Taq DNA polymerase mutant with improved thermal stability and anti-inhibition ability, preparation method and application thereof

Abstract

The present invention discloses a Taq DNA polymerase mutant with improved thermal stability and anti-inhibition ability, as well as a preparation method and application thereof, and relates to the field of biotechnology. The present invention specifically discloses that the Taq DNA polymerase mutant undergoes amino acid mutations in the amino acid sequence of a wild-type Taq DNA polymerase, wherein the sites of the amino acid mutations include F73S and P93A; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO: 1. Compared to the wild-type Taq DNA polymerase, the Taq DNA polymerase mutant has improved resistance to inhibitors such as heme, ethanol, and EDTA, and also has higher specific enzyme activity and thermal stability.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a Taq DNA polymerase mutant with improved thermal stability and anti-inhibition ability, and a preparation method and application thereof. Background Art

[0002] The heat-resistant DNA polymerase (Taq), derived from the bacterium Thermus aquaticus, is the original and widely used enzyme in the polymerase chain reaction (PCR). Taq DNA polymerase belongs to the DNA polymerase I family and is thermostable, highly specific, and highly active. With the application and expansion of PCR technology, research on Taq DNA polymerase has become increasingly important and extensive. However, traditional Taq DNA polymerases suffer from low activity, a short half-life, and low tolerance, and are susceptible to inhibitors contained in the template (such as heme in blood and anticoagulants), hindering their widespread application. Therefore, novel Taq DNA polymerase derivatives with improved performance are needed to meet the requirements of scientific research, medical diagnostics, and industrial production. Summary of the Invention

[0003] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention provides a Taq DNA polymerase mutant that has higher thermostability than wild-type Taq DNA polymerase and improved resistance to inhibitors such as heme, ethanol, and EDTA.

[0004] The present invention also provides a recombinant protein.

[0005] The present invention also provides biological materials related to the above-mentioned Taq DNA polymerase mutant or recombinant protein.

[0006] The present invention also provides an enzyme preparation.

[0007] The present invention also provides a method for preparing the Taq DNA polymerase mutant or recombinant protein.

[0008] The present invention also provides a method for amplifying DNA molecules.

[0009] The present invention also provides applications related to the Taq DNA polymerase mutant, recombinant protein, biomaterial or enzyme preparation.

[0010] According to the first aspect of the present invention, a Taq DNA polymerase mutant is subjected to amino acid mutations in the amino acid sequence of the wild-type Taq DNA polymerase, wherein the amino acid mutations include F73S and P93A; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO: 1.

[0011] The Taq DNA polymerase mutant according to the embodiment of the present invention has at least the following beneficial effects:

[0012] Compared with wild-type Taq DNA polymerase, the Taq DNA polymerase mutant has a higher specific enzyme activity, which is 1.6 to 2.5 times that of the wild-type Taq DNA polymerase; it also has higher thermal stability, and can still retain at least 70% of the enzyme activity after heat treatment at 95°C for 1 hour. Its thermal stability is 30% to 40% higher than that of the wild-type Taq DNA polymerase; at the same time, it has higher resistance to certain PCR inhibitors and can tolerate at least 35μM hemoglobin, 5mM EDTA and 7% ethanol.

[0013] According to some embodiments of the present invention, the Taq DNA polymerase mutant further comprises at least one amino acid mutation of E734G, V155I, and L245M.

[0014] According to some embodiments of the present invention, the Taq DNA polymerase mutant comprises any one of the groups of mutation sites A1) to A4):

[0015] A1), F73S, P93A, E734G (the amino acid sequence is shown in SEQ ID NO: 3, positions 10 to 841);

[0016] A2), F73S, P93A (the amino acid sequence is shown in SEQ ID NO: 4, positions 10 to 841);

[0017] A3), F73S, P93A, V155I (the amino acid sequence is shown in SEQ ID NO: 5, positions 10 to 841);

[0018] A4), F73S, P93A, L245M (the amino acid sequence is shown in SEQ ID NO: 6, positions 10 to 841).

