A protein and its application in magnetic resonance imaging positioning and tracking of intestinal flora

Abstract

The present application relates to a kind of protein and its application in intestinal flora magnetic resonance imaging positioning and tracking.The amino acid sequence of the protein includes the sequence shown in SEQ ID NO.1.The present application designs specific protein, the protein can be combined with endogenous manganese ion, and effectively enhance MRI signal, express in intestinal flora, can be used endogenous manganese ion to carry out magnetic resonance imaging, realize high-resolution positioning and dynamic tracking of intestinal flora, can avoid using exogenous contrast agent, no side effect or immune response, and can be non-invasive, real-time dynamic, high-resolution imaging, provide the spatial distribution and dynamic change information of intestinal flora.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of life science, and relates to a kind of protein and its application in intestinal flora magnetic resonance imaging positioning and tracking. BACKGROUND

[0002] Intestinal flora plays a crucial role in maintaining host health, digestion, immune regulation and nervous system function. In recent years, with the deepening of the research on intestinal flora, scientists have gradually realized that the imbalance of intestinal microecology is closely related to a variety of diseases (such as inflammatory bowel disease, obesity, diabetes, intestinal cancer, etc.). In order to better understand the function of intestinal flora and its changes in different pathological states, accurate and real-time monitoring of the dynamic distribution and changes of intestinal flora has become an important research goal.

[0003] The existing intestinal flora detection methods mainly include genomics methods (such as 16S rRNA sequencing, metagenomic sequencing), metabolomics methods and microscope technology. Although these methods can provide rich information of intestinal flora, they generally have the following problems: (1) lack of spatial resolution: traditional genomics and metabolomics methods cannot provide spatial distribution information of flora in the intestine, and cannot monitor the changes of intestinal flora in the intestinal environment in real time, which limits the comprehensive understanding of the dynamic changes of intestinal flora, especially the subtle differences of intestinal microbial community; (2) invasiveness and time consumption: most of the current intestinal flora detection methods rely on sampling of intestinal contents (such as fecal samples), which not only requires time, but also has certain invasiveness in the sampling process, and some methods also require a long experimental period, which cannot be monitored in real time; (3) difficulty in obtaining spatial distribution information: in vivo, the spatial distribution of intestinal flora is usually highly complex and heterogeneous, and existing imaging techniques (such as traditional microscopes) cannot obtain high-resolution and full-view information of bacterial community in the intestine.

[0004] Therefore, there is an urgent need for a new, non-invasive, high-resolution imaging technology that can monitor the spatial distribution of intestinal flora in real time, in order to better understand the function of intestinal microbial community and its changes in health and disease states. Magnetic resonance imaging (MRI) as a non-invasive, non-radiation, high-resolution imaging technology has been widely used in medical imaging. It generates high-resolution tissue images by interacting with water molecules in the body through magnetic fields. However, traditional MRI imaging cannot be used for microbial imaging, mainly because the signal of microbial population in the body is weak, and there is not enough specific marker to bind to it.

[0005] In summary, how to develop an effective MRI imaging method with high spatial resolution to accurately locate the distribution of intestinal flora is still a scientific problem to be solved. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a protein and its application in the localization and tracking of gut microbiota in magnetic resonance imaging, in order to develop an effective MRI imaging method for gut microbiota with high spatial resolution.

[0007] To achieve this objective, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a protein whose amino acid sequence includes the sequence shown in SEQ ID NO.1.

[0009] This invention designs a protein that can be stably expressed in cells, can bind to endogenous manganese ions, and effectively enhance MRI signals, making it suitable for magnetic resonance imaging of cells.

[0010] SEQ ID NO.1:

[0011] MDYKDHDGDYKDHDIDYKDDDDKVNRRRQRASRAGVVARRATPGDAQANSGRAPARPFQSFVSNGAMLMNKQIVAGIVAGLVSMSSHAQLGQLFQSVKEQVTQAATSQVNQGVRSATDEAVQATSSRTRKAINSVRSPSSAAAATSTSPSAAEETNDATLSEARK.

