A target gene, primer and method for detecting Escherichia fergusonii

Abstract

The present invention relates to the technical field of detection of Escherichia fergusonii, and specifically relates to a target gene, primers and a method for detecting Escherichia fergusonii. A target gene for detecting Escherichia fergusonii provided by the present invention has a target gene sequence for identifying Escherichia fergusonii as shown in SEQ ID NO: 1. Through whole-genome alignment of 622 strains of Escherichia bacteria, it is found that Escherichia fergusonii has a conserved gene cheV , corresponding to the known Escherichia fergusonii Escherichia fergusonii in the whole genome of ATCC 35469 cheV . This gene does not exist in other Escherichia bacteria, so the nucleotide sequence as SEQ ID NO.1 is used as the target gene for detecting Escherichia fergusonii.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of Escherichia fergusonii, and particularly to a target gene, primers and a method for detecting Escherichia fergusonii. Background Art

[0002] Escherichia fergusonii ( Escherichia fergusonii ) belongs to the genus Escherichia of the family Enterobacteriaceae and is a close relative of Escherichia coli. In 1985, two strains of Escherichia fergusonii were first isolated from clinical blood samples. By analyzing their biochemical reactions, they were classified as a new bacterial species and attributed to the genus Escherichia. The clinical significance of Escherichia fergusonii is not yet clear. However, there have been reports showing that this bacterium can be isolated from human wound infections, bile fluids, as well as in primates and water. Escherichia fergusonii has a wide range of prevalence, diverse hosts, and may cause human diseases.

[0003] Currently, the method for identifying Escherichia fergusonii is mainly to first perform gene sequencing and then conduct 16S rDNA alignment. Although this method can identify Escherichia fergusonii, it is costly and time-consuming. In addition, Lindsey et al. compared the genomes of 150 strains of Enterobacteriaceae through the Daydreamer™ platform, including 107 strains of Escherichia coli, 5 strains of Shigella, 21 strains of Escherichia albertii, 12 strains of Escherichia fergusonii, and 5 strains of other species. Subsequently, they designed primers in the 575 bp region of a gene encoding a palmityl acyl carrier protein-dependent acyltransferase and achieved the detection and identification of Escherichia fergusonii through multiplex PCR. However, in actual application, when qPCR is performed based on EFER_0790 gene target primers, the results do not have good specificity, the same as the case of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOFMS) identification method, and it is impossible to effectively distinguish Escherichia coli from Escherichia fergusonii. Therefore, the current detection methods for Escherichia fergusonii have disadvantages such as poor sensitivity and specificity to a large extent. EFER_0790 Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the defects of poor sensitivity and specificity of the existing detection methods for identifying Escherichia fergusonii, and thus provide a target gene, primers and a method for detecting Escherichia fergusonii.

[0005] On the one hand, the present invention provides a target gene for detecting Escherichia fergusonii, and the target gene sequence for detecting Escherichia fergusonii is as shown in SEQ ID NO:1.

[0006] ​On the other hand, the present invention provides a primer for detecting Escherichia fergusonii, and the primer sequences for detecting Escherichia fergusonii are shown in SEQ ID NO: 2 and SEQ ID NO: 4.

[0007] Meanwhile, the present invention provides a kit for detecting Escherichia fergusonii, which includes the above-mentioned primer for detecting Escherichia fergusonii.

[0008] Furthermore, the present invention provides a method for detecting Escherichia fergusonii, which includes the following steps:

[0009] Extract the DNA of the strain to be tested; use the extracted DNA of the strain to be tested as a template to construct a PCR reaction system for PCR reaction. The PCR reaction system includes the above-mentioned primer for detecting Escherichia fergusonii or the above-mentioned kit for detecting Escherichia fergusonii.

[0010] In some embodiments, in a volume of 20 μL, the PCR reaction system includes 0.8 - 1.2 μL of upstream primer, 0.8 - 1.2 μL of downstream primer, 0.8 - 1.2 μL of DNA template, 8 - 12 μL of premix, and the balance is ddH 2 O.

[0011] In some embodiments, the concentration of the upstream primer and / or the downstream primer is 8 - 10 mmol / L.

[0012] In some embodiments, the concentration of the DNA template is 150 - 250 ng / μL.