[0019] A recombinant protein according to the second embodiment of the present invention comprises a tag and the above-mentioned Taq DNA polymerase mutant.

[0020] According to some embodiments of the present invention, the tag is connected to the middle and / or N-terminus and / or C-terminus of the Taq DNA polymerase mutant.

[0021] According to some embodiments of the present invention, the tag includes at least one tag that facilitates the solubilization, purification, and detection of the Taq DNA polymerase mutant. It is understood that the Taq DNA polymerase mutant of the present invention may include one or more tags; multiple tags may include a combination of multiple identical tags, or a combination of multiple different tags. For example, tags that facilitate the solubilization of the Taq DNA polymerase mutant include, but are not limited to, a nus tag or a maltose binding protein tag; tags that facilitate the purification of the Taq DNA polymerase mutant include, but are not limited to, a strep tag, a His tag, a GST tag, a pelB signal tag, or an ompA signal tag; tags that facilitate the detection of the Taq DNA polymerase mutant include, but are not limited to, a horseradish peroxidase (HRP) tag, a β-galactosidase tag, a luciferase tag, a green fluorescent protein (GFP) tag, an HcRed tag, a DsRed tag, or a cyan fluorescent protein (CFP) tag. The tag may specifically be a His tag.

[0022] According to some embodiments of the present invention, the amino acid sequence of the Taq DNA polymerase mutant is shown in any one of SEQ ID NO: 2 to SEQ ID NO: 5.

[0023] According to the third aspect of the present invention, the biological material related to the Taq DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is any one of B1) to B4):

[0024] B1), a nucleic acid molecule encoding the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention;

[0025] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0026] B3) a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2);

[0027] B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

[0028] According to some embodiments of the present invention, the nucleic acid molecule has any one of B11) to B19):

[0029] B11), a DNA molecule having the nucleotide sequence shown in positions 28 to 2526 of SEQ ID No: 7;

[0030] B12), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 8;

[0031] B13), a DNA molecule having the nucleotide sequence shown in positions 28 to 2526 of SEQ ID No: 9;

[0032] B14), a DNA molecule having the nucleotide sequence shown in positions 28 to 2526 of SEQ ID No: 10;

[0033] B15), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B14), and encoding the Taq DNA polymerase mutant;

[0034] B16) A DNA molecule that hybridizes under stringent conditions with the nucleotide sequence defined in any one of B11) to B15) and encodes the Taq DNA polymerase mutant.

[0035] According to some embodiments of the present invention, the stringent conditions can be hybridization in a 2×SSC, 0.1% SDS solution at 68° C. and washing the membrane twice for 5 minutes each time; or hybridization in a 0.5×SSC, 0.1% SDS solution at 68° C. and washing the membrane twice for 15 minutes each time.

[0036] According to some embodiments of the present invention, the expression cassette refers to a DNA molecule capable of expressing the Taq DNA polymerase mutant in a host cell. The DNA molecule may include not only a promoter for initiating transcription of the Taq DNA polymerase mutant encoding gene, but also a terminator for terminating transcription of the Taq DNA polymerase mutant encoding gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0037] According to some embodiments of the present invention, the vector may be a plasmid, cosmid, phage or viral vector, for example, a PET-28a vector.

[0038] According to some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the Taq DNA polymerase mutant into the multiple cloning site of the vector.

[0039] According to some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells, or insect cells. The bacteria may be Escherichia coli, such as E. coli DH5α or E. coli JM109. The recombinant organism does not contain reproductive material.

[0040] According to some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule described in B1), the expression cassette described in B2), or the recombinant vector described in B3) into a biological cell. Specifically, the recombinant cell may be a recombinant Escherichia coli obtained by introducing the recombinant vector into E. coli DH5α or E. coli JM109.

[0041] An enzyme preparation according to the fourth aspect of the present invention comprises the Taq DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention.

