A transgenic system for freshwater crayfish hematopoietic tissue cells and its application

By developing a transgenic vector suitable for freshwater chalcedar hematopoietic tissue cells, using the modified shrimp virus promoter and optimized transfection method, the efficient overexpression of the atakine gene and the improvement of cell proliferation rate are achieved, and the problems of low transgene efficiency and short cell survival time in the existing technology are solved.

CN119685319BActive Publication Date: 2025-06-13GUANGDONG LABORATORY OF SOUTHERN OCEAN SCIENCE AND ENGINEERING (GUANGZHOU)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510209508.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2025-06-13
Estimated Expiration
2045-02-25

AI Technical Summary

Technical Problem

The prior art is difficult to achieve efficient transgene of freshwater crayfish cells, and the cell survival time after the transgene is short, so it is impossible to effectively express and verify functional genes.

Method used

A transgenic vector suitable for freshwater crayfish hematopoietic tissue cells was developed. Using the modified shrimp virus promoter and optimized transfection method, a hybrid promoter group (OpIE2-P2-WSV249(-300/-1)) and a transgenic expression vector (pIZ-OpIE2-P2-WSV249(-300/-1)-Ast-P2A-mCherry) was constructed to achieve overexpression of the astakine gene.

Benefits of technology

The efficient overexpression of the atakine gene was achieved, and the proliferation rate of transgenic cells increased by about 7%, and maintained healthy and stable growth for more than three months.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685319B_ABST
    Figure CN119685319B_ABST
Patent Text Reader

Abstract

The present invention discloses a transgenic system for freshwater crayfish hematopoietic tissue cells and its application, including a promoter, which is the same as or has 80%-98% homology with SEQ ID NO.12, SEQ ID NO.16 or SEQ ID NO.20. The present invention uses the above promoters to sequentially connect to form a hybrid promoter group for initiating the expression of the freshwater crayfish hematopoietic factor gene. astakine Under the electroporation transfection conditions of a voltage of 200 V, an electric pulse time of 30 ms, an electric pulse number of 2 times, an electric pulse interval of 10 s, and an electroporation buffer of CytoMix, or under the chemical transfection conditions of a transfection reagent / DNA ratio of 2:1, overexpression of the gene is achieved. astakine Among them, the expression efficiency under the chemical transfection conditions reaches about 18%, the proliferation rate of the transgenic cells is increased by about 7%, and healthy and stable growth is maintained for more than three months. Moreover, the transgenic expression vector can also be applied to other freshwater crayfish. It provides a reliable transgenic vector for the study of shrimp gene functions and lays a foundation for the development of shrimp immortalized cell lines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of transgenic technology for freshwater shrimp cells, and particularly relates to a transgenic system for freshwater crayfish hematopoietic tissue cells and its application. Background Art

[0002] Crustaceans, especially penaeid shrimp and freshwater crayfish, have extremely high economic value in global aquaculture and contribute greatly to nutrition and food safety. However, with the continuous growth of market demand, the supply of penaeid shrimp and freshwater crayfish products falls short of demand, which is mainly attributed to the frequent outbreaks of viral diseases that severely limit intensive farming and bring huge losses to the aquaculture industry. Shrimp mainly rely on their innate immune system to resist pathogen invasion. With the progress of omics technology, researchers have identified key pathways regulating these immune responses, such as Toll, IMD, and JAK / STAT. However, due to the lack of transgenic vector tools suitable for shrimp cells and their host cell lines, the research on related gene functions and the interaction mechanism between pathogens and host cells is still very limited.

[0003] The main immune defense functions of crustaceans such as penaeid shrimp and freshwater crayfish are jointly executed by the humoral immunity and cellular immune mechanisms mediated by blood cells, including antibacterial peptides, antiviral peptides, the prophenoloxidase activation system, the coagulation system, the lectin system, and the release of cytokines such as phagocytosis, encapsulation or nodulation, and cell adhesion proteins. When pathogenic microorganisms invade, the number of their blood cells will experience a sharp decline and a gradual recovery process, and cytokines related to hematopoietic tissue and blood cell proliferation play an important role in this process.

[0004] Currently, most studies rely solely on the expression of fluorescent protein reporter genes (such as EGFP) to verify the transgenic efficiency, and some reports on the expression of functional genes also show that the transgenic effect is not ideal. For example, oncogenes E6 and E7, SV40-T, 12S E1A, and H-ras were used to immortalize cultured shrimp cells through transgenic technology, but ultimately failed to successfully induce the in vitro proliferation of cells. This may be because there is incompatibility between these mammalian-derived oncogenes and shrimp cells, so they cannot effectively play a role in promoting proliferation. Secondly, the promoter, as the "power motor" driving plasmid expression, is very important for constructing a highly efficient expression vector. Previous research results have shown that some commonly used promoters, such as CMV and MoMLV promoters derived from mammalian viruses and the pH promoter derived from insect baculoviruses, have very low promoter efficiency in shrimp cells. This may be due to species specificity, and transgenic shrimp cells often can only survive for 5-14 days. Due to the lack of development of shrimp virus vector tools, scholars have chosen to use mammalian virus vectors such as modified retroviruses, adeno-associated viruses, and lentiviruses, as well as insect baculovirus vectors to conduct transgenic experiments on shrimp cells, but the recombinant virus infection efficiency is very low due to species differences. Therefore, a gentle and stable transgenic method is also very important.

[0005] In summary, although scholars have made many efforts in developing transgenic tools suitable for shrimp cells, most studies rely solely on reporter gene expression to verify the transgenic efficiency, and cannot achieve the effective expression and verification of functional genes, and the cells will die quickly after transfection. There is still a lack of a transgenic system for shrimp cells that can efficiently and stably express foreign genes. Therefore, it is necessary to establish a standardized transgenic vector suitable for freshwater crayfish hematopoietic tissue cells, lay a foundation for the development of immortalized shrimp cell lines, so as to obtain highly active shrimp hematopoietic tissue cells, provide raw materials for exploring the functions of shrimp hematopoietic tissue cells and gene regulation mechanisms, and also lay a foundation for the good variety breeding of freshwater crayfish. Summary of the Invention

[0006] The purpose of the present invention is to establish a transgenic vector suitable for freshwater crayfish hematopoietic tissue cells to solve this technical problem:

[0007] The first aspect of the present invention provides a promoter that is the same as or has 80%, 85%, 90%, 95%, or 98% homology with SEQ ID NO.12, SEQ ID NO.16, or SEQ ID NO.20.

[0008] The second aspect of the present invention provides the application of a promoter in constructing a transgenic vector for freshwater crayfish hematopoietic tissue cells.

[0009] In the third aspect of the present invention, a transgenic vector for freshwater crayfish hematopoietic tissue cells is provided. The transgenic vector includes an expression cassette, and the expression cassette includes a hybrid promoter group; the hybrid promoter group is sequentially connected by the sequences of SEQ ID NO.20, SEQ ID NO.12, and SEQ ID NO.16.

[0010] Furthermore, the expression cassette is composed of a hybrid promoter group linked to the Ast gene; the nucleotide sequence of the Ast gene is as shown in SEQ ID NO.10.

[0011] Furthermore, the transgenic vector is pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry.