[0012] It is understood that, based on the protein designed in this invention, any functionally similar proteins obtained by using genetic modification methods in the field to substitute, delete, or add amino acids should be within the scope of protection of this invention. The number of amino acids substituted, deleted, or added can be any value, such as 1, 5, 10, 15, or more, so that the sequence identity between the changed amino acid sequence and its corresponding original sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.

[0013] In a second aspect, the present invention provides a nucleic acid molecule that encodes the protein described in the first aspect.

[0014] Preferably, the nucleic acid sequence of the nucleic acid molecule includes the sequence shown in SEQ ID NO.2.

[0015] SEQ ID NO.2:

[0016] 5'-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCG ACTACAAGGATGACGATGACAAGGTTAACAGGCGGCGGCAAAGAGCCAGTCGGGCTGGTGTAGTCGCACGAAGAGCTACACCCGGTGACGCACAAGCCAACTCAGGTAGAGCTCCCGCCCGGCCATTTCAGTCTTTTGTGTCAAACGGAGCCATGCTGATGAACAAGCAAATTGTGGCTGGGATAGTTGCAGGTCTGGTCAGCATGTCCTCCCACGCACAGCTCGGT CAACTCTTCCAGTCTGTTAAGGAACAGGTCACTCAGGCAGCAACCTCTCAGGTAAATCAAGGAGTAAGGTCCGCTACTGACGAAGCCGTGCAAGCAACATCTAGTCGGACCAGAAAGGCCATTAACAGTGTTAGGTCCCCCTCAAGCGCAGCAGCCGCTACTTCTACAAGCCCTTCTGCTGCCGAGGAGACTAATGACGCTACCCTGAGTGAGGCCCGCAAATAA-3'

[0017] Thirdly, the present invention provides a recombinant vector containing the nucleic acid molecule described in the second aspect.

[0018] Fourthly, the present invention provides an engineered cell that expresses the protein described in the first aspect.

[0019] Preferably, the starting cells of the engineered cells include intestinal microbiota cells.

[0020] Preferably, the intestinal flora cells include at least one of Escherichia coli, Bifidobacterium, or Lactobacillus.

[0021] The engineered cells of the present invention express the protein described in the first aspect, which may comprise a nucleic acid molecule encoding the protein or a recombinant vector containing the nucleic acid molecule.

[0022] In this invention, by expressing specific gene-encoded proteins in gut microbiota (such as Escherichia coli), endogenous manganese ions are used to enhance the signal in magnetic resonance imaging (MRI), thereby achieving high-resolution localization and dynamic tracking of gut microbiota.

[0023] It is understood that the technical solution of this invention can be modified and adjusted to some extent in practical applications. For example, the starting cell can utilize common intestinal flora such as Escherichia coli, but it can also utilize other types of intestinal flora, such as Bifidobacterium and Lactobacillus. By adjusting the design and expression conditions of the gene-encoded protein, precise localization and tracking of different flora can be achieved.

[0024] Fifthly, the present invention provides the application of the protein described in the first aspect, the nucleic acid molecule described in the second aspect, the recombinant vector described in the third aspect, or the engineered cell described in the fourth aspect in the preparation of reagents for magnetic resonance imaging localization and tracking of intestinal flora.

[0025] In this invention, the protein is designed to express a system that can be stably expressed in a complex intestinal environment. The protein binds to endogenous manganese ions (such as manganese from the host gut) within the intestinal flora, forming manganese ion aggregates. The endogenous manganese ions enhance the signal in magnetic resonance imaging (MRI), thereby achieving high-resolution localization and dynamic tracking of the intestinal flora without relying on exogenous contrast agents. This avoids potential interference from external substances to the intestinal flora and ensures its long-term effectiveness for dynamic monitoring.

[0026] In a sixth aspect, the present invention provides a kit for magnetic resonance imaging localization and tracking of gut microbiota, the kit comprising the engineered cells described in the fourth aspect.

[0027] In a seventh aspect, the present invention provides a method for locating and tracking gut microbiota using magnetic resonance imaging, the method comprising:

[0028] The engineered cells described in the fourth aspect are transplanted into the intestine of the target cell for magnetic resonance imaging.