[0042] According to some embodiments of the present invention, the enzyme preparation further includes a reaction premix.

[0043] According to some embodiments of the present invention, the PCR premix includes Tris-HCl, K + Mg 2+ , BSA, and at least one of dNTPs.

[0044] According to some embodiments of the present invention, the K + The source includes at least one of potassium chloride, potassium acetate, and potassium sulfate.

[0045] According to some embodiments of the present invention, the Mg 2+ The source includes at least one of magnesium chloride, magnesium acetate, and magnesium sulfate.

[0046] According to some embodiments of the present invention, the qPCR premix solution includes 20-50 mmol / L Tris-HCl, 50-100 mmol / L K + 、5~10mmol / L Mg 2+ , 50-100 μg / mL BSA, 250-500 μmol / L dNTPs. For example, the qPCR premix may include 25 mmol / L Tris-HCl, 100 mmol / L K + 、5mmol / L Mg 2+ , 50μg / mL BSA, 300μmol / LdNTPs.

[0047] According to some embodiments of the present invention, the pH of the qPCR premix is ​​8.5-9.2.

[0048] It is understood that the reaction premix should preferably not affect the activity of the Taq DNA polymerase mutant or recombinant protein.

[0049] According to the fifth aspect of the present invention, the method for preparing the Taq DNA polymerase mutant described in the first aspect of the present invention comprises:

[0050] The Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention or the coding gene of the recombinant protein described in the embodiment of the second aspect of the present invention is introduced into a biological cell, and the coding gene is expressed to obtain the Taq DNA polymerase mutant.

[0051] According to some embodiments of the present invention, the biological cells include prokaryotic cells and eukaryotic cells.

[0052] According to some embodiments of the present invention, the prokaryotic cell comprises bacteria or algae, wherein the bacteria may be Escherichia coli (eg, E. coli JM109).

[0053] According to some embodiments of the present invention, the eukaryotic cells include fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0054] According to the sixth aspect of the present invention, a method for amplifying a DNA molecule comprises the step of amplifying the DNA molecule using the Taq DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention as a DNA polymerase.

[0055] According to some embodiments of the present invention, the following steps may be specifically included:

[0056] The Taq DNA polymerase mutant, DNA molecules, primers and reaction premix are mixed and reacted.

[0057] Application according to the seventh embodiment of the present invention.

[0058] According to some embodiments of the present invention, the application is the application of any one of C1) to C4) in preparing a nucleic acid amplification or sequencing product;

[0059] C1), the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention;

[0060] C2), the recombinant protein described in the embodiment of the second aspect of the present invention;

[0061] C3), the biomaterial described in the embodiment of the third aspect of the present invention;

[0062] C4) The enzyme preparation described in the embodiment of the fourth aspect of the present invention.

[0063] According to some embodiments of the present invention, the nucleic acid amplification may specifically be a polymerase chain reaction.

[0064] According to some embodiments of the present invention, the application is the application of the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention, the recombinant protein described in the embodiment of the second aspect of the present invention, or the enzyme preparation described in the embodiment of the third aspect of the present invention in nucleic acid amplification or sequencing.

[0065] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Electrophoresis diagram of the enzyme proteins finally obtained after wild-type Taq DNA polymerase, Taq-w1, Taq-w2, Taq-w3, and Taq-w4 were expressed and purified; M is a protein marker, and lanes 1 to 5 are enzyme protein samples Taq-WT, Taq-w1, Taq-w2, Taq-w3, and Taq-w4, respectively;

[0067] Figure 2 This is the fluorescence quantitative PCR amplification curve of Taq-WT's resistance to different inhibitors (heme, EDTA, ethanol) added or not added;

[0068] Figure 3 This is the fluorescence quantitative PCR amplification curve of Taq-w1's resistance to different inhibitors (heme, EDTA, ethanol) added or not added;

[0069] Figure 4 This is a fluorescence quantitative PCR amplification curve of Taq-w2's resistance to different inhibitors (heme, EDTA, and ethanol) added or not added;