[0013] In some embodiments, the procedure of the PCR reaction is pre-denaturation at 90 - 95 °C for 2 - 5 min, 1 cycle; denaturation at 90 - 95 °C for 30 s, annealing at 59 - 63 °C for 30 s, extension at 72 °C for 30 s, 30 - 50 cycles; extension at 72 °C for 5 min.

[0014] In some embodiments, the presence of a 192 bp band in the PCR product proves that the strain to be tested is Escherichia fergusonii.

[0015] In some embodiments, the Ct value of the fluorescence quantitative PCR reaction ≤ 36 detects that the strain to be tested is Escherichia fergusonii.

[0016] The technical solution of the present invention has the following advantages:

[0017] 1. The present invention provides a target gene for detecting Escherichia fergusonii, and the target gene sequence for detecting Escherichia fergusonii is shown in SEQ ID NO: 1. Through the whole-genome alignment of 622 strains of Escherichia bacteria, it is found that Escherichia fergusonii has a conserved gene cheV , corresponding to the known Escherichia fergusonii Escherichia fergusoniiIn the whole genome of ATCC 35469 cheV , this gene does not exist in other Escherichia bacteria. Its nucleotide sequence is shown in SEQ ID NO.1. The nucleotide sequence is uploaded to NCBI for BLASTN alignment. The matching rate between the genome of Escherichia fergusonii and this sequence is more than 98.5%, and the coverage rate is 100%. While the matching degrees of the genomes of other bacteria such as Salmonella enterica, Citrobacter freundii, and Citrobacter are below 75%, and the coverage rate is lower than 93%. Therefore, the nucleotide sequence such as SEQ ID NO.1 is used as the target gene for detecting Escherichia fergusonii.

[0018] 2. A primer for detecting Escherichia fergusonii provided by the present invention, and the primer sequences for detecting Escherichia fergusonii are shown in SEQ ID NO:2 and SEQ ID NO:4. The present invention uses the nucleotide sequence such as SEQ ID NO.1 as the target gene for detecting Escherichia fergusonii, and designs a group of primer pairs, which can improve the specificity and sensitivity of detecting Escherichia fergusonii. Description of the Drawings

[0019] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0020] Figure 1 It is the gel electrophoresis diagram of the amplification product in Experimental Example 1 of the present invention;

[0021] Figure 2 It is the gel electrophoresis diagram of the amplification product in Experimental Example 2 of the present invention;

[0022] Figure 3 It is the gel electrophoresis diagram of the amplification product in Experimental Example 3 of the present invention;

[0023] Figure 4 It is the Ct result diagram of the fluorescence quantitative PCR in Experimental Example 4 of the present invention. Detailed Embodiments

[0024] The following embodiments are provided to better further understand the present invention. It is not limited to the best embodiment, and does not limit the content and protection scope of the present invention. Any product obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior art features and being the same or similar to the present invention falls within the protection scope of the present invention.

[0025] For those not specifying specific experimental procedures or conditions in the examples, the operations or conditions of the conventional experimental procedures described in the literature in this field can be followed. For reagents or instruments without indicating the manufacturer, they are all conventional reagent products that can be obtained commercially.

[0026] In the present invention, the complete genomic sequences of 144 Escherichia fergusonii strains in the National Center for Biotechnology Information (NCBI) gene sequence database in the United States were subjected to nucleotide sequence alignment with the complete genomic sequences of 478 other Escherichia bacteria such as Escherichia albertii, Escherichia coli, and Escherichia amnigenus. Multiple candidate genes were screened. Using the candidate genes as targets, primer pairs were designed to perform PCR on the DNA of Escherichia fergusonii and Escherichia coli to verify the specificity and conservation of the genes. It was found that there was a conserved gene sequence corresponding to the Escherichia fergusonii gene in the complete genomic sequence of Escherichia fergusonii ATCC 35469. cheV Through BLASTN alignment, it was found that the match between the Escherichia fergusonii genome and this sequence segment was above 98.5% with a coverage rate of 100%, while the match degrees of other genomes such as Salmonella enterica, Citrobacter freundii, and Citrobacter genus were below 75% and the coverage rate was lower than 93%. It can be seen that the sequence homology of this gene is relatively high among different strains of Escherichia fergusonii and it has good sequence specificity. Using the cheV gene (nucleotide sequence shown in SEQ ID No.1) as the target gene, primer pairs capable of specifically amplifying the cheV gene in Escherichia fergusonii were designed. Whether the target product can be amplified can be used to determine whether the tested strain belongs to Escherichia fergusonii.