[0029] This invention designs a novel magnetic resonance imaging (MRI) method for locating gut microbiota. By expressing specific proteins in common gut microbiota, these proteins can exhibit high signals in T1-weighted MRI, thereby achieving precise localization of gut microbiota. This method not only provides high-resolution spatial distribution information but also has the advantages of being non-invasive and allowing for real-time monitoring. It is expected to play an important role in gut microbiota research and clinical applications.

[0030] It is understood that the intestinal flora magnetic resonance imaging localization and tracking method of the present invention can be used for both disease diagnosis and basic research for non-disease diagnosis purposes (such as microecological research).

[0031] Preferably, the magnetic resonance imaging method includes T1-weighted imaging.

[0032] It is understood that the target to be detected in this invention can be an experimental animal model (such as a mouse or a rat), or it can be extended to the intestinal flora imaging of humans in clinical practice, and has application prospects in multiple fields such as microecology research, disease diagnosis, and personalized treatment.

[0033] Compared with the prior art, the present invention has at least the following beneficial effects:

[0034] This invention designs a specific protein that can bind to endogenous manganese ions and effectively enhance MRI signals. Furthermore, through genetic engineering, the specific protein is expressed in the gut microbiota. Magnetic resonance imaging using endogenous manganese ions enables high-resolution localization and dynamic tracking of the gut microbiota. This avoids the use of exogenous contrast agents, has no side effects or immune reactions, and provides non-invasive, real-time dynamic, high-resolution imaging, offering information on the spatial distribution and dynamic changes of the gut microbiota. Attached Figure Description

[0035] Figure 1 This is a technical approach for magnetic resonance imaging (MRI) to locate gut microbiota.

[0036] Figure 2 The figure shows the results of the expression verification of the target protein in E. coli.

[0037] Figure 3 The images show the verification results of magnetic resonance T1 imaging of Escherichia coli. Image A is the cluster image, and image B is the magnetic resonance T1-weighted imaging.

[0038] Figure 4 MRI imaging results after transplantation of Escherichia coli into the intestines of mice. Detailed Implementation

[0039] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0040] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0041] This invention designs a novel magnetic resonance imaging (MRI) method for locating and tracking gut microbiota. Through genetic engineering, specific proteins are expressed in common gut microbiota (such as *Escherichia coli*), and endogenous manganese ions are used to enhance the T1-weighted MRI signal, thereby achieving precise localization, dynamic monitoring, and spatial distribution tracking of gut microbiota. The specific technical solution includes the following key steps (technical roadmap as shown in the diagram). Figure 1 As shown):

[0042] 1. Gene Engineering Construction and Expression: This invention first uses genetic engineering technology to introduce specific marker genes into target gut microbiota (such as Escherichia coli, Bifidobacterium, Lactobacillus, etc.). This protein has the ability to bind to endogenous manganese ions, which can effectively introduce manganese ions into the microbiota cells and enhance the MRI T1-weighted imaging signal.

[0043] 2. Utilization of endogenous manganese ions: Genetically engineered proteins bind to endogenous manganese ions (such as manganese from the host gut) within the gut microbiota, forming manganese ion aggregates that enhance the magnetic resonance imaging (MRI) signal of the gut microbiota. As an endogenous contrast agent, manganese ions can generate high signals in MRI T1-weighted imaging, enabling clear imaging of the gut microbiota.

[0044] 3. Precise Localization and Tracking of Gut Microbiota: Using magnetic resonance imaging (MRI) combined with the distribution of endogenous manganese ions within the gut microbiota, the spatial distribution of gut microbiota can be monitored in real time. This provides high-resolution spatial distribution information and allows for tracking of dynamic changes in the gut microbiota at different time points, overcoming the limitations of traditional methods in obtaining information on the spatial distribution and dynamic changes of gut microbiota. The process includes:

[0045] (1) Transplantation of engineered bacteria: Engineered bacteria expressing the target protein are validated in vitro and transplanted into the animal's intestine via oral or intestinal injection. The transplanted engineered bacteria will colonize the intestine and become the target for tracking, providing a basis for subsequent imaging; (2) Cultivation and maintenance of animal intestinal flora: The transplanted engineered bacteria will continue to grow in the animal's intestine and coexist with the original flora; (3) MRI scanning: After transplantation, the animal is scanned using MRI equipment. T1-weighted imaging technology is used to obtain magnetic resonance images of the animal's intestine and display the spatial distribution of markers. Through high-resolution imaging, the location and dynamic changes of the intestinal flora can be accurately tracked.