[0070] Figure 5 This is a fluorescence quantitative PCR amplification curve of Taq-w3's resistance to different inhibitors (heme, EDTA, and ethanol) added or not added;

[0071] Figure 6 This is the fluorescence quantitative PCR amplification curve of Taq-w4's resistance to different inhibitors (heme, EDTA, ethanol) added or not added;

[0072] Figure 7The figures are electrophoresis diagrams of fluorescence quantitative PCR results for different enzymes without and with different inhibitors (heme, EDTA, ethanol); Panel A shows wild-type Taq DNA polymerase, Panel B shows Taq-w1, Panel C shows Taq-w2, Panel D shows Taq-w3, and Panel E shows Taq-w4; M in each panel represents GL DNAMarker 2000, lanes 1-4 show the group without inhibitor addition, lanes 5-8 show the group with 35 μM heme addition, lanes 9-12 show the group with 5 mM EDTA addition, and lanes 13-16 show the group with 7% ethanol addition. DETAILED DESCRIPTION

[0073] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0074] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or those recommended by the manufacturer. All reagents or instruments used, if the manufacturer is not specified, are commercially available conventional products.

[0075] In the description of the present invention, the terms "comprises" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method or product comprising a series of steps or elements is not necessarily limited to those steps or elements explicitly listed, but may include other steps or elements not explicitly listed or inherent to such processes, methods or products.

[0076] Unless otherwise defined, all scientific or technical terms in this patent are consistent with the common understanding of most general people in this field.

[0077] The following amino acid sequences are in order from N-terminus to C-terminus; the nucleotide sequences are in order from 5' to 3' end.

[0078] The term "amplification" refers to the process by which the number of target nucleic acid fragments increases under the action of nucleic acid polymerase.

[0079] To obtain a Taq DNA polymerase with good thermal stability and amplification performance, wild-type Taq DNA polymerase (Taq-WT, NCBI Sequence ID: P19821.1, amino acid sequence as shown in SEQ ID NO: 1, amino acids 10 to 841) was mutated and screened extensively to obtain Taq DNA polymerase mutants (Taq-w1 to Taq-w4).

[0080] The Taq DNA polymerase mutants (Taq-w1 to Taq-w4) were all mutated based on the amino acid sequence of Taq-WT. The specific amino acid mutations of Taq-w1 are F73S, P93A, and E734G, and the amino acid sequence is shown in SEQ ID NO:3, positions 10 to 841. The specific amino acid mutations of Taq-w2 are F73S, P93A, and the amino acid sequence is shown in SEQ ID NO:4, positions 10 to 841. The specific amino acid mutations of Taq-w3 are F73S, P93A, and V155I, and the amino acid sequence is shown in SEQ ID NO:5, positions 10 to 841. The specific amino acid mutations of Taq-w4 are F73S, P93A, and L245M, and the amino acid sequence is shown in SEQ ID NO:6, positions 10 to 841. A 6× histidine tag is connected to the N-terminus of wild-type Taq DNA polymerase and Taq DNA polymerase mutants (Taq-w1 to Taq-w4) via a linker peptide GS. The corresponding nucleotide sequences are shown in SEQ ID NOs: 7 to 10.

[0081] Example 1

[0082] 1. Construction of expression vector:

[0083] Hunan Aikerui Bioengineering Co., Ltd. was commissioned to design a nucleotide sequence encoding a histidine tag (HHHHHH) and a connecting peptide (GS) at the 3' end based on the coding nucleotide sequence information of Taq-WT, Taq-w1 to Taq-w4, namely ATGCATCACCACCATCACCATGGTAGC (SEQ ID NO: 11), and synthesize the corresponding DNA molecules. The DNA molecules were then ligated with the PET-28a vector by overlapping PCR to obtain the recombinant expression vectors PET-28a / Taq-WT, PET-28a / Taq-w1, PET-28a / Taq-w2, PET-28a / Taq-w3, and PET-28a / Taq-w4.