[0012] In the fourth aspect of the present invention, a method for constructing a transgenic vector for freshwater crayfish hematopoietic tissue cells is provided, including the following steps: Step A: Obtain the freshwater crayfish hematopoietic factor Ast gene; Step B: Clone the P2 promoter and the WSV249 (-300 / -1) promoter; using pIZ-V5-His as the basic vector, and sequentially perform double digestion and ligation of the P2 promoter and P2A-mCherry to obtain the intermediate vector pIZ-OpIE2-P2-P2A-mCherry; Step C: Connect the WSV249 (-300 / -1) promoter and the Ast gene to the intermediate vector pIZ-OpIE2-P2-P2A-mCherry in sequence by homologous recombination to obtain the transgenic vector pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry.

[0013] Furthermore, Step A includes: Step A-1: Cultivate freshwater crayfish hematopoietic tissue cells using a 2D or 3D culture system to obtain freshwater crayfish hematopoietic tissue cells; Step A-2: Extract RNA and prepare cDNA from the freshwater crayfish hematopoietic tissue cells, and use the prepared cDNA as a template to clone the freshwater crayfish hematopoietic factor Ast gene to obtain the complete CDS sequence of the Ast gene.

[0014] In the fifth aspect of the present invention, an application of the transgenic vector in the culture of freshwater crayfish hematopoietic tissue cells, the establishment of hematopoietic tissue cell lines, the overexpression of foreign genes in hematopoietic tissue cells, the proliferation of hematopoietic tissue cells, the study of shrimp antiviral genes, or the detection of shrimp viruses for non-diagnostic and therapeutic purposes is provided.

[0015] Furthermore, the transgenic vector is introduced into the hematopoietic tissue cells of crayfish to enable the hematopoietic tissue cells of crayfish to stably grow for at least 3 months; the overexpression efficiency of exogenous genes in the hematopoietic tissue cells of crayfish is 18.01 ± 1.83%; the proliferation rate of the hematopoietic tissue cells of crayfish is 25.69 ± 1.19%.

[0016] Furthermore, the overexpression of exogenous genes in the hematopoietic tissue cells of crayfish is achieved by electroporation or chemical transfection; the operating parameters of the electroporation method are: voltage 200 V, electric pulse time 30 ms, number of electric pulses 2 times, electric pulse interval 10 s, and the electroporation buffer is CytoMix; the operating parameters of the chemical transfection method are: the ratio of the transfection reagent to plasmid DNA in the transfection complex is 2:1; the incubation time of the transfection complex with the hematopoietic tissue cells of crayfish is ≤ 6 h.

[0017] Furthermore, the crayfish is from the family Parastacidae or Astacidae; the family Parastacidae includes Cherax quadricarinatus, Astacopsis gouldi, Euastacus malacops, Euastacus fluviatilis or Euastacus destructor; the family Astacidae includes Procambarus clarkii, Cambaroides dauricus, Cambaroides similis or Astacus astacus.

[0018] The present invention has successfully developed a hybrid promoter group (OpIE2-P2-WSV249 (-300 / -1) ), and a transgenic expression vector (pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry) suitable for 2D or 3D culture of hematopoietic tissue cells of Cherax quadricarinatus by modifying the shrimp virus promoter and optimizing the transfection method. The coding sequence of the hematopoietic factor astakine of Cherax quadricarinatus is cloned and inserted into the transgenic expression vector, and the overexpression of the astakine gene is achieved under the electroporation transfection conditions of voltage 200 V, electric pulse time 30 ms, number of electric pulses 2 times, electric pulse interval 10 s, and the electroporation buffer being CytoMix, or under the chemical transfection conditions of a transfection reagent / DNA ratio of 2:1. Among them, the expression efficiency under the chemical transfection conditions reached about 18%, the proliferation rate of transgenic cells increased by about 7%, and healthy and stable growth was maintained for more than three months. Moreover, this transgenic expression vector can also be applied to other crayfish. Therefore, the present invention provides a reliable transgenic vector for the study of shrimp gene functions. The disclosed transgenic vector of the hematopoietic tissue cells of crayfish can not only support the expression and functional research of exogenous genes, but also ensure the healthy growth of the hematopoietic tissue cells of crayfish after transgenic operation, laying a foundation for the development of immortalized cell lines of shrimp. Brief Description of the Drawings

[0019] The above content of the present invention and the following specific embodiments will be better understood when read in conjunction with the accompanying drawings. It should be noted that the drawings are only examples of the claimed technical solutions.

[0020] Figure 1 For the RNA agarose gel electrophoresis map of the blood cells of Cherax quadricarinatus in Example 1 (wherein, the first lane is the marker; the second lane is the RNA, the 28 S band is about 1800 bp, and the 18 S band is about 900 bp);

[0021] Figure 2 For the sequence alignment map of the known astakine proteins of shrimp and crabs in Example 1 (wherein, Ast is Astakine; Pl is Pacifastacus leniusculus; Lv is Litopenaeus vannamei; Mj is Marsupenaeus japonicus; Pm is Penaeus monodon; Es is Eriocheir sinensis; Pc is Procambarus clarkii);

[0022] Figure 3 For the agarose gel electrophoresis map of the first amplification product in Example 1 (wherein, the first lane is the marker; the second to fifth lanes are the first amplification products at annealing temperatures of 48 °C, 50 °C, 53 °C, and 54 °C respectively);

[0023] Figure 4 For the agarose gel electrophoresis map of the second amplification product in Example 1 (wherein, the first lane is the marker; the second lane is the cloned astakine gene of Cherax quadricarinatus, and the band is about 450 bp);

[0024] Figure 5 For the agarose gel electrophoresis map of the third amplification product in Example 1 (wherein, the first lane is the marker; the second to fifth lanes are all the bacterial solutions of the astakine gene of Cherax quadricarinatus ligated to the pMD18-T vector, and the band is about 490 bp);

[0025] Figure 6 For the nucleic acid and amino acid sequence map of the coding frame (CDS) of the astakine gene of Cherax quadricarinatus in Example 1;

[0026] Figure 7 For the predicted domain map of the coding frame (CDS) of the astakine gene of Cherax quadricarinatus in Example 1;

[0027] Figure 8 For the multiple sequence alignment map of the coding frame (CDS) of the astakine gene of Cherax quadricarinatus and other proteins containing the Prokineticin domain in Example 1;

[0028] Figure 9 For the phylogenetic analysis map of the coding frame (CDS) of the astakine gene of Cherax quadricarinatus in Example 1;

[0029] Figure 10 It is the agarose gel electrophoresis pattern of the fourth amplification product in Example 1 (where, the first lane is the marker; the second to fourth lanes are all the P2 promoter, and the band is around 110 bp);

[0030] Figure 11 It is the agarose gel electrophoresis pattern of the fifth and sixth amplification products in Example 1 (where, A is the fifth amplification product WSV249 (-504 / -1) promoter, and the band is around 500 bp; B is the sixth amplification product WSV249 (-300 / -1) promoter, and the band is around 330 bp);

[0031] Figure 12 It is the map of the pIZ-V5-His basic vector in Example 1;

