SSR primer combination for identifying and controlling pollination line mango filial generation male parents and application of SSR primer combination

Abstract

The invention relates to an SSR primer combination for identifying and controlling a male parent of a pollination line mango filial generation and application of the SSR primer combination, and belongs to the technical field of mango crossbreeding. The invention provides an SSR (Simple Sequence Repeat) primer combination for identifying and controlling a male parent of a pollination line mango filial generation. The primer combination comprises a G33 primer pair, a G676 primer pair, a G744 primer pair, a G1134 primer pair, a G1151 primer pair, a G1342 primer pair, a G1382 primer pair, a G1454 primer pair, a G1527 primer pair and a G1617 primer pair. According to the invention, male parent identification is carried out on 113 control pollination line mango filial generations by utilizing an SSR primer combination in combination with a capillary electrophoresis technology, and the male parent identification success rate is 84.07% under the confidence coefficient of 80%; under 95% confidence, the identification success rate is 41.59%, and the method is simple, efficient, high in accuracy and suitable for large-scale sample detection.

Description

Technical Field

[0001] The invention relates to the technical field of mango hybrid breeding, and in particular to an SSR primer combination for identifying the male parent of mango hybrid offspring of a controlled pollination system and an application thereof. Background Art

[0002] Mango (Mangifera indica L.) is an evergreen fruit tree of the genus Mangifera in the Anacardiaceae family. It is cross-pollinated and relies on insects to spread pollen. It is widely planted in tropical and subtropical regions of the world. Its fruit is tender, sweet and juicy, healthy and delicious. It contains a large amount of vitamins and a variety of trace elements. It is deeply favored by consumers and is known as the "King of Tropical Fruits". In 2022, China's mango cultivation area reached 5.928 million mu and the output was about 4.317 million tons. However, most of the main mango varieties in my country are introduced from abroad, with a single variety, excessively concentrated fruit ripening period, and a lack of high-quality varieties with regional characteristics, which restricts the sustainable and healthy development of the mango industry. Therefore, the selection and breeding of new excellent mango varieties is particularly important for the high-quality development of my country's mango industry.

[0003] Hybrid breeding is an important means of selecting new mango varieties. Compared with other breeding methods, hybrid breeding has the advantages of clear breeding goals and the ability to quickly aggregate multiple excellent traits. At present, most mango cultivars are obtained through natural hybridization or seedling breeding. However, there are many uncontrollable factors in completely natural pollination hybridization, and it is difficult to identify the paternal parent. It is a better choice to control the pollination of multiple parents with nets and conduct genotyping analysis on naturally pollinated seedlings of known maternal varieties in the early stage to identify the optimal paternal parent. The traditional method of paternal parent identification is morphological markers, which are simple, intuitive, economical and convenient, but phenotypic detection has a lag, takes a long time, and is easily affected by the growth status of the plant and environmental conditions. It is difficult to distinguish hybrid offspring with low levels of genetic variation, and it is difficult to unify the definition standards. Molecular markers are a new generation of technology based on DNA differences between offspring individuals. They are not restricted by the environment and growth status and can quickly and accurately match candidate parents of offspring. However, traditional polyacrylamide gel electrophoresis SSR molecular marker technology has disadvantages such as large workload, low resolution, time-consuming and labor-intensive. It is not suitable for the detection of large quantities of samples. How to conduct early identification of the father of hybrid offspring and establish a molecular marker-assisted breeding system to accelerate the breeding process has become an urgent problem to be solved.