[0084] Furthermore, PCR amplification was performed using the above-mentioned recombinant expression vector as a template, and then the PCR product was purified and recovered using the SteadyPure PCR reaction liquid purification kit (Hunan Aikerui Bioengineering Co., Ltd., product number AG21003). The recovered product was transformed into DH5α competent cells, and positive monoclonal clones were screened for sequencing verification. After verification, the results showed that they were consistent with expectations.

[0085] 2. Expression:

[0086] The recombinant expression vectors expressing wild-type Taq DNA polymerase or Taq DNA polymerase mutants were transformed into host cells E. coli JM109, and single colonies were picked and inoculated into 100 mL of LB medium containing 50 μg / mL ampicillin. After shaking and culturing overnight at 37°C, the colonies were inoculated into 2 L of LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100 and shaken at 30°C until 0 D 600 The pH value was 0.6-0.8; IPTG was added to a final concentration of 0.4 mmol / L, and the induction was continued at 30°C for 10-12 hours; the induced bacteria were collected by centrifugation and weighed, the wet weight of the bacteria was recorded, and the bacteria were stored at -80°C.

[0087] 3. Purification:

[0088] After induction of expression, cells frozen at -80°C were taken and resuspended in 3 mL of lysis buffer (100 mM Tris-HCl, 0.2 mM EDTA, pH 7.5) per gram of wet weight to obtain a cell suspension. The cells were lysed using a high-pressure crusher at 800 bar for three cycles. The lysed cells were centrifuged at 4°C and 12,000 rpm for 30 minutes. Supernatant A was transferred to a 200 mL sterile beaker and pellet A was discarded. Supernatant A was incubated in a 75°C water bath for 20 minutes. Centrifuged at 4°C and 12,000 rpm for 30 minutes. Supernatant B was transferred to a 200 mL sterile beaker and pellet B was discarded. Supernatant B was filtered through a 0.22 μm microporous membrane to obtain a filtrate.

[0089] After equilibration of the chromatography column Ni-NTAPurose 6 Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.) with buffer A (50 mM Tris-HCl, 0.1 mM EDTA, 100 mM KCl, 0.2% (v / v) Tween-20, pH 7.5), the filtrate was loaded onto the chromatography column. After loading, the column was first rinsed with buffer A, and then gradient elution from 0% to 100% was performed with buffer B (50 mM Tris-HCl, 0.1 mM EDTA, 100 mM KCl, 700 mM imidazole, 0.2% (v / v) Tween-20, pH 7.5). The eluted fractions were subjected to SDS-PAGE protein electrophoresis detection. Based on the detection results, the eluate A containing the target protein was collected, and the eluate A was dialyzed into buffer A, and the dialyzate A was collected.

[0090] After equilibration of the chromatography column Q Purose 6 Fast Flow 6 mL (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.) with buffer A, the dialysate A was loaded onto the chromatography column. After loading, the column was first rinsed with buffer A, and then gradient elution was performed with buffer C (50 mM Tris-HCl, 0.1 mM EDTA, 700 mM KCl, 0.2% (v / v) Tween-20, pH 7.5) from 0% to 100%. The eluted fractions were subjected to SDS-PAGE protein electrophoresis detection. Based on the detection results, the eluate B containing the target protein was collected and dialyzed into enzyme preservation solution (20 mM Tris-HCl, 0.1 mM EDTA, 100 mM KCl, 0.5% (v / v) Tween-20, 1 mM DTT, 50% (v / v) glycerol, pH 7.5). The dialysate B was collected, and this dialysate B was the final enzyme protein obtained.

[0091] After the above purification steps, 30 μL of Taq-WT and Taq-w1 to Taq-w4 enzyme proteins were taken and analyzed by SDS-PAGE electrophoresis. Figure 1 shown.

[0092] Test Example 1

[0093] This assay was used to detect the DNA polymerase activities of Taq-WT, Taq-w1 to Taq-w4.

