cell preparations. Summary of the invention

[0004] One of the objects of the present invention is to provide a method for detecting bacterial contamination in MSC preparations, the method comprising the following steps:

[0005] (1) After centrifugation of 0.8-1.2 mL of the sample to be tested, discard the supernatant;

[0006] (2) Add 0.8-1.2 mL of Lysis Buffer I, mix well, and place on ice for 15-25 min;

[0007] (3) After centrifugation, discard the supernatant;

[0008] (4) Add 700-900 μL DPBS and 15-25 μL proteinase K, mix well and place in a metal bath at 36-38°C for 25-35 min;

[0009] (5) After centrifugation, discard the supernatant;

[0010] (6) Add 0.8-1.2 mL ddH2O, mix well, centrifuge, and discard the supernatant;

[0011] (7) Repeat step (6);

[0012] (8) Add 45-55 μL of lysis buffer II, mix well, centrifuge, and place in a metal bath at 78-82°C for 15-25 min;

[0013] (9) 98-100℃ metal bath for 4-6 minutes, ice bath for 4-6 minutes;

[0014] (10) The supernatant obtained after centrifugation is the DNA template;

[0015] (11) Perform PCR amplification on the DNA template obtained in step (10) using primers SEQ ID NO.1-2. If a 1500 bp band can be amplified, it can be determined that at least one of the following bacteria is mixed in the sample to be tested:

[0016] Staphylococcus albus, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Clostridium sporogenes.

[0017] Preferably, the volume of the sample to be tested in step (1) is 1 mL.

[0018] More preferably, the volume of the lysate I in step (2) is 1 mL.

[0019] More preferably, in step (4), the amount of DPBS added is 800 μL, the amount of proteinase K added is 20 μL, and after mixing, the mixture is placed in a metal bath at 37° C. for 30 min.

[0020] More preferably, the amount of ddH2O used in steps (6) and (7) is 1 mL.

[0021] More preferably, in step (8), the amount of lysate II used is 50 μL, and after mixing and centrifugation, the mixture is placed in a metal bath at 80° C. for 20 min.

[0022] More preferably, in step (9), a 100° C. metal bath is performed for 5 minutes, and an ice bath is performed for 5 minutes.

[0023] A second object of the present invention is to provide a method for detecting fungal contamination in MSC preparations, omitting step (9) and replacing step (11) with the following operation, and the remaining steps are the same as above:

[0024] The DNA template obtained in step (10) is amplified by PCR using primers SEQ ID NO.3-4. If a band of 500-750 bp can be amplified, it can be determined that at least one of the following fungi is mixed in the sample to be tested:

[0025] Candida albicans, Aspergillus niger.

[0026] The third object of the present invention is to provide an application of the above method for detecting bacterial contamination in MSC preparations to detect whether bacterial contamination occurs in MSC preparations.

[0027] A fourth object of the present invention is to provide an application of the above method for detecting fungal contamination in MSC preparations to detecting whether fungal contamination occurs in MSC preparations.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) The detection time is significantly shortened; compared with the traditional sterility test method (14 days), this test method can quickly detect 8 common contamination indicator bacteria in MSC preparations within 4-5 hours, meeting the release test standard (≤6 hours).

[0030] (2) High detection sensitivity: This method is based on the PCR detection method and can sensitively amplify the target fragment of the genome of the contaminating indicator bacteria, which is more conducive to the release detection of MCS preparations.

[0031] (3) The operation requirements and costs are significantly reduced. Compared with the fluorescence quantitative PCR method, this method is easy to obtain materials, the operation process is less affected by external factors, and is more suitable for the clinical application and promotion of MSC preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a gel image of the detection of Staphylococcus aureus and Escherichia coli at different detection concentrations in Example 1.

[0033] Figure 2 This is the detection gel image of Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis and Clostridium sporogenes in Example 1.

[0034] Figure 3This is a gel image of the detection of Candida albicans and Aspergillus niger at different detection concentrations in Example 1.

[0035] Figure 4 This is the detection gel image of Candida albicans and Aspergillus niger in Example 1.

[0036] Figure 5 This is a test gel image of the mixed contamination indicator bacteria in Example 2.