[0004] Based on this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide an SSR primer combination for identifying the male parent of mango hybrid offspring with a controlled pollination line and its application, so as to solve the problems in the prior art that the traditional polyacrylamide gel electrophoresis SSR molecular marker technology method for identifying the male parent of mango hybrid offspring has a large workload, low resolution, time-consuming and labor-intensive, and is not suitable for large-scale sample detection.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides an SSR primer combination for identifying the male parent of mango hybrid offspring of a controlled pollination system, wherein the primer combination comprises a G33 primer pair, a G676 primer pair, a G744 primer pair, a G1134 primer pair, a G1151 primer pair, a G1342 primer pair, a G1382 primer pair, a G1454 primer pair, a G1527 primer pair and a G1617 primer pair;

[0008] The nucleotide sequence of the upstream primer of the G33 primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2;

[0009] The nucleotide sequence of the upstream primer of the G676 primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4;

[0010] The nucleotide sequence of the upstream primer of the G744 primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6;

[0011] The nucleotide sequence of the upstream primer of the G1134 primer pair is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8;

[0012] The nucleotide sequence of the upstream primer of the G1151 primer pair is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10;

[0013] The nucleotide sequence of the upstream primer of the G1342 primer pair is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12;

[0014] The nucleotide sequence of the upstream primer of the G1382 primer pair is shown in SEQ ID NO.13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.14;

[0015] The nucleotide sequence of the upstream primer of the G1454 primer pair is shown in SEQ ID NO.15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.16;

[0016] The nucleotide sequence of the upstream primer of the G1527 primer pair is shown in SEQ ID NO.17, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.18;

[0017] The nucleotide sequence of the upstream primer of the G1617 primer pair is shown in SEQ ID NO.19, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.20.

[0018] Preferably, the 5' end of the upstream primer of all primer pairs in the SSR primer combination is labeled with a fluorescent group, and the fluorescent group includes HEX, ROX or FAM.

[0019] The present invention provides the application of the SSR primer combination in identifying true and false hybrids of mango hybrid offspring of a controlled pollination system.

[0020] The present invention provides the application of the SSR primer combination in mango hybrid breeding and / or molecular marker-assisted breeding.

[0021] The present invention provides a method for identifying the male parent of mango hybrid offspring of a controlled pollination system, comprising the following steps:

[0022] (1) extracting genomic DNA from the hybrid offspring and parents of the controlled pollination line mango, using the genomic DNA as a DNA template and performing PCR amplification using a combination of SSR primers to obtain PCR amplification products;

[0023] (2) Using capillary electrophoresis to detect the size of the PCR amplification product, the genotype data of the mango hybrid offspring and parents of the controlled pollination line were obtained by analysis;

[0024] (3) performing allele frequency analysis on the genotype data of the mango hybrid offspring and the parents of the controlled pollination line obtained in step (2) to obtain allele frequency data;

[0025] (4) performing simulation analysis on the allele frequency data obtained in step (3) to obtain simulation analysis data;

[0026] (5) performing parent-offspring analysis on the genotype data of the controlled-pollination mango hybrid offspring and the parents obtained in step (2), the allele frequency data obtained in step (3), and the simulation analysis data obtained in step (4), to determine the male parent of the controlled-pollination mango hybrid offspring;

[0027] The SSR primer combination described in step (1) is the SSR primer combination.

[0028] Preferably, the reaction system for PCR amplification in step (1) is: 1 to 3 μL of a DNA template with an initial concentration of 25 to 35 ng / μL, 0.2 to 0.8 μL of an upstream primer with an initial concentration of 5 to 15 μmol / L, 0.2 to 0.8 μL of an downstream primer with an initial concentration of 5 to 15 μmol / L, 5 to 15 μL of 2×EasyTaq PCR SuperMix and 5 to 9 μL of ultrapure water.

[0029] Preferably, the reaction procedure of the PCR amplification in step (1) is: pre-denaturation at 92-96°C for 4-6 min; 92-96°C for 25-35 s, 56-60°C for 25-35 s, 70-74°C for 25-35 s, 35 cycles; extension at 70-74°C for 6-10 min.

[0030] Preferably, the analysis software in step (2) is Peak Scanner V1.0;

[0031] The software for allele frequency analysis described in step (3) is Cervus V3.07;

[0032] The simulation analysis program described in step (4) is Simulation;

[0033] The program for parentage analysis described in step (5) is ParentageAnalysis.