[0094] Over a specific time period, a control curve is established based on the product amounts obtained at different addition levels of commercial DNA polymerase. Simultaneously, a curve for the DNA polymerase being tested is also established. The ratio of the slopes is calculated to determine the enzymatic activity of the DNA polymerase being tested. A hairpin oligonucleotide sequence is designed. Under the catalysis of DNA polymerase, dNTPs are gradually incorporated, and the hairpin oligonucleotide sequence ultimately forms a double-stranded DNA product. SYBR Green I is a highly sensitive fluorescent dye that binds to double-stranded DNA, generating a fluorescent signal whose intensity is positively correlated with the concentration of double-stranded DNA. By measuring the fluorescent signal over a specific time period, the enzymatic activity of the DNA polymerase being tested can be calculated.

[0095] (1) Dilute Taq-WT, Taq-w1 to Taq-w4 appropriately with enzyme storage solution and use Micro BCA TM Protein concentrations were determined using a Protein Assay Kit (purchased from Thermo Fisher Scientific, Cat. No. 23235). For specific concentration determination methods, refer to the kit instructions.

[0096] (2) Enzyme activity assay: A hairpin oligonucleotide sequence (Test 1: 5'-TAGCGAAGGATGTGAACCT AATCCCTGCTCCCGCGGCCGATCTGCCGGCCGCGGGAGCA-3') was designed. Based on the brightness of the protein bands obtained in the SDS-PAGE electrophoresis, the enzyme activity of the purified Taq-WT, Taq-w1 to Taq-w4 mutants was calculated in advance at a certain ratio to obtain an estimated enzyme activity value. The enzyme was diluted with enzyme preservation solution to an estimated enzyme activity value of approximately 5 U / μL. The enzyme preservation solution was further used to dilute the commercial Taq DNA polymerase (purchased from Thermo Fisher Scientific, catalog number 18038018, as the control group), Taq-WT, Taq-w1 to Taq-w4 at different multiples to obtain the diluted enzyme solution. To a 20 μL reaction system (25 mmol / L Tris-HCl, 50 mmol / L KCl, 5 mmol / L (NH₄)₂SO₄, 2.5 mmol / L MgCl₂, 0.1% Triton X-100, 0.25 mmol / L dNTPs, 0.5 μmol / L Test 1, pH 8.5), add 5 μL of the diluted enzyme solution. Incubate at 74°C for 5 min, immediately cool on ice, and terminate the reaction by adding EDTA to a final concentration of 10 mM. Add 1× SYBR stain at a volume ratio of 1:30, and analyze using a microplate reader. Prepare two replicates for each dilution to minimize experimental error. Prepare two blank controls for each reaction to subtract background fluorescence. Export the raw fluorescence signal data, subtract the background fluorescence signal, and calculate the slope of the fluorescence signal versus enzyme amount.

[0097] The results are shown in Table 1.

[0098] Table 1

[0099] Group Protein concentration (μg / μL) Initial enzyme activity (U / μL) Specific enzyme activity (U / μg) Taq-WT 2.035 102.5 50.4 Taq-w1 1.750 216.8 123.9 Taq-w2 3.180 263.4 82.8 Taq-w3 1.691 170.4 100.8 Taq-w4 1.818 185.2 101.9

[0100] Compared with Taq-WT, Taq-w1 to Taq-w4 have higher specific enzyme activities, about 1.6-2.5 times.

[0101] Test Example 2

[0102] This test examines the thermal stability of Taq-WT, Taq-w1, and Taq-w4. Based on the enzyme activity results from Test Example 1, Taq-WT, Taq-w1, and Taq-w4 were diluted to the same appropriate enzyme activity concentration using enzyme storage solution and then heat-treated at 95°C for 1 hour. Fluorescence values ​​were then measured using the "Enzyme Activity Assay" method in Test Example 1. Post-heat-treatment enzyme activity and residual enzyme activity were calculated. Unheat-treated Taq-WT or Taq DNA polymerase mutants served as the untreated group.