[0032] Figure 13 It is the agarose gel electrophoresis pattern of the seventh amplification product in Example 1 (where, the first lane is the marker; the second to fifth lanes are all the inserted sequence P2-Ast-P2A-mCherry, and the band size is around 1300 bp);

[0033] Figure 14 It is the map of the pIZ-OpIE2-P2-Ast-P2A-mCherry vector in Example 1;

[0034] Figure 15 It is the agarose gel electrophoresis pattern of the eighth amplification product in Example 2 (where, the first to second lanes are all the inserted sequence WSV249 (-504 / -1) -Ast, and the band size is around 900 bp; the third lane is the marker);

[0035] Figure 16 It is the map of the pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry vector in Example 2;

[0036] Figure 17 It is the agarose gel electrophoresis pattern of the ninth amplification product in Example 3 (where, the first lane is the marker; the second to third lanes are all the inserted sequence WSV249 (-300 / -1) -Ast, and the band size is around 750 bp);

[0037] Figure 18 It is the map of the pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry vector in Example 3;

[0038] Figure 19Agarose gel electrophoresis patterns of three expression vector plasmids in Example 4 (where: in A, the first lane is the marker, and the second lane is the pIZ-OpIE2-P2-Ast-P2A-mCherry plasmid DNA (plasmid a)); in B, the first and fourth lanes are both markers, and the second lane is the pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry plasmid DNA (plasmid b); the third lane is blank; the fifth lane is the pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry plasmid (plasmid c);

[0039] Figure 20 Light microscopy and mCherry fluorescence images of the expression of the red claw crayfish astakine gene expression vector in Sf9 cells in Test Example 1 (where A1-A2, B1-B2, and C1-C2 are the light microscopy images (bright field) and mCherry fluorescence images of the pIZ-OpIE2-P2-Ast-P2A-mCherry plasmid transfected into Sf9 cells for 24, 48, and 72 h, respectively; D1-D2, E1-E2, and F1-F2 are the light microscopy images (bright field) and mCherry fluorescence images of the pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry plasmid transfected into Sf9 cells for 24, 48, and 72 h, respectively; G1-G2, H1-H2, and I1-I2 are the light microscopy images (bright field) and mCherry fluorescence images of the pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry plasmid transfected into Sf9 cells for 24, 48, and 72 h, respectively; the scale bar is 100 μm);

[0040] Figure 21 Statistical chart of the expression efficiency of the red claw crayfish astakine gene expression vector in Sf9 cells in Test Example 1 (the abscissa is the transfection efficiency; the ordinate is the transfection time, which are 24 h, 48 h, and 72 h, respectively; ** and *** represent significant differences and extremely significant differences, respectively);

[0041] Figure 22 In Test Example 1, pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry vector construction annotation diagram (where, blue is the P2 promoter; green is the WSV249 (-300 / -1) promoter; orange is the astakine gene; pink is the P2A short peptide; red is the mCherry gene fluorescence label);

[0042] Figure 23 Light microscopy and fluorescence images of the HPT cell viability of Cherax quadricarinatus under different voltage conditions in Test Example 2 (where A1 - A2, B1 - B2, C1 - C2, D1 - D2, E1 - E2, F1 - F2, G1 - G2, H1 - H2, I1 - I2, and J1 - J2 are light microscopy images (bright field) and Calcein - AM fluorescence images of Calcein - AM cell viability after electroporation of HPT cells at voltages of 0, 50, 100, 200, 300, 400, 500, 600, 800, and 1000 V respectively; scale bar is 50 μm);

[0043] Figure 24 Statistical chart of the survival rate of Cherax quadricarinatus HPT cells under different voltage conditions in Test Example 2 (where the abscissa is the cell viability, unit (%); the ordinate is the voltage, unit (V); *, **, and *** represent differences, significant differences, and extremely significant differences respectively);

[0044] Figure 25 Light microscopy and fluorescence images of the cell viability of Cherax quadricarinatus HPT cells under different electropulse durations in Test Example 3 (where A1 - A2, B1 - B2, C1 - C2, D1 - D2, E1 - E2, F1 - F2, G1 - G2, H1 - H2, and I1 - I2 are light microscopy images (bright field) and Calcein - AM fluorescence images of Calcein - AM cell viability after electroporation of HPT cells at electropulse durations of 0, 1, 5, 10, 15, 20, 25, 30, and 40 ms respectively; scale bar is 50 μm);

[0045] Figure 26 Statistical chart of the survival rate of Cherax quadricarinatus HPT cells under different electropulse durations in Test Example 3 (where the abscissa is the cell viability, unit (%); the ordinate is the electropulse duration, unit (ms); *** represents an extremely significant difference);

[0046] Figure 27 Light microscopy and fluorescence images of the cell viability of Cherax quadricarinatus HPT cells under different electroporation buffers in Test Example 4 (where A1 - A2, B1 - B2, C1 - C2, D1 - D2, and E1 - E2 are light microscopy images and Calcein - AM fluorescence images of Calcein - AM cell viability after electroporation of HPT cells at electropulse durations of 0, 10, 20, 30, and 40 ms using CytoMix electroporation buffer; F1 - F2, G1 - G2, H1 - H2, I1 - I2, and J1 - J2 are light microscopy images and Calcein - AM fluorescence images of Calcein - AM cell viability after electroporation of HPT cells at electropulse durations of 0, 10, 20, 30, and 40 ms using HEPES electroporation buffer; scale bar is 50 μm);

[0047] Figure 28 Statistical chart of the survival rate of HPT cells of Cherax quadricarinatus under different electroporation buffers in Test Example 4 (where the abscissa is the cell viability, unit (%); the ordinate is the electroporation buffer; * and *** represent significant and extremely significant differences respectively);

[0048] Figure 29 Light microscope and fluorescence images of the activity of Cherax quadricarinatus HPT cells using different ratios of chemical transfection reagents in Test Example 5 (where A1 - A2, B1 - B2, and C1 - C2 show the light microscope images (bright field) and mCherry fluorescence microscopic images of HPT cells transfected with a transfection reagent / DNA ratio of 1:1 for 24, 48, and 72 h respectively, D1 - D2, E1 - E2, and F1 - F2 show the light microscope images (bright field) and mCherry fluorescence microscopic images of HPT cells transfected with a transfection reagent / DNA ratio of 2:1 for 24, 48, and 72 h respectively, G1 - G2, H1 - H2, and I1 - I2 show the light microscope images (bright field) and mCherry fluorescence microscopic images of HPT cells transfected with a transfection reagent / DNA ratio of 3:1 for 24, 48, and 72 h respectively, J1 - J2, K1 - K2, and L1 - L2 show the light microscope images (bright field) and mCherry fluorescence microscopic images of HPT cells transfected with a transfection reagent / DNA ratio of 4:1 for 24, 48, and 72 h respectively; the scale bar is 50 μm);

[0049] Figure 30 Statistical chart of the transfection efficiency of Cherax quadricarinatus HPT cells using different ratios of chemical transfection reagents in Test Example 5 (where the abscissa is the transfection efficiency, unit (%); the ordinate is the transfection time, which are 24 h, 48 h, and 72 h respectively; ** and *** represent significant and extremely significant differences respectively);