[0034] The invention provides application of the identification method in identifying true and false hybrids of mango hybrid offspring of a controlled pollination system.

[0035] The invention provides application of the identification method in mango hybrid breeding and / or molecular marker-assisted breeding.

[0036] The present invention has the following technical effects and advantages:

[0037] The SSR loci amplified by the SSR primer combination screened by the present invention have a strong detection efficiency, among which 7 primer pairs have PIC values ​​greater than 0.5 and are highly polymorphic primers. The SSR primer combination composed of 10 primer pairs has a cumulative non-parent exclusion probability of more than 99% when a single parent or both parents are known. According to the method of the present invention, the paternal parent of 113 mango hybrid offsprings of the controlled pollination line is identified by using the SSR primer combination in combination with the capillary electrophoresis technology. Under the confidence level of 80%, the optimal paternal parent is successfully identified in 95 offsprings among the 113 mango offsprings, and the identification success rate is 84.07%. Among the 95 offsprings, 80 are hybrid offsprings, accounting for 84.21%, and 15 are self-pollinated offsprings, accounting for 15.79%. Under the confidence level of 95%, the optimal paternal parent is successfully identified in 47 offsprings, and the identification success rate is 41.59%. Among the 47 offsprings, 44 are hybrid offsprings, accounting for 93.62%, and 3 are self-pollinated offsprings, accounting for 6.38%. The method is simple, efficient and has a high accuracy rate, is suitable for large-scale sample determination, and has a reference value for mango hybrid breeding and molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the capillary electrophoresis diagram of the hybrid progeny of mango in the partially controlled pollination line using the G1454 primer pair. DETAILED DESCRIPTION

[0039] The invention provides an SSR primer combination for identifying the male parent of mango hybrid offspring of a controlled pollination system, wherein the primer combination comprises a G33 primer pair, a G676 primer pair, a G744 primer pair, a G1134 primer pair, a G1151 primer pair, a G1342 primer pair, a G1382 primer pair, a G1454 primer pair, a G1527 primer pair and a G1617 primer pair;

[0040] The nucleotide sequence of the upstream primer of the G33 primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2;

[0041] The nucleotide sequence of SEQ ID NO.1 is: GCCATAAGTATTGCGAGCGC;

[0042] The nucleotide sequence of SEQ ID NO.2 is: ACGCCTAGTGGTGAAGAAGC;

[0043] The nucleotide sequence of the upstream primer of the G676 primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4;

[0044] The nucleotide sequence of SEQ ID NO.3 is: CCCAGTTGAAAATATGGGTTCCC;

[0045] The nucleotide sequence of SEQ ID NO.4 is: TCCACCGCTGAAACAACTCG;

[0046] The nucleotide sequence of the upstream primer of the G744 primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6;

[0047] The nucleotide sequence of SEQ ID NO.5 is: AGATGGACGGTTGAGGTTGC;

[0048] The nucleotide sequence of SEQ ID NO.6 is: TTCCCCCTTAAATGGCCACC;

[0049] The nucleotide sequence of the upstream primer of the G1134 primer pair is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8;

[0050] The nucleotide sequence of SEQ ID NO.7 is: CACATTGTCCCAACATGCCC;

[0051] The nucleotide sequence of SEQ ID NO.8 is: GAGCAGCACACAACTTGAGG;

[0052] The nucleotide sequence of the upstream primer of the G1151 primer pair is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10;

[0053] The nucleotide sequence of SEQ ID NO.9 is: GTCAGATGTTGTCCGCATGC;

[0054] The nucleotide sequence of SEQ ID NO.10 is: TCATCGTCCATTCCTGTGCC;

[0055] The nucleotide sequence of the upstream primer of the G1342 primer pair is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12;

[0056] The nucleotide sequence of SEQ ID NO.11 is: TGGACTCGACATCCTGAAGC;

[0057] The nucleotide sequence of SEQ ID NO.12 is: CTTCACCGCTTTGTCAAGGG;