[0037] Figure 6 This is a test gel image of the mixed contamination indicator fungi in Example 2. DETAILED DESCRIPTION

[0038] Example 1

[0039] 1. Materials:

[0040] (1) 8 common contamination indicator bacteria

[0041] Bacteria (C≤100 CFU / mL): Staphylococcus albus〔CMCC(B)26069〕, Escherichia coli〔CMCC(B)44102〕, Staphylococcus aureus〔CMCC(B)26003〕, Pseudomonas aeruginosa〔CMCC(B)10104〕, Bacillus subtilis〔CMCC(B)63501〕, Clostridium sporogenes〔CMCC(B)64941〕.

[0042] Fungi (C≤100 CFU / mL): Candida albicans〔CMCC(F)98001〕, Aspergillus niger〔CMCC(F)98003〕.

[0043] (2) MSC preparation: MSC 1.2×10 6 CFU / mL+20% human albumin.

[0044] (3) Reagents: NaCl solution, lysis buffer I (0.3% SDS 100 μL, 4% KCl 50 μL, Triton X-100 2 μL, ddH2O 845 μL), DPBS (pH = 7.2-7.4), proteinase K (manufacturer: TaKaRa, catalog number: 9034), lysis buffer II (Lysis buffer for microoganism to direct PCR, manufacturer: TaKaRa, catalog number: 9164), Gold Mix (Green), agarose, 50×TAE buffer.

[0045] (4) Equipment: high-speed centrifuge (Micro CL17), constant temperature metal bath (ThermoLT), PCR instrument (DHP-9052B), electrophoresis instrument (Basic-p), gel imager (GBOXF3), ice machine (Snowflake).

[0046] 2. Operation process

[0047] Bacteria detection:

[0048] (1) Use NaCl solution (normal saline) to prepare bacterial suspensions of six common contamination indicator bacteria (C ≤ 1000 CFU / mL).

[0049] (2) The experimental group (A): 1 mL of MSC preparation + 100 μL of bacterial suspension (Staphylococcus aureus or Escherichia coli or Staphylococcus aureus or Pseudomonas aeruginosa or Bacillus subtilis or Clostridium sporogenes), the positive extraction control group (B): 100 μL of bacterial suspension (Staphylococcus aureus or Escherichia coli or Staphylococcus aureus or Pseudomonas aeruginosa or Bacillus subtilis or Clostridium sporogenes), and the negative extraction control group (MSC): 1 mL of MSC preparation were placed in 1.5 mL centrifuge tubes to prepare samples to be tested. Letters are used to represent the respective groups in the subsequent description.

[0050] (3) Transfer the sample to be tested to a high-speed centrifuge and centrifuge at 15,000 g for 10 min. Discard the supernatant (remaining 50-100 μL) and flick the bottom precipitate to mix well.

[0051] (4) Add 1 mL of Lysis Buffer I to the tube, mix by inverting, and place on ice for 20 min.

[0052] (5) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0053] (6) Add 800 μL DPBS and 20 μL proteinase K into the tube, shake it 5 times to mix well, and place it in a metal bath at 37°C for 30 min.

[0054] (7) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0055] (8) Add 1 mL of ddH2O to the tube, shake it five times to mix, centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix.

[0056] (9) Repeat step (8). In this step, when discarding the supernatant, aspirate the liquid inside the centrifuge.

[0057] (10) Add 50 μL of Lysis Buffer II to the tube, shake it 5 times to mix, centrifuge it briefly, and place it in a metal bath at 80°C for 20 min.

[0058] (11) Take out the centrifuge tube, place it in a metal bath at 100°C for 5 min, and then immediately place it in an ice bath for 5 min.

[0059] (12) Centrifuge at 15000 g for 5 min and transfer 20 μL of the supernatant to a PCR tube to obtain a DNA template.

[0060] (13) Prepare PCR system (20 μL), TaKaRa Taq TM HS Low DNA 10μL, 16s-F (SEQ ID NO.1: AGAGTTTGATCATGGCTCAG) 1μL, 16s-R (SEQ ID NO.2: TACGGTTACCTTGTTACGAC) 1μL, DNA template 2μL (bacterial DNA extracted by the kit as positive +, ddH2O as negative -), ddH2O 6μL.