[0050] Figure 31 Fluorescence images of Cherax quadricarinatus HPT cells under different transfection methods in Test Example 6 (where A1 - A3, B1 - B3, and C1 - C3 are mCherry fluorescence images of overexpression of astakine in HPT cells by electroporation, A1, B1, and C1 are bright field, A2, B2, and C2 are mCherry fluorescence, and A3, B3, and C3 are bright field - fluorescence merged; Figures D1 - D3, E1 - E3, and F1 - F3 are mCherry fluorescence images of overexpression of astakine in HPT cells by chemical transfection, D1, E1, and F1 are bright field, D2, E2, and F2 are mCherry fluorescence, and D3, E3, and F3 are bright field - fluorescence merged; the scale bar is 50 μm);

[0051] Figure 32Statistical chart of transfection efficiency of red claw crayfish HPT cells under different transfection methods in Test Example 6 (where the abscissa is the transfection time, unit (h); the ordinate is the transfection efficiency, unit (%); *** represents a significant difference);

[0052] Figure 33 Agarose gel electrophoresis diagram of semi - quantitative RT - PCR amplification of mCherry gene in red claw crayfish HPT cells in Test Example 6 (where lane 1 is Marker; lane 2 is the untransfected cell control; lane 3 is 24 h; lane 4 is 48 h; lane 5 is 72 h; the band around 1000 bp is β - actin; the band around 750 bp is mCherry; A is electroporation; B is chemical transfection);

[0053] Figure 34 Statistical result chart of the gray value of the mCherry gene band in red claw crayfish HPT cells in Test Example 6 (where the abscissa is the transfection time, unit (h); the ordinate is the gray value; ** and *** represent significant difference and extremely significant difference respectively);

[0054] Figure 35 Fluorescence images of red claw crayfish HPT cell spheres under different transfection methods in Test Example 7 (where A1 - A3, B1 - B3 and C1 - C3 are mCherry fluorescence images of over - expression of astakine in HPT cell spheres by electroporation, A1, B1 and C1 are bright - field images, A2, B2 and C2 are mCherry fluorescence images, A3, B3 and C3 are merged bright - field and fluorescence images; Figures D1 - D3, E1 - E3 and F1 - F3 are mCherry fluorescence images of over - expression of astakine in HPT cell spheres by chemical transfection, D1, E1 and F1 are bright - field images, D2, E2 and F2 are mCherry fluorescence images, D3, E3 and F3 are merged bright - field and fluorescence images; the scale bar is 50 μm);

[0055] Figure 36 Statistical chart of transfection efficiency of red claw crayfish HPT cell spheres under different transfection methods in Test Example 7 (where the abscissa is the transfection time, unit (h); the ordinate is the transfection efficiency, unit (%); *** represents a significant difference);

[0056] Figure 37Agarose gel electrophoresis diagram of semi-quantitative RT-PCR amplification of mCherry gene in red claw crayfish HPT cell spheres in Test Example 7 (wherein, lane 1 is Marker; lane 2 is the untransfected cell control; lane 3 is 24 h; lane 4 is 48 h; lane 5 is 72 h; the band around 1000 bp is β-actin; the band around 750 bp is mCherry; A is electroporation; B is chemical transfection);

[0057] Figure 38 Statistical result diagram of the gray value of the mCherry gene band in red claw crayfish HPT cell spheres in Test Example 7 (wherein, the abscissa is the transfection time, unit (h); the ordinate is the gray value; * and ** respectively represent having differences and significant differences);

[0058] Figure 39 Light microscope and fluorescence images of astakine transgenic red claw crayfish HPT cells in Test Example 8 after 72 h of transfection treatment (wherein, A1-A5, B1-B5 and C1-C5 are the light microscope images and fluorescence images of EdU proliferation in crayfish HPT cells after different transfection treatments for 72 h; A1, B1 and C1 are bright fields; A2, B2 and C2 are Hoechst fluorescence; A3, B3 and C3 are EdU fluorescence; A4, B4 and C4 are mChreey fluorescence; A5, B5 and C5 are bright field-fluorescence merge; NT is the negative control group; MT is the conditional control group; PT is the experimental group; the scale bar is 50 μm);

[0059] Figure 40 Diagram of transfection efficiency and proliferation rate of astakine transgenic red claw crayfish HPT cells in Test Example 8 after 72 h of transfection treatment (wherein mCherry represents transfection efficiency; EdU represents proliferation efficiency; *, ** and *** respectively represent having differences, significant differences and extremely significant differences);

[0060] Figure 41 Agarose gel electrophoresis diagram of semi-quantitative RT-PCR amplification of astakine and PCNA in astakine transgenic red claw crayfish HPT cells in Test Example 8 (wherein, lane 1 is Marker; lane 2 is the NT negative control; lane 3 is the PT experimental group; A: the band around 1000 bp is β-actin; B: the band around 500 bp is astakine; C: the band around 600 bp is PCNA);

[0061] Figure 42Statistical result chart of the gray values of astakine and PCNA gene bands in astakine transgenic redclaw crayfish HPT cells in Test Example 8 (where the abscissa represents the NT negative control group and the PT experimental group; the ordinate represents the gray value; * and *** represent differences and extremely significant differences respectively). Detailed implementation manners

[0062] The detailed features and advantages of the present invention are described in detail in the following detailed implementation manners. The content is sufficient for any person skilled in the art to understand the technical content of the present invention and implement it accordingly. According to the specification, claims and drawings disclosed in this specification, those skilled in the art can easily understand the related purposes and advantages of the present invention.

[0063] It should be noted that in this specification, similar reference numerals and letters denote similar items in the following drawings. Therefore, once an item is defined in one drawing, it does not need to be further defined and explained in subsequent drawings.

[0064] To make the objectives, technical solutions and advantages of the present invention clearer, the implementation manners of the present invention will be further described in detail below with reference to the drawings. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0065] (1) Source of sample materials

[0066] In this implementation manner, healthy redclaw crayfish are purchased from the Freshwater Fisheries Research Institute of Zhejiang Province.

[0067] (2) Source of reagents and consumables

[0068] Table 1 Sources and catalog numbers of reagents and consumables required for the experiment