[0058] The nucleotide sequence of the upstream primer of the G1382 primer pair is shown in SEQ ID NO.13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.14;

[0059] The nucleotide sequence of SEQ ID NO.13 is: TCCACGGTGGATGATGTAGC;

[0060] The nucleotide sequence of SEQ ID NO.14 is: GAAGATTCAGCAAGCCAGACG;

[0061] The nucleotide sequence of the upstream primer of the G1454 primer pair is shown in SEQ ID NO.15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.16;

[0062] The nucleotide sequence of SEQ ID NO.15 is: AAAAGGAGGACGGTTTGGGG;

[0063] The nucleotide sequence of SEQ ID NO.16 is: GTACCCACCAAATTAGGCGC;

[0064] The nucleotide sequence of the upstream primer of the G1527 primer pair is shown in SEQ ID NO.17, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.18;

[0065] The nucleotide sequence of SEQ ID NO.17 is: CACCCGTCTTGAACCTCTCC;

[0066] The nucleotide sequence of SEQ ID NO.18 is: TCAGGCAAATGAGTGCTGGG;

[0067] The nucleotide sequence of the upstream primer of the G1617 primer pair is shown in SEQ ID NO.19, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.20;

[0068] The nucleotide sequence of SEQ ID NO.19 is: CAAACACGAAGACGACGACG;

[0069] The nucleotide sequence of SEQ ID NO.20 is: TCGCCGTTGTCCATATTCCC;

[0070] In the present invention, the 5' end of the upstream primer of all primer pairs in the SSR primer combination is labeled with a fluorescent group, and the fluorescent group includes HEX, ROX or FAM.

[0071] The present invention provides the application of the SSR primer combination in identifying true and false hybrids of mango hybrid offspring of a controlled pollination system.

[0072] The present invention provides the application of the SSR primer combination in mango hybrid breeding and / or molecular marker-assisted breeding.

[0073] The present invention provides a method for identifying the male parent of mango hybrid offspring of a controlled pollination system, comprising the following steps:

[0074] (1) extracting genomic DNA from the offspring and parents of the mango hybrids of the controlled pollination line, and using the genomic DNA as a DNA template to perform PCR amplification using a combination of SSR primers to obtain PCR amplification products;

[0075] (2) Using capillary electrophoresis to detect the size of the PCR amplification product, the genotype data of the mango hybrid offspring and parents of the controlled pollination line were obtained by analysis;

[0076] (3) performing allele frequency analysis on the genotype data of the mango hybrid offspring and the parents of the controlled pollination line obtained in step (2) to obtain allele frequency data;

[0077] (4) performing simulation analysis on the allele frequency data obtained in step (3) to obtain simulation analysis data;

[0078] (5) performing parent-offspring analysis on the genotype data of the controlled-pollination mango hybrid offspring and the parents obtained in step (2), the allele frequency data obtained in step (3), and the simulation analysis data obtained in step (4), to determine the male parent of the controlled-pollination mango hybrid offspring;

[0079] The SSR primer combination described in step (1) is the SSR primer combination.

[0080] In the present invention, the reaction system of PCR amplification described in step (1) is: 1-3 μL of DNA template with an initial concentration of 25-35 ng / μL, 0.2-0.8 μL of upstream primer with an initial concentration of 5-15 μmol / L, 0.2-0.8 μL of downstream primer with an initial concentration of 5-15 μmol / L, 5-15 μL of 2×EasyTaq PCR SuperMix and 5-9 μL of ultrapure water;

[0081] The volume of the DNA template is preferably 2 μL, and the initial concentration is preferably 30 ng / μL;

[0082] The volume of the upstream primer is preferably 0.4 to 0.6 μL, more preferably 0.5 μL, and the initial concentration is preferably 10 μmol / L;

[0083] The volume of the downstream primer is preferably 0.4 to 0.6 μL, more preferably 0.5 μL, and the initial concentration is preferably 10 μmol / L;

[0084] The volume of the 2×EasyTaq PCR SuperMix is ​​preferably 10 μL;

[0085] The volume of the ultrapure water is preferably 6 to 8 μL, more preferably 7 μL.