[0027] Example 1

[0028] This example provides a method for detecting Escherichia fergusonii, and the specific steps and parameters are as follows:

[0029] (1) Entrust Tsingke Biotechnology (Shanghai) Co., Ltd. to synthesize primers, and the primer information is shown in Table 1.

[0030] (2) Scrape the mycelium from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bio-Engineering Co., Ltd.). The mycelium is Escherichia fergusonii ( Escherichia fergusonii ) ATCC 35469.

[0031] (3) Prepare the reaction solution according to the PCR reaction system provided in Table 2 and perform amplification according to the PCR reaction program provided in Table 3.

[0032] Table 1 Primer information

[0033]

[0034] Table 2 PCR reaction system

[0035]

[0036] In Table 1, the concentration of primer - F is 10 mmol / L, the concentration of primer - R is 10 mmol / L, the concentration of DNA template is 200 ng / μL, and the premix is 2×TB Green Fast qPCR Mix.

[0037] Table 3 PCR reaction program

[0038]

[0039] Example 2

[0040] This example provides a method for detecting Escherichia fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction program, the annealing temperature is 59°C.

[0041] Example 3

[0042] This example provides a method for detecting Escherichia fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction program, the annealing temperature is 61°C.

[0043] Example 4

[0044] This example provides a method for detecting Escherichia fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction program, the annealing temperature is 62°C.

[0045] Example 5

[0046] This example provides a method for detecting Escherichia fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction program, the annealing temperature is 63°C.

[0047] Example 6

[0048] This example provides a method for detecting Escherichia fergusonii. The specific steps and parameters are as follows:

[0049] (1) Entrust Tsingke Biotechnology (Shanghai) Co., Ltd. to synthesize the primer pair q2, and the primer information is shown in Table 1.

[0050] (2) Scrape the mycelium from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Biotechnology Co., Ltd.). The mycelium is Escherichia fergusonii (Escherichia fergusonii ) ATCC 35469。

[0051] (3)Perform a PCR reaction on the DNA template,

[0052] The PCR reaction system consists of 8 μL of 2×TB Green Fast qPCR Mix, 0.8 μL of 10 mmol / L forward primer, 0.8 μL of 10 mmol / L reverse primer, 1 μL of 150 ng / μL DNA template, and 9.4 μL of ddH 2 O, prepare the reaction solution. The primer information is shown in primer pair q2 in Table 1, and the specific sequences are shown in SEQ ID NO:2 and SEQ ID NO:4.

[0053] The PCR reaction program is pre-denaturation at 90°C for 5 min; denaturation at 90°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; finally, extension at 72°C for 5 min.

[0054] Example 7

[0055] This example provides a method for detecting Escherichia fergusonii, and the specific steps and parameters are as follows:

[0056] (1)Entrust Tsingke Biotechnology (Shanghai) Co., Ltd. to synthesize primer pair q2, and the primer information is shown in Table 1.

[0057] (2)Scrape the mycelium from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd.). The mycelium is Escherichia fergusonii( Escherichia fergusonii ) ATCC 35469.

[0058] (3)Perform a PCR reaction on the DNA template,

[0059] The PCR reaction system consists of 12 μL of 2×TB Green Fast qPCR Mix, 1.2 μL of 8 mmol / L forward primer, 1.2 μL of 8 mmol / L reverse primer, 1 μL of 250 ng / μL DNA template, and 4.6 μL of ddH 2 O, prepare the reaction solution. The primer information is shown in primer pair q2 in Table 1, and the specific sequences are shown in SEQ ID NO:2 and SEQ ID NO:4.

[0060] The PCR reaction program is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 50 cycles; finally, extension at 72°C for 5 min.

[0061] Experimental Example 1

[0062] The amplification products obtained in Examples 1-5 were tested by gel electrophoresis, and the results are shown in Figure 1 , it can be seen that the primer pairs numbered q1-q2 can amplify the DNA template at annealing temperatures of 59-61°C; the primer pairs numbered q3-q5 can amplify the DNA template at annealing temperatures of 59-63°C.