[0069] Name Manufacturer Collagenase I Sigma Fetal Bovine Serum (FBS) BI 400-mesh Silk Screen Qingdao Beibei District Feimat Experimental Supplies Business Department Ophthalmic Scissors, Forceps Jiangxi Yuyuan Medical Devices Co., Ltd. Sterilizable Needle Filter Qingdao Beibei District Feimat Experimental Supplies Business Department SIM-SF Insect Cell Culture Medium Beijing Protein Innovation Co., Ltd. Trypsin Beijing Solarbio Science & Technology Co., Ltd. Enzyme-Free Cell Digestive Solution Beijing PrimeRNA Gene Technology Co., Ltd. TIANamp Genomic DNA Kit Tiangen Biochemical Technology (Beijing) Co., Ltd. DNase I Merck KGaA Potassium Chloride (KCl) Sinopharm Chemical Reagent Co., Ltd. Sodium Chloride (NaCl) Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Potassium dihydrogen phosphate (KH 2 PO 4 )]]> Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Sodium hydrogen phosphate (Na 2 HPO 4 ).]]> Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Sodium bicarbonate (NaHCO 3 ).]]> Sinopharm Chemical Reagent Co., Ltd. Sodium Hydroxide (NaOH) Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Magnesium chloride hexahydrate (MgCl 2 ·6H 2 O)]]> Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Absolute ethanol (C 2 H 5 OH)]]> Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Dipotassium hydrogen phosphate trihydrate (K 2 HPO 4 ·3H 2 O)]]> Sinopharm Chemical Reagent Co., Ltd. 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic Acid (HEPES) Sinopharm Chemical Reagent Co., Ltd. <![CDATA[Manganese chloride (MnCl 2 ).]]> Sinopharm Chemical Reagent Co., Ltd. Sorbitol Sinopharm Chemical Reagent Co., Ltd. Lysine Shanghai Macklin Biochemical Co., Ltd. Taurine Shanghai Aladdin Biochemical Technology Co., Ltd. Proline Shanghai Aladdin Biochemical Technology Co., Ltd. Aspartic acid Shanghai Aladdin Biochemical Technology Co., Ltd. Glutamic acid Shanghai Aladdin Biochemical Technology Co., Ltd. Hydroxyproline Shanghai Aladdin Biochemical Technology Co., Ltd. Ornithine Shanghai Aladdin Biochemical Technology Co., Ltd. Cystine Shanghai Aladdin Biochemical Technology Co., Ltd. β-Alanine Shanghai Macklin Biochemical Co., Ltd. γ-Aminobutyric Acid (γ-ABA) Shanghai Macklin Biochemical Co., Ltd. Glutamine Shanghai Aladdin Biochemical Technology Co., Ltd. Glucose Sinopharm Chemical Reagent Co., Ltd. Trehalose Shanghai Aladdin Biochemical Technology Co., Ltd. Gentiobiose J&K Scientific Ltd. Sucrose Shanghai Aladdin Biochemical Technology Co., Ltd. Ribose Shanghai Aladdin Biochemical Technology Co., Ltd. Arabinose Shanghai Aladdin Biochemical Technology Co., Ltd. Lactose Shanghai Aladdin Biochemical Technology Co., Ltd. Fucose Shanghai Aladdin Biochemical Technology Co., Ltd. Xylose Shanghai Aladdin Biochemical Technology Co., Ltd. Fructose Shanghai Aladdin Biochemical Technology Co., Ltd. ATP Shanghai Beyotime Biotechnology Co., Ltd. Trans IT®-Insect Transfection Reagent Mirus Bleomycin Lifesensors Restriction Endonuclease TaKaRa T4 Ligase TaKaRa PrimeScript™ RT reagent Kit TaKaRa Premix Taq™ TaKaRa pMD™ 18-T Vector TaKaRa Trans2K PLUS DNA Marker TransGen Biotech Trans2K PLUS II DNA Marker TransGen Biotech TransZolTM Up Plus RNA Kit TransGen Biotech EasyPure Plasmid MiniPrep Kit TransGen Biotech EasyPure HiPure Plasmid MaxiPrep Kit TransGen Biotech EZ-10 Column DNA Gel Extraction Kit Sangon Biotech (Shanghai) Co., Ltd. DH5α Chemically Competent Cells Vazyme Biotech Co., Ltd. Leibovitz’s L-15 Thermo Fisher Scientific (Gibco) Calcein-AM Reagent Shanghai Beyotime Biotechnology Co., Ltd. EdU Imaging Kits Thermo Fisher Scientific Epidermal Growth Factor (EGF) Sino Biological Inc. Basic Fibroblast Growth Factor (bFGF) Sino Biological Inc. pIZ-V5-His Plasmid Beijing HuaYuYang Biotechnology Co., Ltd. 50×TAE Electrophoresis Buffer Solarbio Science & Technology Co., Ltd. 100× Penicillin-Streptomycin Antibiotic Stock Solution Solarbio Science & Technology Co., Ltd. Cell Fixative Shanghai Beyotime Biotechnology Co., Ltd. Cell Permeabilization Solution Shanghai Beyotime Biotechnology Co., Ltd. Cell Wash Solution Shanghai Beyotime Biotechnology Co., Ltd. Sf9 Cells Qingdao ShunLeJia Biotechnology Co., Ltd. Grace Serum-Free Insect Cell Medium Thermo Fisher Scientific (Gibco)

[0070] (3) Source of instruments and equipment

[0071] Table 2 Sources and models of instruments and equipment required for the experiment

[0072] Name Manufacturer ECM830 Electroporator BTX Electroporation Cuvette BTX Ultra-Low Attachment Cell Culture Plate Corning Incorporated Vertical Pressure Steam Sterilizer Shanghai Shenan Medical Instrument Factory Pipette Eppendorf Laminar Flow Hood Suzhou Antai Air Technology Co., Ltd. pH Meter Mettler Toledo Instruments (Shanghai) Co., Ltd. Ultra-Pure Water Machine Jinan Taipingma Equipment Co., Ltd. Electrothermal Thermostatic Blast Dryer Shanghai Jinghong Experimental Equipment Co., Ltd. Diaphragm Vacuum Pump Tianjin Jinteng Equipment Co., Ltd. Magnetic Stirrer Shanghai Huxi Instrument Factory Co., Ltd. Inverted Fluorescence Microscope Nikon Corporation, Japan Electronic Balance Radwag, Poland Refrigerator Qingdao Haier Co., Ltd. Constant Temperature Water Bath Jiangsu Shuangjie Experimental Instrument Factory Snowflake Ice Maker Changshu Xueke Electric Appliance Co., Ltd. Refrigerated Centrifuge Eppendorf AG, Germany High-Speed Centrifuge Xiangyi Centrifuge Co., Ltd. Double-Head Oxygenation Pump Guangdong Minjiang Aquarium Industry Co., Ltd. High-Speed Electric Homogenizer Jiangsu Zhongda Instrument Factory Freezing Point Osmometer Shanghai Medical Instrument Factory HF-90 Carbon Dioxide Incubator Shanghai Lishen Scientific Instrument Co., Ltd. JY-C Electrophoresis Apparatus Beijing Junyi Oriental Electrophoresis Equipment Co., Ltd. JY04S-3C Gel Imaging Analysis System Beijing Junyi Oriental Electrophoresis Equipment Co., Ltd. 100 W Heating Rod Qingdao Kangsi Jia Experimental Equipment Business Department Microplate Reader Thermo Fisher Scientific WH-2 Mini Vortex Mixer Shanghai Huxi Analytical Instrument Factory Co., Ltd. Bench-Top Thermostatic Shaker Shanghai Jinghong Experimental Equipment Co., Ltd. Biochemical Incubator Shanghai Jinghong Experimental Equipment Co., Ltd. Laser Scanning Confocal Microscope (LSM510) Carl Zeiss AG, Germany Metal Bath Tiangen Biochemical Technology (Beijing) Co., Ltd. Mini Low-Speed Centrifuge Tiangen Biochemical Technology (Beijing) Co., Ltd. Cell Culture Flask / Culture Plate Corning Incorporated, USA Disposable Syringe Filter Sartorius AG, Germany Disposable Syringe Shaanxi Longkangxin Medical Device Co., Ltd.