[0103] The results are shown in Table 2.

[0104] Table 2

[0105] Group Initial enzyme activity (U / μL) Enzyme activity after heat treatment (U / μL) Remaining enzyme activity (%) Taq-WT 102.5 44.7 43.57 Taq-w1 216.8 173.4 80.00 Taq-w2 263.4 203.0 77.06 Taq-w3 170.4 130.1 76.32 Taq-w4 185.2 137.4 74.21

[0106] After heat treatment at 95°C for 1 h, the residual enzyme activities of Taq-w1 to Taq-w4 were all greater than 50%, much higher than Taq-WT, indicating better thermal stability.

[0107] Test Example 3

[0108] This assay uses fluorescent quantitative PCR to test the inhibitory ability of Taq-w1 to Taq-w4. Using 5 ng of human cDNA as template, 100-bp fragments were amplified using wild-type Taq DNA polymerase and each Taq DNA polymerase mutant. The 25 μL qPCR reaction system consisted of: 25 mmol / L Tris-HCl, 100 mmol / L KCl, 5 mmol / L MgCl2, 50 μg / mL BSA, 300 μmol / L dNTPs, 0.2 μmol / L upstream primer qPCR-F (100 bp), 0.2 μmol / L downstream primer qPCR-R (100 bp), 0.2 μmol / L probe primer qPCR-Probe (100 bp), 1 U enzyme, 7% (v / v) ethanol, 5 mM EDTA, or 35 μM hemin, pH 8.5. The reaction procedure was: 95°C for 30 s; 95°C for 5 s; 60°C for 30 s / cycle, for a total of 45 cycles. Four replicate wells were tested for each sample. After the reaction, the amplification curves were analyzed, and the reaction products were electrophoresed on a 3% agarose gel. The nucleotide sequences of the primers and probe used are as follows:

[0109] qPCR-F-100bp: 5'-GCGTATAGTAAGGCTGCAACA-3';

[0110] qPCR-R-100bp: 5'-CTGCAAAGGTGATTTTCCCT-3';

[0111] qPCR-Probe-100bp: 5'FAM-ACTGGTAAACTGGTCCATGC-3'BHQ1.

[0112] The experimental results are as follows Figure 2-Figure 7 As shown in Tables 3 and 4.

[0113] Table 3 shows the statistical results of the mean CT values ​​and ΔCT values ​​of each replicate well of Taq-WT and Taq-w1 to Taq-w4 by fluorescence quantitative PCR detection; Table 4 shows the mean fluorescence signal value and fluorescence signal value ratio of each replicate well of Taq-WT and Taq-w1 to Taq-w4 by fluorescence quantitative PCR detection.

[0114] Table 3

[0115] Group Taq-WT Taq-w1 Taq-w2 Taq-w3 Taq-w4 Mean CT value without inhibitor 24.7 23.48 23.81 23.56 23.77 Mean CT value of 7% ethanol / 23.68 23.23 22.17 22.72 5mM EDTA CT value average / 24.42 23.86 24.01 24.40 Average CT value of 35μM hemoglobin / 27.48 28.27 29.65 29.59 ΔCT value without inhibitor / 1.22 0.89 1.14 0.93 7% ethanol ΔCT value / -0.20 0.58 1.39 1.05 5mM EDTAΔCT value / -0.94 -0.05 -0.45 -0.63 ΔCT value of 35 μM hemoglobin / -4.00 -4.46 -6.09 -5.82

[0116] Note: ΔCT value without inhibitor = average CT value of Taq-WT without inhibitor - average CT value of mutant without inhibitor; ΔCT value with addition of each inhibitor = average CT value of mutant without inhibitor - average CT value of mutant with inhibitor.