[0061] (14) PCR reaction: 94°C for 5 min, (94°C for 20 s, 55°C for 20 s, 72°C for 1 min) 40×, 72°C for 5 min.

[0062] (15) Prepare 1% agarose gel, apply sample (5 μL), run electrophoresis at 150 V for 20 min, and take pictures with a gel imager.

[0063] Fungal Detection:

[0064] (1) Use NaCl solution (normal saline) to prepare bacterial suspensions of two common contamination indicator fungi (C ≤ 1000 CFU / mL).

[0065] (2) Prepare samples to be tested; place the experimental group (A): 1 mL MSC preparation + 100 μL bacterial suspension (Candida albicans or Aspergillus niger), the positive extraction control group (B): 100 μL bacterial suspension (Candida albicans or Aspergillus niger), and the negative extraction control group (MSC): 1 mL MSC preparation in 1.5 mL centrifuge tubes respectively and mix thoroughly.

[0066] (3) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom precipitate to mix well.

[0067] (4) Add 1 mL of Lysis Buffer I to the tube, mix by inverting, and place on ice for 20 min.

[0068] (5) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0069] (6) Add 800 μL DPBS and 20 μL proteinase K into the tube, shake it 5 times to mix well, and place it in a metal bath at 37°C for 30 min.

[0070] (7) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0071] (8) Add 1 mL of ddH2O to the tube, shake it five times to mix, centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom precipitate to mix well.

[0072] (9) Repeat step (8). In this step, when discarding the supernatant, aspirate the liquid inside the centrifuge.

[0073] (10) Add 50 μL of Lysis Buffer II to the tube, shake it 5 times to mix, centrifuge it briefly, and place it in a metal bath at 80°C for 20 min.

[0074] (11) Centrifuge at 15000 g for 5 min and transfer 20 μL of the supernatant to a PCR tube to obtain a DNA template.

[0075] (12) Prepare PCR system (25 μL), including 20 μL of Gold Mix (Green), 1 μL of UF (SEQ ID NO. 3: TCCGTAGGTGAACCTTGCGG), 1 μL of UR (SEQ ID NO. 4: TCCTCCGCTTATTGATATGC), and 3 μL of DNA template (fungal DNA extracted by the kit as positive +, and ddH2O as negative -).

[0076] (13) PCR reaction: 98°C for 2 min, (98°C for 10 s, 55°C for 30 s, 72°C for 40 s) 35×, 72°C for 5 min.

[0077] (14) Prepare 1% agarose gel, apply sample (5 μL), run electrophoresis at 150 V for 20 min, and take pictures with a gel imager.

[0078] 3. Test results:

[0079] (1) Bacterial test results

[0080] Gel imaging showed that Staphylococcus albus, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Clostridium sporogenes and the positive control group all had obvious bands, and the band size (about 1500bp) was consistent with the positive (+) band; the negative control and negative (-) did not have a band at about 1500bp, indicating that when the 6 common contamination indicator bacteria with C≤100CFU / mL are present in MSC preparations, this detection method can quickly detect them.

[0081] Detection gel images of 6 common contamination indicator bacteria Figure 1-2 shown.

[0082] (2) Fungal test results

[0083] Gel imaging showed that Candida albicans, Aspergillus niger and the positive control group with C≤100CFU / mL all had obvious bands, and the band size (about 500-750bp) was consistent with the positive (+) band; the negative control and negative (-) did not have bands at about 500-750bp, indicating that this detection method can effectively detect two common contaminating fungi (C≤100CFU / mL) in infected MSC preparations.

[0084] The test results of two common contamination indicator fungi are as follows Figure 3-4 shown.

[0085] Example 2

[0086] 1. Materials: Same as Example 1.

[0087] 2. Operation process

[0088] Bacterial Mixture Detection:

[0089] (1) Use NaCl solution (normal saline) to prepare a mixed bacterial suspension (C ≤ 1000 CFU / mL) of six common contamination indicator bacteria.