[0073] (4) Preparation methods of experimental reagents

[0074] 1) Preparation of PBS

[0075] PBS refers to phosphate buffer saline (PBS). The preparation method is as follows: Weigh 4.0 g of NaCl, 0.1 g of KCl, and 1.5 g of Na 2HPO 4 ·12H 2 O and 0.1 g KH 2 PO 4 in a volumetric flask, and dissolve it thoroughly with ddH 2 O. Then make up the volume to 500 mL, sterilize it at 121 °C under high temperature and high pressure for 20 min. After that, aseptically dispense the cooled PBS into 100-mL reagent bottles in a laminar flow hood and store them in a 4 °C refrigerator for later use.

[0076] 2) Preparation of CPBS

[0077] CPBS refers to the phosphate buffer saline of Cherax quadricarinatus (CPBS). The preparation method is as follows: Weigh 8.8 g of NaCl, 1.11 mg of CaCl 2 , 1.26 mg of MnCl 2 , 1.42 g of Na 2 HPO 4 and 1.36 g of KH 2 PO 4 in a volumetric flask, and dissolve it thoroughly with ddH 2 O. Then make up the volume to 1000 mL, sterilize it at 121 °C under high temperature and high pressure for 20 min. After that, aseptically dispense the cooled CPBS into 100-mL reagent bottles in a laminar flow hood and store them in a 4 °C refrigerator for later use.

[0078] 3) Preparation of 0.25% trypsin

[0079] Weigh 0.25 g of trypsin in a volumetric flask, and dissolve it thoroughly with PBS. Then make up the volume to 100 mL. After that, filter and sterilize it (0.22 μm) in a laminar flow hood, aseptically dispense it into 15-mL centrifuge tubes, and store it in a -20 °C refrigerator for long-term use and in a 4 °C refrigerator for short-term use.

[0080] 4) Preparation of 0.1% collagenase I tissue dissociation solution

[0081] Fully dissolve 100 mg of collagenase I powder in 100 mL of L-15 medium, which is 0.1% collagenase I tissue dissociation solution (100 mg mL -1 ). Filter and sterilize it through a 0.22-μm needle filter into a 100-mL reagent bottle in a laminar flow hood. After appropriate dispensing, store it in a -20 °C refrigerator for later use, and avoid repeated freezing and thawing.

[0082] 5) Preparation of Sf9 cell medium

[0083] Under aseptic conditions, measure 90 mL of SIM-SF insect cell culture medium into a sterile serum bottle, and add fetal bovine serum (FBS) at a total volume of 10% (v / v), penicillin sodium at a final concentration of 100 IU / mL -1 , streptomycin sulfate at a final concentration of 100 μg / mL -1 and amphotericin B at a final concentration of 0.25 mg / L -1 . After mixing well, place it in a 4°C refrigerator and use it within 1 month.

[0084] 6) Aseptic preparation of red swamp crayfish serum (CP)

[0085] Before collecting hemolymph, the crayfish need to be anesthetized in crushed ice for about 10 min first, and then the anesthetized crayfish is soaked in 75% ethanol for 10 min for deep anesthesia and disinfection, and the crayfish is fixed with an alcohol cotton strip. Use a 10 mL syringe pre-filled with about 5 mL of CPBS, insert it into the area below the base of the fifth walking leg and above the first abdominal segment, and slowly aspirate the hemolymph. After inverting and mixing the hemolymph and CPBS in a 1:1 ratio, centrifuge at 1000 × g for 5 min at 4°C, and take the supernatant as the crude mixture of serum and CPBS. Incubate the crude mixture in a 56°C water bath for 30 min, and then centrifuge at 5000 × g for 20 min at 4°C to remove the precipitate. Finally, aliquot the prepared crayfish serum (CP) appropriately and store it in a -20°C refrigerator for later use.

[0086] 7) Preparation of 60% glycerol

[0087] Dilute 60 mL of glycerol to 100 mL with sterilized ddH 2 O, filter through a 0.45 μm filter membrane and store at 4°C.

[0088] 8) Preparation of cell conductance solution - HEPES buffer

[0089] HEPES buffer is a buffer solution for cell electroporation. The preparation method is as follows: Weigh 57 mg of KH 2 PO 4 , 20 mg of MgCl 2 ·6H 2 O, 246 mg of K 2 HPO 4 ·3H 2 O, 48 mg of HEPES and 5.47 g of sorbitol in a volumetric flask, and dissolve them thoroughly with ddH 2 O and then make up the volume to 100 mL. Then, filter and sterilize it through a 0.22 μm needle filter into a 100 mL reagent bottle in a laminar flow hood and store it in a 4°C refrigerator for later use.

[0090] 9) Preparation of CytoMix buffer for cell conductance solution

[0091] CytoMix buffer is a buffer solution for cell electroporation. The preparation method is as follows: Weigh 0.9 g of KCl, 1.7 mg of CaCl 2 , 174.2 mg of K 2 HPO 4 ·3H 2 O, 600 mg of HEPES, 76.2 mg of EGTA·2Na, 47.6 mg of MgCl 2 , ATP with a final concentration of 200 mM and 153.8 mg of glutathione into a volumetric flask, and dissolve them fully with ddH 2 O and make up the volume to 100 mL. Then filter and sterilize it through a 0.22 μm needle filter into a 100 mL reagent bottle in a laminar flow hood, and dispense an appropriate amount under sterile conditions, and store it in a -20°C refrigerator for later use.

[0092] 10) Preparation of 1% agarose gel

[0093] Weigh 0.2 g of agarose powder into a 50 mL conical flask, add 20 mL of 1× TAE solution, heat it in a microwave oven until completely dissolved, then pour it into a mold, and use it after cooling and solidifying.

[0094] 11) Preparation of LB liquid medium

[0095] Weigh 1.0 g of tryptone, 0.5 g of yeast extract and 1.0 g of NaCl and dissolve them in ddH 2 O, adjust the pH to 7.2 ± 0.2, and make up the volume to 100 mL. Autoclave it at 121°C and then cool it to room temperature, store it at 4°C for later use, and add an appropriate amount of antibiotic according to different plasmid resistances before use.

[0096] 12) Preparation of LB solid medium

[0097] Weigh 1.0 g of tryptone, 0.5 g of yeast extract, 1.0 g of NaCl and 1.5 g of agarose and dissolve them in ddH 2 O, adjust the pH to 7.2 ± 0.2 and make up the volume to 100 mL. Autoclave it at 121°C and then cool it to about 60°C, and add an appropriate amount of antibiotic according to the plasmid resistance requirement, mix well and pour the medium into a petri dish to obtain LB solid medium plates with different plasmid resistances.

[0098] 13) Preparation of the cell growth medium for Cherax quadricarinatus (OCCM)

[0099] As shown in Table 3, it is the formula of the cell growth medium for Cherax quadricarinatus. Adjust the pH value to 7.2 ± 0.2. This formula is from the published literature: Zhao, Y., Xue, T., Wang, J. & Guo, H. Development of reliable in vitro long-term culture systems for hematopoietic cells of crayfish Cherax quadricarinatus and virus susceptibility assay. Aquaculture 589, 741016, doi: 10.1016 / j.aquaculture.2024.741016 (2024).