[0046] In a specific embodiment of the present invention, Escherichia coli was used as an example to construct engineered bacteria, and the technical solution of the present invention was further verified in the mouse intestine.

[0047] Example 1

[0048] In this embodiment, an engineered Escherichia coli expressing a manganese ion-binding protein was constructed and validated.

[0049] (1) Strains construction

[0050] Target strains: Select common gut microbiota bacteria, such as Escherichia coli, Bifidobacterium, or Lactobacillus, which can grow in the gut environment and express exogenous genes.

[0051] The amino acid sequence of this gene can be designed according to SEQ ID NO.1, and its expression and manganese ion binding ability can be optimized by modifying or mutating amino acids.

[0052] Gene sequences also need to be tagged with appropriate sequences, such as 6×His tags, for purification after protein expression.

[0053] (2) Transformation of E. coli host cells

[0054] The constructed recombinant vector is transformed into E. coli host cells. Commonly used transformation methods include chemical transformation or electroporation transformation.

[0055] The transformed E. coli were cultured on a medium containing the appropriate antibiotics, and the successfully transformed cells were selected.

[0056] Screening for positive clones: Clones that have been successfully transformed and contain the target gene are selected through antibiotic screening and PCR verification.

[0057] (3) Expression of recombinant proteins

[0058] Selected positive clones are transferred to a culture medium containing an appropriate inducer (such as IPTG) to induce the expression of the target protein.

[0059] The expressed protein undergoes processes such as dissolution and purification. Commonly used protein purification methods include affinity chromatography, ion exchange chromatography, and gel filtration.

[0060] The expression status of the protein was confirmed by using methods such as SDS-PAGE and Western Blot to verify the expression of the recombinant protein.

[0061] (4) Expression verification

[0062] The expression of the target protein was detected using Western blot. Specific methods include...

[0063] 1) Sample preparation

[0064] Cell culture: Select *E. coli* strains expressing the target protein (positive clones transformed and induced to express the protein). Culture the bacteria to the logarithmic growth phase (OD). 600 The concentration of the protein is 0.6-0.8, and then an inducer (such as IPTG) is added for protein expression. The induction conditions are generally to culture at 37°C for 4-6 hours. The specific time and temperature can be optimized according to the characteristics of the protein.

[0065] 2) Cell lysis: Lyse cells using a protein lysis buffer (such as RIPA lysis buffer or PBS containing protease inhibitors). Lyse cells using methods such as sonication or freeze-thaw cycles to extract total cellular protein. Cell debris can be removed by centrifugation (12,000 × g, 10 minutes), and the supernatant can be collected as the protein extraction solution.

[0066] 3) Protein quantification: Use the BCA protein quantification kit or the Bradford method to determine the protein concentration, ensuring that the amount of protein loaded into each sample is consistent.

[0067] 2) SDS-PAGE electrophoresis

[0068] Prepare an SDS-PAGE gel. A 12% or 15% polyacrylamide gel is typically used and is suitable for most protein molecular weights.

[0069] Heat the sample (including sample buffer) together with the molecular weight marker to 95°C for 5 minutes to ensure adequate protein denaturation.

[0070] The pretreated sample (typically 20-40 μg per sample) is loaded into the gel wells.

[0071] Proteins are separated using SDS-PAGE electrophoresis. The electrophoresis conditions are usually: 120V, until the dye front is close to the bottom of the gel.

[0072] 3) Transfer membrane

[0073] After electrophoresis, the proteins on the gel are transferred to a PVDF or nitrocellulose membrane. The transfer is typically performed using a wet transfer method (or semi-dry transfer method) in transfer buffer at 100V for 1-1.5 hours.

[0074] After transfer, Ponceau S staining was used to check the transfer efficiency and the quality of proteins on the membrane.