[0090] (2) The experimental group (A): 1 mL MSC preparation + 100 μL mixed bacterial suspension (Staphylococcus aureus + Escherichia coli + Staphylococcus aureus + Pseudomonas aeruginosa + Bacillus subtilis + Clostridium sporogenes, C of each bacterial suspension ≤ 1000 CFU / mL, volume ratio of 1:1:1:1:1:1), the positive extraction control group (B): 100 μL mixed bacterial suspension (Staphylococcus aureus + Escherichia coli + Staphylococcus aureus + Pseudomonas aeruginosa + Bacillus subtilis + Clostridium sporogenes, concentration and ratio are the same as above), and the negative extraction control group (MSC): 1 mL MSC preparation were placed in 1.5 mL centrifuge tubes to prepare samples to be tested. Letters are used to represent the respective groups in the subsequent description.

[0091] (3) Transfer the sample to be tested to a high-speed centrifuge and centrifuge at 15,000 g for 10 min. Discard the supernatant (remaining 50-100 μL) and flick the bottom precipitate to mix well.

[0092] (4) Add 1 mL of Lysis Buffer I to the tube, mix by inverting, and place on ice for 20 min.

[0093] (5) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0094] (6) Add 800 μL DPBS and 20 μL proteinase K into the tube, shake it 5 times to mix, and place it in a metal bath at 37°C for 30 min.

[0095] (7) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0096] (8) Add 1 mL of ddH2O to the tube, shake it five times to mix, centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix.

[0097] (9) Repeat step (8). In this step, when discarding the supernatant, aspirate the liquid inside the centrifuge.

[0098] (10) Add 50 μL of Lysis Buffer II to the tube, shake it 5 times to mix, centrifuge it briefly, and place it in a metal bath at 80°C for 20 min.

[0099] (11) Take out the centrifuge tube, place it in a metal bath at 100°C for 5 min, and then immediately place it in an ice bath for 5 min.

[0100] (12) Centrifuge at 15000 g for 5 min and transfer 20 μL of the supernatant to a PCR tube to obtain a DNA template.

[0101] (14) Prepare PCR system (20 μL), TaKaRa Taq TM HS Low DNA 10μL, 16s-F (SEQ ID NO.1: AGAGTTTGATCATGGCTCAG) 1μL, 16s-R (SEQ ID NO.2: TACGGTTACCTTGTTACGAC) 1μL, DNA template 2μL (bacterial DNA extracted by the kit as positive +, ddH2O as negative -), ddH2O 6μL.

[0102] (14) PCR reaction: 94°C for 5 min, (94°C for 20 s, 55°C for 20 s, 72°C for 1 min) 40×, 72°C for 5 min.

[0103] (15) Prepare 1% agarose gel, apply sample (5 μL), run electrophoresis at 150 V for 20 min, and take pictures with a gel imager.

[0104] Fungal Mix Test:

[0105] (1) Use NaCl solution (normal saline) to prepare a mixed bacterial suspension of two common contamination indicator fungi (C ≤ 1000 CFU / mL).

[0106] (2) Prepare samples to be tested; place the experimental group (A): 1 mL MSC preparation + 100 μL mixed bacterial suspension (Candida albicans + Aspergillus niger, C of each bacterial suspension ≤ 1000 CFU / mL, volume ratio of 1:1), the positive extraction control group (B): 100 μL bacterial suspension (Candida albicans + Aspergillus niger, concentration and ratio as above), and the negative extraction control group (MSC): 1 mL MSC preparation in 1.5 mL centrifuge tubes to prepare samples to be tested. Letters are used to represent the respective groups in the subsequent description.

[0107] (3) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom precipitate to mix well.

[0108] (4) Add 1 mL of Lysis Buffer I to the tube, mix by inverting, and place on ice for 20 min.

[0109] (5) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0110] (6) Add 800 μL DPBS and 20 μL proteinase K into the tube, shake it 5 times to mix well, and place it in a metal bath at 37°C for 30 min.

[0111] (7) Centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix well.

[0112] (8) Add 1 mL of ddH2O to the tube, shake it five times to mix, centrifuge at 15,000 g for 10 min, discard the supernatant (remaining 50-100 μL), and flick the bottom pellet to mix.

[0113] (9) Repeat step (8). In this step, when discarding the supernatant, aspirate the liquid inside the centrifuge.