[0117] Table 4

[0118] Group Taq-WT Taq-w1 Taq-w2 Taq-w3 Taq-w4 Mean fluorescence signal value without inhibitor 752622.9 891694.21 1133910.88 922647.07 1021345.06 Average fluorescence signal value of 7% ethanol / 333405.93 435439.93 429679.95 392112.30 Average fluorescence signal value of 5mM EDTA / 334526.44 476492.89 435447.55 434387.84 Average fluorescence signal value of 35μM hemoglobin / 278304.59 238502.68 223930.48 221203.14 Ratio of fluorescence signal value without inhibitor / 1.18 1.51 1.23 1.36 7% ethanol fluorescence signal ratio / 0.37 0.38 0.47 0.38 5mM EDTA fluorescence signal ratio / 0.38 0.42 0.47 0.43 35μM hemoglobin fluorescence signal ratio / 0.31 0.21 0.24 0.22

[0119] Note: The ratio of fluorescence signal values ​​without inhibitors = the average fluorescence signal of the mutant without inhibitors / the average fluorescence signal of Taq-WT without inhibitors. The ratio of fluorescence signal values ​​with each inhibitor added = the average fluorescence signal of the mutant with the corresponding inhibitor / the average fluorescence signal of the mutant without inhibitors.

[0120] Under the same reaction system and conditions, the Taq DNA polymerase mutants Taq-w1 to Taq-w4 exhibited a certain degree of improvement in CT values ​​and fluorescence signal values ​​compared to wild-type Taq DNA polymerase when no inhibitors were added. The addition of inhibitors inhibited the amplification ability of wild-type Taq DNA polymerase, resulting in no amplification curve or corresponding amplification band. However, Taq-w1 to Taq-w4 all produced amplification curves and corresponding amplification bands, and their CT values ​​remained essentially unchanged when a final concentration of 7% ethanol and 5mM EDTA was added. These results demonstrate that Taq-w1 to Taq-w4 exhibit significantly enhanced inhibition resistance.

[0121] The embodiments of the present invention are described in detail above with reference to the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the scope of knowledge possessed by ordinary technicians in the relevant technical field without departing from the scope of the present invention.

Claims

1. A Taq DNA polymerase mutant, characterized in that: The amino acid sequence of the Taq DNA polymerase mutant is shown in SEQ ID NO: 3, positions 10 to 841, SEQ ID NO: 4, positions 10 to 841, SEQ ID NO: 5, or positions 10 to 841 of SEQ ID NO:

6.

2. A recombinant protein, characterized in that The method comprises a tag and the Taq DNA polymerase mutant according to claim 1.

3. A biomaterial related to the Taq DNA polymerase mutant of claim 1 or the recombinant protein of claim 2, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the Taq DNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that The nucleic acid molecule has any one of B11) to B19): B11), a DNA molecule having the nucleotide sequence shown in positions 28 to 2526 of SEQ ID No: 7; B12), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 8; B13), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 9; B14), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 10; B18), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B17), and encoding the Taq DNA polymerase mutant; B19), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B18) under stringent conditions and encodes the Taq DNA polymerase mutant.

5. An enzyme preparation, characterized in that The method comprises the Taq DNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2.

6. A method for preparing the Taq DNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2, characterized in that: include: The coding gene of the Taq DNA polymerase mutant according to claim 1 or the recombinant protein according to claim 2 is introduced into a biological cell to express the coding gene, thereby obtaining the Taq DNA polymerase mutant.

7. A method for amplifying DNA molecules, characterized in that: The method comprises the step of amplifying the DNA molecule using the Taq DNA polymerase mutant according to claim 1, the recombinant protein according to claim 2 or the enzyme preparation according to claim 5 as a DNA polymerase.

8. Use of any one of C1) to C4) in the preparation of nucleic acid amplification or sequencing products; C1), the Taq DNA polymerase mutant according to claim 1; C2), the recombinant protein according to claim 2; C3), the biomaterial according to claim 3 or 4; C4) The enzyme preparation according to claim 5.

9. Use of the Taq DNA polymerase mutant according to claim 1, the recombinant protein according to claim 2, or the enzyme preparation according to claim 5 in nucleic acid amplification or sequencing.

Images