[0075] 4) Blocking and antibody incubation

[0076] Blocking: Block the membrane with 5% skim milk powder or BSA (phosphate buffer containing 1% BSA) at room temperature for 1 hour to prevent nonspecific binding.

[0077] Primary antibody incubation: Add a primary antibody against the target protein (such as a specific antibody against the target protein, diluted at a ratio of 1:1000 to 1:5000), and incubate overnight at 4°C to ensure adequate binding.

[0078] Washing: Wash the membrane three times with TBST (TBS + 0.1% Tween-20), each time for 5-10 minutes, to remove unbound primary antibodies.

[0079] 5) Secondary antibody incubation

[0080] Add HRP (horseradish peroxidase)-labeled secondary antibody that matches the primary antibody and incubate at room temperature for 1 hour.

[0081] Washing: Wash the membrane three times with TBST to remove unbound secondary antibodies.

[0082] 6) Protein detection

[0083] HRP is reacted with a chemiluminescent substrate (such as an ECL kit) to generate a chemiluminescent signal.

[0084] 7) Results Analysis

[0085] The results are as follows Figure 2 As shown, the results indicate that engineered E. coli expressing the target protein was successfully constructed.

[0086] (5) MRI verification of E. coli

[0087] The magnetic resonance signal of engineered E. coli was verified through in vitro experiments. The engineered E. coli was cultured on culture plates and subjected to MRI scans.

[0088] 1) Take 0.2 μg of the constructed target plasmid and the empty control plasmid, mix them thoroughly, add them to 100 μL of competent cells, and place on ice for 30 minutes.

[0089] 1) Place the above-mentioned receptive states in a 42°C water bath for 90 seconds to heat shock, and then place them on ice for 5-10 minutes.

[0090] 2) Add 600 μL of antibiotic-free LB medium, incubate at 37°C by shaking, and revive for 1 hour.

[0091] 3) Centrifuge at 1200×g, slowly aspirate the supernatant, leaving about 100μL, and slowly pipette to mix.

[0092] 4) Add 30 μL of X-gal and 3 μL of IPTG to the above competent cells and mix thoroughly. Then spread evenly onto resistant bacterial plates and incubate at 37°C upside down overnight.

[0093] 5) Incubate for approximately 16-20 hours until individual colonies are clear and non-overlapping. Carefully cover the bacterial plate with pre-prepared 1% Agrose gel to form a sandwich structure, removing air bubbles as much as possible without damaging the colony morphology. Then, perform MRI scanning as required. MRI scanning parameters are: T1-weighted fast spin-echo sequence used; echo time (TR / TE) = 700 / 14.3 ms; FOV 60mm × 60mm; base resolution 240; voxel size 0.25*0.25mm; and a slice thickness of 1.5mm.

[0094] T1-weighted imaging was used to verify whether the target protein could enhance the MRI signal of *E. coli*. The results are as follows: Figure 3 As described above, Figure A is a colony image, with white colonies representing colonies expressing the target protein and black colonies representing control colonies; Figure B is the result of magnetic resonance T1-weighted imaging, where colonies expressing the target protein show high signal on magnetic resonance T1-weighted imaging. The image clearly shows the expression of the target protein in E. coli and its signal intensity in MRI, providing an experimental basis for subsequent in vivo validation in mice.

[0095] Example 2

[0096] This embodiment verifies the transplantation of engineered Escherichia coli and the intestinal magnetic resonance imaging of mice.

[0097] Engineered E. coli, validated in vitro, were transplanted into the mouse gut to enable in vivo localization and tracking of the gut microbiota. Subsequently, magnetic resonance imaging (MRI) was used to scan the mice to verify the effectiveness of this method in the mouse gut. T1-weighted imaging techniques were employed to acquire MRI images of the gut, allowing for precise tracking of the spatial distribution and dynamic changes of the gut microbiota.

[0098] The specific experimental procedure includes:

[0099] 1. Cultivation of engineered Escherichia coli

[0100] The successfully constructed engineered Escherichia coli strain (the strain expressing the target protein) was inoculated into LB liquid medium containing appropriate antibiotics (e.g., ampicillin or kanamycin was added to ensure that only bacteria carrying the recombinant plasmid could grow).