[0114] (10) Add 50 μL of Lysis Buffer II to the tube, shake it 5 times to mix, centrifuge it briefly, and place it in a metal bath at 80°C for 20 min.

[0115] (11) Centrifuge at 15000 g for 5 min and transfer 20 μL of the supernatant to a PCR tube to obtain a DNA template.

[0116] (13) Prepare PCR system (25 μL), including 20 μL of Gold Mix (Green), 1 μL of UF (SEQ ID NO. 3: TCCGTAGGTGAACCTTGCGG), 1 μL of UR (SEQ ID NO. 4: TCCTCCGCTTATTGATATGC), and 3 μL of DNA template (fungal DNA extracted from the kit as positive +, and ddH2O as negative -).

[0117] (13) PCR reaction: 98°C for 2 min, (98°C for 10 s, 55°C for 30 s, 72°C for 40 s) 35×, 72°C for 5 min.

[0118] (14) Prepare 1% agarose gel, apply sample (5 μL), run electrophoresis at 150 V for 20 min, and take pictures with a gel imager.

[0119] Mixed detection of bacteria + fungi:

[0120] (1) Prepare a mixed bacterial suspension of eight common contamination indicator bacteria (C ≤ 1000 CFU / mL) using NaCl solution.

[0121] (2) The experimental group (A): 1 mL MSC preparation + 100 μL mixed bacterial suspension (Staphylococcus albus + Escherichia coli + Staphylococcus aureus + Pseudomonas aeruginosa + Bacillus subtilis + Clostridium sporogenes + Candida albicans + Aspergillus niger, each bacterial suspension C≤1000 CFU / mL, volume ratio of 1:1:1:1:1:1:1:1:1), the positive extraction control group (B): 100 μL mixed bacterial suspension (Staphylococcus albus + Escherichia coli + Staphylococcus aureus + Pseudomonas aeruginosa + Bacillus subtilis + Clostridium sporogenes + Candida albicans + Aspergillus niger, concentration and ratio are the same as above), and the negative extraction control group (MSC): 1 mL MSC preparation are placed in 1.5 mL centrifuge tubes to prepare the samples to be tested. The experimental group, positive extraction control group and negative control group need to be set up in two parallel groups, one group is tested according to the bacterial mixed detection steps, and the other group is tested according to the fungal mixed detection steps.

[0122] The subsequent operation steps are carried out according to the bacterial mixed detection and fungal mixed detection steps respectively.

[0123] 3. Test results:

[0124] (1) Bacterial mixed test results

[0125] Gel imaging showed that obvious bands appeared in the experimental group (Staphylococcus albus + Escherichia coli + Staphylococcus aureus + Pseudomonas aeruginosa + Bacillus subtilis and Clostridium sporogenes) with C≤100CFU / mL and the positive extraction control group, and the band size (about 1500bp) was consistent with its positive (+) band; no band appeared at about 1500bp in the negative extraction control (MSC) and negative (-), indicating that this detection method can effectively detect the six mixed contamination indicator bacteria with C≤100CFU / mL in the MSC preparation.

[0126] The test gel of 6 kinds of mixed contamination indicator bacteria is shown in the figure Figure 5 shown.

[0127] (3) Fungal mixed test results

[0128] Gel imaging showed that obvious bands appeared in both the experimental group (Candida albicans + Aspergillus niger) with C≤100CFU / mL and the positive extraction control group, and the band size (about 500-750bp) was consistent with its positive (+) band; the negative extraction control (MSC) and negative (-) did not show bands at about 500-750bp, indicating that this detection method can effectively detect two mixed contaminating fungi (C≤100CFU / mL) in infected MSC preparations.

[0129] The test results of two mixed contamination indicator fungi are as follows Figure 6 shown.