[0086] In the present invention, the reaction procedure of PCR amplification described in step (1) is: pre-denaturation at 92-96°C for 4-6 min; 92-96°C for 25-35 s, 56-60°C for 25-35 s, 70-74°C for 25-35 s, 35 cycles; extension at 70-74°C for 6-10 min;

[0087] Preferably, the method comprises pre-denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and extension at 72°C for 8 min.

[0088] In the present invention, the analysis software described in step (2) is Peak Scanner V1.0;

[0089] The software for allele frequency analysis described in step (3) is Cervus V3.07;

[0090] The simulation analysis program described in step (4) is Simulation, preferably the Paternity subroutine in the Simulation program;

[0091] The program for parentage analysis in step (5) is Parentage Analysis, preferably the Paternity subprogram in the ParentageAnalysis program.

[0092] The invention provides application of the identification method in identifying true and false hybrids of mango hybrid offspring of a controlled pollination system.

[0093] The invention provides application of the identification method in mango hybrid breeding and / or molecular marker-assisted breeding.

[0094] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0095] Example

[0096] 1. Materials and Methods

[0097] 1.1 Test materials

[0098] From June to August 2024, a total of 136 mango fruits of the controlled pollination system were picked in the germplasm nursery of the South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, and the fruit seeds were sown and seedlings were raised, and 113 healthy seedlings with known maternal parents were obtained. The young leaves of the 113 controlled-pollination mango hybrid progenies and 12 candidate parents were collected, frozen with liquid nitrogen, and stored in a -80°C refrigerator for later use. The information of the 113 natural hybrid progenies and 12 candidate parents is shown in Table 1.

[0099] Table 1113 controlled pollination mango hybrid offspring and 12 candidate parents

[0100] serial number variety Known number of progeny seedlings of the mother parent 1 Irwin 11 2 Tainong No.1 7 3 Renong No.1 11 4 KensingtonPride 0 5 Zillate 7 6 Palmer 1 7 Dashehari 5 8 Zill 29 9 Yuexi No.1 0 10 Dongzhenhong 2 11 Guimang No.1 32 12 TommyAtkins 8

[0101] 1.2 Extraction of genomic DNA

[0102] The genomic DNA of 113 controlled-pollination mango hybrid progenies and 12 parents was extracted by the improved CTAB method. The quality and concentration of the genomic DNA were detected by 1% agarose gel and a micro-UV-visible spectrophotometer (Nano Drop One). The genomic DNA concentration was uniformly adjusted to 30 ng / μL and stored in a -20°C refrigerator for future use.

[0103] 1.3 SSR primer combinations and PCR amplification

[0104] Mango SSR primer pairs were developed using “Alphonso” as the reference genome. Ten SSR primer pairs were selected from the developed primers and combined into SSR primer combinations. The synthesis of SSR primer combinations and the modification of different fluorescent labels at the 5′ end were completed by Shanghai Shenggong Biotechnology Co., Ltd. The information of SSR primer combinations is shown in Table 2.

[0105] Table 2 Basic information of SSR primer combinations

[0106]

[0107] The extracted genomic DNA was used as a DNA template to perform PCR amplification using the SSR primer pair combination to obtain PCR amplification products;

[0108] The PCR amplification reaction system was 20 μL, including 2 μL of DNA template with an initial concentration of 30 ng / μL, 0.5 μL of upstream primer with an initial concentration of 10 μmol / L, 0.5 μL of downstream primer with an initial concentration of 10 μmol / L, 10 μL of 2×EasyTaq PCRSuperMix and 7 μL of ultrapure water.

[0109] PCR reaction program: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 35 cycles; extension at 72°C for 8 min.