[0100] Table 3 Formula of the cell growth medium (OCCM) for Cherax quadricarinatus

[0101] Amino Acid <![CDATA[Final concentration (unit: mg L -1 ).]]> Carbohydrate <![CDATA[Final concentration (unit: mg L -1 ).]]> Glycine 200 Fructose 5.91 L-Alanine 225 Arabinose 18.86 L-Arginine 500 Trehalose 233.79 L-Asparagine 250 Gentiobiose 88.09 L-Cysteine 120 D-Galactose 900 L-Glutamine 300 Vitamin <![CDATA[Final concentration (unit: mg L -1 ).]]> L-Histidine 250 Inositol 2 L-Isoleucine 250 Folic Acid 1 L-Leucine 125 Nicotinamide 1 L-Lysine 245.85 Choline Chloride 1 L-Methionine 75 D-Calcium Pantothenate 1 L-Phenylalanine 125 Pyridoxine Hydrochloride 1 L-Serine 200 Thiamine Phosphate 1 L-Threonine 300 Riboflavin-5'-Phosphate Sodium 0.1 L-Tryptophan 20 Inorganic Salt <![CDATA[Final concentration (unit: mg L -1 ).]]> L-Tyrosine 300 KCl (Potassium Chloride) 400 L-Valine 100 NaCl (Sodium Chloride) 8000 Taurine 829.12 <![CDATA[CaCl 2 (Calcium chloride)]]> 140 L-Proline 1518.28 <![CDATA[MgCl 2 (Magnesium chloride)]]> 93.7 L-Aspartic Acid 53.90 <![CDATA[MgSO 4 (Magnesium sulfate)]]> 97.7 L-Glutamic Acid 98.39 <![CDATA[KH 2 PO 4 (Potassium Dihydrogen Phosphate)]]> 60 Hydroxyproline 62.55 <![CDATA[Sodium 2 Hydrogen Phosphate 4 (Disodium Hydrogen Phosphate)]]> 190 Ornithine 18.40 <![CDATA[NaHCO 3 (Sodium bicarbonate)]]> 1000 L-Cystine 23.20 Other Components <![CDATA[Final concentration (unit: L -1 ).]]> β-Alanine 4.56 Fetal Bovine Serum (FBS) 50 mL γ-Aminobutyric Acid 3.06 Crayfish Plasma (CP) 30 mL Carbohydrate <![CDATA[Final concentration (unit: mg L -1 ).]]> Phenol Red 10 mg Xylose 5.52 Streptomycin Sulfate <![CDATA[1.0 × 10 5 μg <!-- 11 -->]]> Fucose 7.63 Sodium Pyruvate 550 mg Ribose 27.52 Sodium Penicillin <![CDATA[1.0 × 10 5 IU]]> Glucose 2935.55 Epidermal Growth Factor (EGF) 20 μg Sucrose 69.41 Basic Fibroblast Growth Factor (bFGF) 20 μg Lactose 17.53

[0102] Example 1

[0103] A transgenic system for hematopoietic tissue cells of freshwater crayfish includes the following steps:

[0104] S1. Cell culture, and the specific steps are as follows:

[0105] (1) Culture of Spodoptera frugiperda ovarian (Sf9) cells

[0106] Culture the resuscitated Sf9 cells in SIM-SF insect cell medium, place them in a biochemical incubator at 28°C, and perform subculture every 3 days with 0.25% trypsin at a ratio of 1:3.

[0107] (2) Primary culture of hematopoietic tissue (HPT) cells of Cherax quadricarinatus

[0108] ① Sampling of hematopoietic tissue (HPT) of Cherax quadricarinatus

[0109] Anesthetize the Cherax quadricarinatus in crushed ice for about 10 min, soak the anesthetized crayfish in 75% ethanol for 10 min for deep anesthesia and disinfection. Fix a pair of chelipeds and the abdominal part of the anesthetized and disinfected Cherax quadricarinatus with alcohol cotton strips and rubber bands, and place it in a laminar flow hood for sampling.

[0110] Use sterile scissors to cut and carefully remove the shell on the gills and back of the red claw crayfish, exposing the hematopoietic tissue as much as possible. Use ophthalmic scissors to cut off the connection between the hematopoietic tissue and other tissues. Use sterile tweezers to carefully clip the hematopoietic tissue out and place it in a sterilized bottle containing CPBS. The sampling is now completed and the red claw crayfish hematopoietic tissue (HPT) is obtained.

[0111] ② Aseptic preparation of hematopoietic tissue cells of red claw crayfish and its 2D and 3D cell culture

[0112] The red claw crayfish hematopoietic tissue was repeatedly rinsed with CPBS for 7 times, and then washed twice with basal culture medium (serum-free L-15 culture medium). The crayfish hematopoietic tissue was placed in a centrifuge tube containing 1 mL of 0.1% collagenase I and cut into pieces. The cells were repeatedly ground with a sterile pestle to dissociate the cells from the red claw crayfish hematopoietic tissue. The entire enzymatic hydrolysis process was completed within 20 min to obtain the crayfish hematopoietic tissue cell dissociation solution. The red claw crayfish hematopoietic tissue cell dissociation solution was filtered using two layers of 400-mesh sterilized sieves, and the filtrate was collected and centrifuged at 600 × g for 5 min. The supernatant was discarded to obtain the first precipitate, and 1 mL of basal culture medium was added to resuspend the first precipitate, and the second precipitate was centrifuged again (the same conditions as above) to obtain the second precipitate (i.e., the red claw crayfish HPT cell precipitate). The red claw crayfish HPT cell precipitate was resuspended in the red claw crayfish cell growth medium, inoculated in a cell culture plate or a low-adsorption cell culture plate, and placed at 28°C with 3% CO 2 2D culture or 3D culture was carried out in a cell culture incubator, and half of the medium was changed once a day to obtain red claw crayfish hematopoietic tissue cells (crayfish HPT cells).

[0113] Among them, both the 2D culture or 3D culture system are derived from the published literature: Zhao, Y., Xue, T., Wang, J. & Guo, H. Development of reliable in vitro long-term culture systems for hematopoietic cells of crayfish Cherax quadricarinatus and virus susceptibility assay. Aquaculture 589, 741016, doi: 10.1016 / j.aquaculture.2024.741016 (2024). 2D culture refers to suspending cells in a flat culture dish; 3D culture is a cell culture method that simulates the three-dimensional growth environment in vivo. By allowing cells to aggregate into 3D spheres or adhere, extend, and grow on a three-dimensional structure carrier with a component structure similar to solid tissue, the proliferation and differentiation of cells are co-regulated in terms of time and space, so that the tissue structure and function can be retained to a large extent.

[0114] S2. Cloning of the astakine gene (abbreviated as Ast gene) of the hematopoietic factor of Cherax quadricarinatus

[0115] There are various methods to obtain the Ast gene of Cherax quadricarinatus, such as gene cloning, artificial synthesis, gene library screening, gene sequencing, etc. This patent mainly obtains the Ast gene of Cherax quadricarinatus through the gene cloning method.