[0101] The bacterial culture was incubated in a shaker at 37°C until OD (Organic Demand) was reached. 600 When the value reaches 0.6-0.8, the bacteria are in the logarithmic growth phase, which is suitable for transplantation.

[0102] Remove the bacterial culture, centrifuge to precipitate the bacteria, then resuspend in PBS buffer and adjust the bacterial concentration to an appropriate level (e.g., 10^8-10^9 CFU / mL).

[0103] 2. Prepare mice

[0104] Select healthy mice (e.g., 6-8 week old C57BL / 6 mice or Balb / c mice) and properly feed and fast them before transplantation (usually for 4 hours to minimize interference from intestinal contents). Handle all experimental materials using aseptic techniques and ensure the mice are anesthetized. Common anesthetics such as ketamine / difluoroene can be used for anesthesia.

[0105] 3. Transplanted engineered Escherichia coli

[0106] The prepared engineered E. coli suspension was transplanted into mice via intestinal perfusion. A sterile gastric tube or a dedicated bacterial perfusion needle can be used to directly infuse the bacterial solution into the mouse's stomach or intestine. For intestinal colonization, direct injection into the mouse's cecum or colon is an option.

[0107] The number of bacteria transplanted into each mouse is approximately 10^8-10^9 CFU. During the transplantation process, it is crucial to ensure the sterility of the injected fluid and to administer it slowly to avoid overstimulation.

[0108] 4. Recovery and Observation

[0109] After colony transplantation, mice were placed in a warm recovery incubator until the anesthesia wore off. Behavioral responses, appetite, and fecal emissions were observed to ensure stable colonization of the transplanted bacteria in the gut. Mice were observed regularly for several hours or days after transplantation to confirm the colonization status of the engineered *E. coli*.

[0110] The results are as follows Figure 4 As shown, the experimental group consisted of mice transplanted with E. coli expressing the target protein, while the control group consisted of mice transplanted with empty vector control E. coli. Figure 4 The results of MRI imaging after transplantation of Escherichia coli into the mouse intestine were presented, clearly showing the spatial distribution of the gut microbiota and its signal enhancement effect in T1-weighted imaging, providing a valid basis for the localization and dynamic tracking of the gut microbiota.

[0111] In summary, this invention provides a method for magnetic resonance imaging (MRI) localization and tracking of gut microbiota based on endogenous manganese ions. A specific protein-coding gene is introduced into the target gut microbiota. This protein has the ability to bind to endogenous manganese ions, effectively introducing manganese ions into the microbial cells and enhancing the MRI T1-weighted imaging signal. The transplantation of microbiota expressing the specific protein into the gut allows for stable expression in the complex gut environment. MRI, combined with the distribution of endogenous manganese ions within the gut microbiota, enables real-time monitoring of the spatial distribution of gut microbiota, providing high-resolution spatial distribution information and tracking dynamic changes in the gut microbiota at different time points. This overcomes the limitations of traditional methods in obtaining the spatial distribution and dynamic changes of gut microbiota, while avoiding the biocompatibility and safety issues associated with traditional methods that rely on exogenous contrast agents.

[0112] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A protein, characterized in that, The amino acid sequence of the protein is the sequence shown in SEQ ID NO.

1.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleic acid sequence of the nucleic acid molecule is the sequence shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that, The recombinant vector contains the nucleic acid molecule as described in claim 2 or 3.

5. An engineered cell, characterized in that, The engineered cells express the protein of claim 1.

6. The engineered cell according to claim 5, characterized in that, The starting cells for the engineered cells are intestinal flora cells.

7. The engineered cell according to claim 6, characterized in that, The intestinal flora cells are at least one of Escherichia coli, Bifidobacterium, or Lactobacillus.

8. The use of the protein of claim 1, the nucleic acid molecule of claim 2 or 3, the recombinant vector of claim 4, or the engineered cell of any one of claims 5-7 in the preparation of reagents for magnetic resonance imaging localization and tracking of intestinal flora.

9. A kit for magnetic resonance imaging localization and tracking of gut microbiota, characterized in that, The kit comprises the engineered cells as described in any one of claims 5-7.

Images