[0110] Capillary electrophoresis detection of PCR amplification products: Purify the PCR amplification products, then perform capillary electrophoresis on ABI3730 gene sequencer, and use GenemapperV4.0 software to read the fragment size; Use PeakScannerV1.0 software to analyze the obtained data, and obtain the genotype data of the mango hybrid offspring of the controlled pollination line, as shown in Table 3, where the capillary electrophoresis diagram of the G1454 primer pair in some of the mango hybrid offspring of the controlled pollination line is shown in Figure 1 As shown, A represents the capillary electrophoresis of 11-Dashehari-2, B represents the capillary electrophoresis of 6-Tainong No.1-2, C represents the capillary electrophoresis of 24-TommyAtkins-2, D represents the capillary electrophoresis of 36-Zillate-1, E represents the capillary electrophoresis of 11-Dashehari-1, and F represents the capillary electrophoresis of Irwin-3.

[0111] Table 3 Genotype data of 113 controlled pollination mango hybrid offspring

[0112]

[0113]

[0114]

[0115]

[0116]

[0117] The genotype data of the 12 candidate parents were analyzed and the results are shown in Table 4.

[0118] Table 4 Genotype data of 12 candidate parents

[0119]

[0120] 1.4 Data Processing

[0121] According to the genotype data of the mango hybrid progeny and candidate parents of the controlled pollination line, the genetic diversity parameters including the number of alleles (Na), the effective number of alleles (Ne), the Shannon information index (I), the observed heterozygosity (Ho), the expected heterozygosity (He) and the polymorphism information content (PIC) were calculated using GenAlEx V6.5 software. The results are shown in Table 5.

[0122] Table 5 Genetic diversity analysis results of SSR primer combinations

[0123]

[0124]

[0125] According to Table 5, the SSR primer combination detected 54 alleles (Na) in 125 mango resources (113 mango natural hybrid progeny and 12 candidate fathers), and an average of 5.4 alleles were detected per marker; the effective allele number (Ne) ranged from 2.127 to 3.727, with an average of 2.825, among which G676, G1382, G33 and G1151 had higher effective allele numbers, indicating that these loci have a relatively high Strong detection efficiency; Shannon index (I) ranged from 0.926 to 1.428, with an average of 1.185; the average values ​​of observed heterozygosity (Ho) and expected heterozygosity (He) were 0.689 and 0.632, respectively; the polymorphism information content (PIC) ranged from 0.452 to 0.677, with an average of 0.575, among which 7 pairs of primers had PIC values ​​greater than 0.5, which were highly polymorphic primers; the above results showed that mango controlled pollination lines had rich genetic diversity.

[0126] According to the genotype data of mango hybrid progeny and parents of the controlled pollination line, the polymorphism information content (PIC) of SSR primer combinations, the non-parent exclusion probability when both parental genotypes are unknown (NE-1P), the non-parent exclusion probability when one parental genotype is known (NE-2P), the non-parent exclusion probability when the parental genotypes are known (NE-PP), the cumulative exclusion probability when both parental genotypes are unknown (CE-1P), the cumulative exclusion probability when one parental genotype is known (CE-2P) and the cumulative exclusion probability when the parental genotypes are known (CE-PP) were calculated using Cervus V3.07 software. The results are shown in Table 6.

[0127] Table 6 Non-parent exclusion probability and cumulative exclusion probability of mango paternal identification

[0128]

[0129]

[0130] According to Table 6, when the maternal and paternal genotypes are unknown, the non-parent exclusion probability (NE-1P) of a single locus varies between 0.689 and 0.856; when the maternal or paternal genotypes are known, the non-parent exclusion probability (NE-2P) of a single locus varies between 0.432 and 0.914; when the maternal and paternal genotypes are known, the non-parent exclusion probability (NE-PP) of a single locus varies between 0.250 and 0.839. According to the polymorphism information content (PIC) of the primers, the non-parent exclusion probability of the SSR primer combination is gradually accumulated and calculated. As the number of loci increases, the cumulative exclusion probability also increases accordingly. The cumulative exclusion probability CE-1P of the SSR primer combination with unknown maternal and paternal genotypes only reached 92.36%; when a single parent or both parents were known, the cumulative non-parent exclusion probability of the SSR primer combination was above 99%, indicating that the SSR primer combination obtained in the present application scheme can be used to identify the paternal parent of mango hybrid offspring with controlled pollination line.