[0063] Experimental Example 2

[0064] Using 10 strains of Escherichia fergusonii ( Escherichia fergusonii ) as positive controls and 10 strains of Escherichia coli ( Escherichia coli ) as negative controls.

[0065] Referring to the method of Example 1, 5 pairs of primers were used to amplify the DNA templates extracted from the negative and positive controls, and the amplification products were visualized by gel electrophoresis. The results are shown in Figure 2 (columns 1-10 in the figure represent the positive control Escherichia fergusonii, and columns 11-20 represent the negative control Escherichia coli). It can be seen that the primer pairs SEQ ID NO:2 and SEQ ID NO:4 provided in the examples of the present invention have the best experimental effect of differentiating Escherichia fergusonii from Escherichia coli. Although the other primer pairs can also amplify Escherichia fergusonii ( Figure 2 in columns 1-10), when amplifying Escherichia coli, the q1 and q3 primer pairs suspected to amplify bands in some lanes (i.e., columns 11-20), while the q2 primer pair did not amplify the bands of Escherichia coli at all, proving that the primer pair q2 has the best specificity.

[0066] Experimental Example 3

[0067] Verify the specificity of the primer pair q2 provided in the examples of the present invention.

[0068] The verification method includes the following steps.

[0069] 1. Scrape the mycelium from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bio-Engineering Co., Ltd.). The mycelia are Escherichia fergusonii ( Escherichia fergusonii ), Escherichia hermannii ( Escherichia hermann ii), Escherichia marmotae ( Escherichia marmotae ), Escherichia vulneris ( Escherichia vulneris ), Escherichia adecarboxylata ( Escherichia albertii ), Aeromonas hydrophila ( Aeromonas hydrophila ), Aeromonas caviae ( Aeromonas caviae ), Pseudomonas ( Pseudomonas ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus ), Campylobacter jejuni (Campylobacter jejuni ), Salmonella ( Salmonella ), Escherichia coli ( Escherichia coli ), Acinetobacter baumannii ( Acinetobacter baumannii ), Enterococcus faecalis ( Enterococcus faecalis ), Lactobacillus plantarum ( Lactobacillus plantarum ). The above strains were all purchased from the American Type Culture Collection (ATCC).

[0070] 2. Prepare the reaction solution according to the PCR reaction system provided in Table 2 of Example 1, and perform amplification according to the PCR reaction program provided in Table 3. The primer information is shown in primer pair q2 in Table 1. Use the DNA extracted from the above mycelium as the positive control, and use an equal volume of ddH 2 O as the negative control.

[0071] Visualize the amplification products by gel electrophoresis. The results are shown in Figure 3 . It can be seen that the primers provided in the examples of the present invention can only identify Escherichia fergusonii (with an obvious band at 192 bp), proving that the primers are specific.

[0072] Experimental Example 4

[0073] Determine the sensitivity of the primers provided in the examples of the present invention.

[0074] The test method is as follows:

[0075] 1. Scrape the mycelium from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Biotechnology Co., Ltd.). The mycelium is Escherichia fergusonii ( Escherichia fergusonii ) ATCC 35469.

[0076] 2. Construct a recombinant positive plasmid using the specific identification gene cheV of Escherichia fergusonii as the template:

[0077] 2.1. Prepare the reaction solution according to the PCR reaction system provided in Table 2 of Example 1, and perform amplification according to the PCR reaction program provided in Table 3. The primer sequences are cheV-F: GCGCACATGATCTTCATTCG (see SEQ ID NO.11); cheV-R: GTCCTCACTGCCGATAACTG (see SEQ ID NO.12).

[0078] 2.2. Integrate the product amplified by the primer pair in step 2.1 into the plasmid pMD19-T to construct a recombinant positive reference plasmid pMD19-T- cheV :

[0079] Integrate the amplification product into plasmid pMD19-T to construct the recombinant positive reference plasmid pMD19-T- cheV The steps are as follows:

[0080] 2.2.1. Purification of PCR products: Transfer the PCR products into a 1.5 mL centrifuge tube, and then perform steps such as agarose gel electrophoresis, gel cutting, and gel extraction to obtain purified PCR products;

[0081] 2.2.2. Ligation: Use a commercial seamless cloning kit to perform seamless cloning ligation on the purified PCR products and plasmid pMD-19T;

[0082] 2.2.3. Transformation: Transform the obtained seamless cloning products into Escherichia coli DH5α based on the chemical transformation method;

[0083] 2.2.4. Plasmid extraction: Use a commercial plasmid extraction kit to extract the recombinant positive plasmid from Escherichia coli DH5α and use it for subsequent experiments.