[0130] (4) Bacteria + fungi mixed test results

[0131] Gel imaging showed that in the PCR test performed by bacterial primers (16s-F, 16s-R), the experimental group (8 mixed strains, C≤100CFU / mL) and its positive extraction control group both showed obvious bands at 1500bp, and the band size was consistent with the bacterial positive (+) band; the experimental group (8 mixed strains, C≤100CFU / mL) and the positive extraction control group amplified by fungal primers (UF, UR) both showed obvious bands at 500-750bp, and the band size was consistent with their fungal positive (+) band; in addition, the negative control (MSC) and negative (-) amplified by the two primers did not show any bands, indicating that this detection method can effectively detect 8 mixed contamination indicator bacteria (C≤100CFU / mL) in infected MSC preparations.

[0132] The test results of 8 common contamination indicator bacteria are as follows Figure 5-6 shown.

[0133] Example 3

[0134] In order to determine the detection limit of this test method for contamination indicator bacteria, the test used non-infected MSC preparations as a comparative example, and the concentration of contamination indicator bacteria as a variable. The concentrations of two typical contamination bacteria, Escherichia coli and Staphylococcus albus, and two typical contamination indicator fungi, Candida albicans and Aspergillus niger, were adjusted to C≤200CFU / mL and C≤100CFU / mL, respectively. The results showed that at the two test concentrations, this test method could effectively detect the four bacteria, thus determining that the detection limit of this test method for contamination indicator bacteria can reach ≤100CFU / mL.

[0135] The test results of two typical contamination indicator bacteria (Escherichia coli and Staphylococcus aureus) are as follows: Figure 1 shown.

[0136] The test results of two typical contamination indicator fungi (Candida albicans and Aspergillus niger) are as follows Figure 4 shown.

[0137] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for detecting bacterial contamination in MSC preparations, characterized in that: The method comprises the following steps: (1) After centrifugation of 0.8-1.2 mL of the sample to be tested, discard the supernatant; (2) Add 0.8-1.2 mL of Lysis Buffer I, mix well, and place on ice for 15-25 min; (3) After centrifugation, discard the supernatant; (4) Add 700-900 μL DPBS and 15-25 μL proteinase K, mix well and place in a metal bath at 36-38°C for 25-35 min; (5) After centrifugation, discard the supernatant; (6) Add 0.8-1.2 mL ddH2O, mix well, centrifuge, and discard the supernatant; (7) Repeat step (6); (8) Add 45-55 μL of lysis buffer II, mix well, centrifuge, and place in a metal bath at 78-82°C for 15-25 min; (9) 98-100℃ metal bath for 4-6 minutes, ice bath for 4-6 minutes; (10) The supernatant obtained after centrifugation is the DNA template; (11) Perform PCR amplification on the DNA template obtained in step (10) using primers SEQ ID NO.1-2. If a 1500 bp band can be amplified, it can be determined that at least one of the following bacteria is mixed in the sample to be tested: Staphylococcus albus, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Clostridium sporogenes.

2. The method according to claim 1, characterized in that The volume of the sample to be tested in step (1) is 1 mL.

3. The method according to claim 2, characterized in that The volume of the lysate I in step (2) is 1 mL.

4. The method according to claim 3, characterized in that In the step (4), the amount of DPBS added is 800 μL, and the amount of proteinase K added is 20 μL. After mixing, the mixture is placed in a metal bath at 37° C. for 30 minutes.

5. The method according to claim 4, characterized in that The amount of ddH2O used in steps (6) and (7) is 1 mL.

6. The method according to claim 5, characterized in that In step (8), the amount of lysate II used is 50 μL. After mixing and centrifugation, the mixture is placed in a metal bath at 80° C. for 20 min.

7. The method according to claim 6, characterized in that In the step (9), the mixture is heated in a 100° C. metal bath for 5 minutes and then in an ice bath for 5 minutes.

8. A method for detecting fungal contamination in MSC preparations, characterized in that: Step (9) is omitted, and step (11) is replaced by the following operation, and the remaining steps are the same as any one of claims 1 to 7: The DNA template obtained in step (10) is amplified by PCR using primers SEQ ID NO.3-4. If a band of 500-750 bp can be amplified, it can be determined that at least one of the following fungi is mixed in the sample to be tested: Candida albicans, Aspergillus niger.

9. Use of the method according to any one of claims 1 to 7 for detecting whether bacterial contamination occurs in MSC preparations.

10. Use of the method according to claim 8 in detecting whether fungal contamination occurs in MSC preparations.

Images