[0131] 2. Identification of the paternal parent

[0132] According to the genotype data of the hybrid offspring and parents of the controlled-pollination mango, the allele frequencies of the hybrid offspring and parents of the controlled-pollination mango were calculated using Cervus V3.07 to obtain the allele frequency data; in the Simulation program, the Paternity subroutine was selected and run, and the allele frequency data was input as required. The parameters were set as follows: 10,000 parent-offspring simulations, 12.0 candidate paternal parents, 0.096 sampling ratio of candidate paternal parents, 0.99 matching site ratio, and 0.01 genotype error rate to obtain simulation analysis data; in the ParentageAnalysis program, the Paternity subroutine was selected and run, and the genotype data, allele frequency data and simulation analysis data of the hybrid offspring and parents of the controlled-pollination mango were gradually input as required to identify the paternal parent of the hybrid offspring of the controlled-pollination mango.

[0133] The results showed that at 80% and 95% confidence levels, the critical LOD values ​​were 1.13 and 4.36, respectively, indicating that when the LOD value of the candidate parent exceeded 1.13, the identification credibility was 80%; when the LOD value exceeded 4.36, the credibility increased to 95%. At 80% confidence, 95 of the 113 controlled-pollination mango hybrid offspring successfully identified the optimal male parent, with an identification success rate of 84.07%. Among them, only 12 offspring had one mismatch site; among these 95 offspring, 80 were hybrid offspring, accounting for 84.21%, and 15 were self-pollinated offspring, accounting for 15.79%. At 95% confidence, 47 offspring successfully identified the optimal male parent, with an identification success rate of 41.59%. Among them, 5 offspring had 1 mismatch site; among these 47 offspring, 44 were hybrid offspring, accounting for 93.62%, and 3 were self-pollinated offspring, accounting for 6.38%. The results of the identification of the male parent of the mango hybrid offspring of the controlled pollination line at 95% confidence level are shown in Table 5.

[0134] Table 5 Identification results of male parent of mango hybrid offspring of controlled pollination line at 95% confidence level

[0135]

[0136]

[0137] It can be seen from the above embodiments that the present invention provides an SSR primer combination for identifying the male parent of mango hybrid offspring of the controlled pollination system and its application. The SSR loci amplified by the SSR primer combination screened by the present invention have a strong detection efficiency, among which 7 pairs of primer pairs have a PIC value greater than 0.5, which are highly polymorphic primers. The SSR primer combination composed of 10 primer pairs has a cumulative non-parent exclusion probability of more than 99% when a single parent or two parents are known. According to the method of the present invention, the SSR primer combination combined with capillary electrophoresis technology was used to identify the male parent of 113 controlled pollination mango hybrid offspring. At a confidence level of 80%, 95 of the 113 mango offspring successfully identified the optimal male parent, and the identification success rate was 84.07%. Among these 95 offspring, 80 were hybrid offspring, accounting for 84.21%, and 15 were self-pollinated offspring, accounting for 15.79%. At a confidence level of 95%, 47 offspring were successfully identified as the optimal father, with an identification success rate of 41.59%. Among these 47 offspring, 44 were hybrid offspring, accounting for 93.62%, and 3 were self-pollinated offspring, accounting for 6.38%. This method is simple, efficient and highly accurate, suitable for large-scale sample determination, and has reference value for mango hybrid breeding and molecular marker-assisted breeding.