[0084] 3. Gradient dilute the obtained recombinant positive reference plasmid pMD19-T- cheV integrated with the amplification product to a copy number of 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, and use an equal volume of ddH 2 O as a negative control, and perform fluorescence quantitative PCR on the above positive and negative controls with different copy numbers using a fluorescence quantitative PCR instrument (CFX96), where:

[0085] The qPCR reaction system is 10 μL of 2×TB Green Fast qPCR Mix, 0.8 μL of 10 mmol / L upstream primer, 0.8 μL of 10 mmol / L downstream primer, 1 μL of 200 ng / μL DNA template, 7.4 μL of ddH 2 O. Prepare the reaction solution. The primer information is shown in primer pair q2 in Table 1, and the specific sequences are shown in SEQ ID NO:2 and SEQ ID NO:4;

[0086] Amplification was carried out according to the qPCR reaction program, with pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 45 cycles; and finally extension at 72°C for 10 min.

[0087] ddH 2 O was used to replace the qPCR of the DNA template as a negative control.

[0088] The results of fluorescence quantitative PCR are shown in Figure 4 ( Figure 4 In which NTC represents no-template control, that is, the negative control in this experimental example) and Table 4.

[0089] Table 4 Results of fluorescence quantitative PCR

[0090]

[0091] The Ct value of the positive control of Escherichia fergusonii is known to be 38 or less. According to Table 4 and Figure 4 , it can be seen that the Ct values of Escherichia fergusonii DNA with a copy number of more than 10 1 copies / μL are all below 36, while the Ct values of the negative controls ddH 2 O and 10 0 copies / μL of Escherichia fergusonii DNA are all above 37, proving that the detection limit of the detection method provided in the embodiment of the present invention for Escherichia fergusonii DNA is 10 1 copies / μL.

[0092] Obviously, the above embodiments are only examples clearly described and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A primer for detecting Escherichia Fergusonii, characterized in that: The primer sequences for detecting Escherichia fergusonii are shown in SEQ ID NO:2 and SEQ ID NO:

4.

2. A kit for detecting Escherichia Ferguson, characterized in that: The invention comprises the primers for detecting Escherichia fergusonii as claimed in claim 1.

3. A method for non-disease diagnosis and detection of Escherichia Fergusonii, characterized in that: The following steps are included: Extract DNA of the strain to be tested; A PCR reaction system is constructed using the DNA of the strain to be tested as a template to carry out a PCR reaction, wherein the PCR reaction system comprises the primers for detecting Escherichia fergusonii according to claim 1 or the kit for detecting Escherichia fergusonii according to claim 2, In the PCR reaction procedure, the annealing temperature is 59-61°C.

4. The method for detecting Escherichia Ferguson according to claim 3, characterized in that: Based on a volume of 20 μL, the PCR reaction system includes 0.8-1.2 μL of upstream primer, 0.8-1.2 μL of downstream primer, 0.8-1.2 μL of DNA template, 8-12 μL of premix and the balance is ddH2O.

5. The method for detecting Escherichia Ferguson according to claim 4, characterized in that: The concentration of the upstream primer and / or the downstream primer is 8-10 mmol / L.

6. The method for detecting Escherichia Fergusonii according to claim 5, characterized in that: The concentration of DNA template is 150-250 ng / μL.

7. The method for detecting Escherichia Ferguson according to claim 6, characterized in that: The PCR reaction procedure is 90-95°C pre-denaturation for 2-5 minutes, and one cycle; Denaturation at 90-95°C for 30 s, annealing at 59-61°C for 30 s, extension at 72°C for 30 s, cycle 30-50 times; 72°C, extension for 5 min.

8. The method for detecting Escherichia Fergusonii according to any one of claims 3 to 7, characterized in that: The PCR product showed a 192 bp band, proving that the strain to be tested was Escherichia fergusonii.

9. The method for detecting Escherichia Ferguson according to any one of claims 3 to 7, characterized in that: The Ct value of the fluorescence quantitative PCR reaction was ≤36, indicating that the test strain was Escherichia fergusonii.

Images