[0138] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SSR primer combination for identifying the male parent of mango hybrid offspring with controlled pollination, characterized in that: The primer combination includes a G33 primer pair, a G676 primer pair, a G744 primer pair, a G1134 primer pair, a G1151 primer pair, a G1342 primer pair, a G1382 primer pair, a G1454 primer pair, a G1527 primer pair and a G1617 primer pair; The nucleotide sequence of the upstream primer of the G33 primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; The nucleotide sequence of the upstream primer of the G676 primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; The nucleotide sequence of the upstream primer of the G744 primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6; The nucleotide sequence of the upstream primer of the G1134 primer pair is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8; The nucleotide sequence of the upstream primer of the G1151 primer pair is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.10; The nucleotide sequence of the upstream primer of the G1342 primer pair is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.12; The nucleotide sequence of the upstream primer of the G1382 primer pair is shown in SEQ ID NO.13, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.14; The nucleotide sequence of the upstream primer of the G1454 primer pair is shown in SEQ ID NO.15, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.16; The nucleotide sequence of the upstream primer of the G1527 primer pair is shown in SEQ ID NO.17, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.18; The nucleotide sequence of the upstream primer of the G1617 primer pair is shown in SEQ ID NO.19, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

20.

2. The SSR primer combination according to claim 1, characterized in that The 5' ends of the upstream primers of all primer pairs in the SSR primer combination are labeled with fluorescent groups, and the fluorescent groups include HEX, ROX or FAM.

3. Use of the SSR primer combination described in claim 1 or 2 in identifying true and false hybrids of mango hybrid offspring of controlled pollination lines.

4. Use of the SSR primer combination described in claim 1 or 2 in mango hybrid breeding and / or molecular marker-assisted breeding.

5. A method for identifying the male parent of mango hybrid offspring in a controlled pollination system, characterized in that: The steps include: (1) extracting genomic DNA from the hybrid offspring and parents of the controlled pollination line mango, using the genomic DNA as a DNA template and performing PCR amplification using a combination of SSR primers to obtain PCR amplification products; (2) Using capillary electrophoresis to detect the size of the PCR amplification product, the genotype data of the mango hybrid offspring and parents of the controlled pollination line were obtained by analysis; (3) performing allele frequency analysis on the genotype data of the mango hybrid offspring and the parents of the controlled pollination line obtained in step (2) to obtain allele frequency data; (4) performing simulation analysis on the allele frequency data obtained in step (3) to obtain simulation analysis data; (5) performing parent-offspring analysis on the genotype data of the controlled-pollination mango hybrid offspring and the parents obtained in step (2), the allele frequency data obtained in step (3), and the simulation analysis data obtained in step (4), to determine the male parent of the controlled-pollination mango hybrid offspring; The SSR primer combination described in step (1) is the SSR primer combination described in any one of claims 1 or 2.

6. The identification method according to claim 5, characterized in that: The reaction system of PCR amplification described in step (1) is: 1-3 μL of DNA template with an initial concentration of 25-35 ng / μL, 0.2-0.8 μL of upstream primer with an initial concentration of 5-15 μmol / L, 0.2-0.8 μL of downstream primer with an initial concentration of 5-15 μmol / L, 5-15 μL of 2×EasyTaq PCRSuperMix and 5-9 μL of ultrapure water.

7. The identification method according to claim 5, characterized in that: The reaction procedure of the PCR amplification described in step (1) is: pre-denaturation at 92-96°C for 4-6 min; 92-96°C for 25-35 s, 56-60°C for 25-35 s, 70-74°C for 25-35 s, 35 cycles; extension at 70-74°C for 6-10 min.

8. The identification method according to claim 5, characterized in that: The analysis software described in step (2) is PeakScanner V1.0; The software for allele frequency analysis described in step (3) is Cervus V3.07; The simulation analysis program described in step (4) is Simulation; The program for parentage analysis described in step (5) is ParentageAnalysis.

9. Use of the identification method according to any one of claims 4 to 8 in identifying true and false hybrids of mango hybrid offspring of controlled pollination lines.

10. Use of the identification method according to any one of claims 4 to 8 in mango hybrid breeding and / or molecular marker-assisted breeding.

Images