[0116] (1) Preparation of cDNA of Cherax quadricarinatus hemocytes

[0117] RNA extraction: Use TransZol TMExtract the RNA of red swamp crayfish hemocytes using the Up Plus RNA Kit (TransGen Biotech) (all reagents mentioned below are included in this kit). The specific experimental method is as follows: Use a 10 mL syringe pre-filled with about 5 mL of CPBS to pierce the area below the base of the fifth walking leg and above the first abdominal segment of the crayfish, and slowly aspirate the hemolymph. After mixing the hemolymph and CPBS in a 1:1 ratio by inverting, centrifuge at 1000 × g for 5 min at 4 °C, and remove the supernatant to obtain the third precipitate (hemocyte precipitate). Add 1 mL of TransZol Up and 0.2 mL of RNA Extraction Agent to the third precipitate, and repeatedly pipette until there is no obvious precipitate to obtain a hemocyte suspension. Vortex the hemocyte suspension at room temperature for 5 min, and centrifuge at 10000 × g at 4 °C for 15 min. At this time, the sample is divided into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). Among them, RNA is in the colorless aqueous phase. Transfer the colorless aqueous phase to a new centrifuge tube, add an equal volume of absolute ethanol, and gently invert and mix. At this time, white flocculent precipitates (i.e., the fourth precipitate) will appear. Add the obtained solution and the white flocculent precipitate to the centrifugal column, centrifuge at 12000 × g at 4 °C for 30 s, and discard the first effluent; add 500 μL of CB9, centrifuge at 12,000 × g at 4 °C for 30 s, and discard the second effluent (this step is repeated once, and the third effluent is discarded); add 500 μL of WB9, centrifuge at 12000 × g at 4 °C for 30 s, and discard the fourth effluent (this step is repeated once, and the fifth effluent is discarded); centrifuge at 12000 × g at 4 °C for 2 min to completely remove the residual ethanol, i.e., the sixth effluent. Place the centrifugal column corresponding to the discarded sixth effluent into an RNase-free Tube (RNase-free tube, provided in the kit), add 50 - 200 μL of RNase-free Water in the center of the centrifugal column, and let it stand on ice for 1 min; centrifuge at 12000 × g at 4 °C for 1 min to elute the RNA, which is the RNA of red swamp crayfish hemocytes, and store it at -80 °C.

[0118] Take a small amount of the extracted red swamp crayfish hemocyte RNA sample, and use a nucleic acid quantifier to detect the concentration and purity of the RNA to ensure that the RNA OD 260 / 280 = 1.8 - 2.0, and detect the integrity of the RNA by agarose gel electrophoresis. As Figure 1 shown, the RNA band shows that the 28 s band is around 1800 bp and the 18 s band is around 900 bp.

[0119] cDNA Preparation: Using the PrimeScript™ RT reagent Kit (TaKaRa) (all reagents mentioned below are included in this kit), reverse transcribe the RNA of red claw crayfish hemocytes into cDNA. The reverse transcription system is as follows: sequentially add 2 μL of 5× PrimeScript Buffer, 0.5 μL of PrimeScript RT Enzyme Mix I, 0.5 μL of Oligo dT Primer, 0.5 μL of Random 6 mers, and 1 μL of red claw crayfish hemocyte RNA (500 ng / μL) into a PCR tube, and finally supplement with RNase Free dH 2 O to 10 μL. The reverse transcription program is: 42°C for 15 min, 85°C for 5 s, store at 4°C to obtain the cDNA of red claw crayfish hemocytes, and store it in a -80°C refrigerator.

[0120] (2) Cloning of the hematopoiesis factor astakine gene of red claw crayfish

[0121] According to the sequence alignment of known shrimp and crab astakine proteins in the NCBI database ( Figure 2), primers were designed using a conserved region as a template: Ast-1: 5’-GCACGGACACATTCC-3’ (SEQ ID NO.1) and Ast-2: 5’-GGAATGTGTCCGTGC-3’ (SEQ ID NO.2); Based on the data of the red swamp crayfish genome (GenBank: JAPQEV000000000.1) uploaded by Tan et al. (2020) to the NCBI database, the online website Augustus: job submission (uni-greifswald.de) was used to predict the CDS of the astakine gene. Finally, the CDS sequence of the astakine gene (YC-astakine: SEQ ID NO.3) was predicted, and two primers were designed based on the YC-astakine gene sequence: Ast-3: 5’-ATGCAACCCAACGTACGAACCACAG-3’ (SEQ ID NO.4) and Ast-4: 5’-TCAGAAGAATCCGTAGGAATTGTCC-3’ (SEQ ID NO.5); The extracted cDNA of red swamp crayfish blood cells was used as a template, and Ast-1 and the RACE universal primer UPM (SEQ ID NO.6: 5’-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3’) were used as amplification primers for the first PCR reaction. The PCR reaction system was 20 μL, including 1 μL of each primer Ast-1 and UPM, 1 μL of template cDNA, 10 μL of Taq enzyme, and ddH 2 O 7 μL. The PCR reaction program was denaturation at 95°C for 30 s, annealing at 48 - 65°C for 30 s, extension at 72°C for 1 min. Among them, denaturation, annealing, and extension were 30 cycles, followed by 72°C for 10 min and storage at 4°C; The first half of the astakine gene sequence was obtained as the first amplification product, and the first amplification product was verified by agarose gel electrophoresis. As Figure 3 shown, the first half of the predicted astakine gene sequence was obtained, and the band size was about 600 bp. According to the first amplification product sequence, a 5’-end primer for the astakine gene, Ast-5: 5’-ATGATGGTAATAGTTCGAAGTGTGT-3’ (SEQ ID NO.7), was designed; Using Ast-4 and Ast-5 as primers and cDNA as a template for the second PCR reaction, the second PCR reaction system and reaction program were the same as above. The second amplification product was obtained, and the second amplification product was verified by agarose gel electrophoresis. As Figure 4As shown, the complete CDS sequence of the predicted astakine gene of Cherax quadricarinatus was obtained, which is the predicted astakine gene of Cherax quadricarinatus, and the band size is about 450 bp.

[0122] (3)Verification of transformation of the hematopoiesis factor astakine gene of Cherax quadricarinatus

[0123] The PCR product obtained after gel recovery was ligated to the pMD18-T vector and transformed into DH5α competent cells. The specific experimental operations are as follows:

[0124] ① Gel recovery and purification: The second amplification product was subjected to gel recovery and purification using the EZ-10 Column DNA Gel Extraction Kit (all reagents mentioned below are included in the kit). The agarose gel at 450 bp of the astakine gene of Cherax quadricarinatus in the second amplification product was cut with a clean scalpel and placed in a 1.5 mL centrifuge tube for weighing; according to the weight of the gel block, Binding Buffer II (binding buffer II) was added at a ratio of 100 μL per 100 mg of agarose; the centrifuge tube was placed in a water bath at 55 - 65 °C for 5 - 10 min, and mixed occasionally until the gel block was completely melted; the melted gel solution was transferred to an EZ-10 Column (EZ-10 filter column), allowed to stand for 2 min, centrifuged at 8000 rpm for 1 min, and the liquid in the collection tube was discarded; 500 μL of Wash Solution (washing solution) was added, the lid was covered and inverted and mixed 3 - 5 times, centrifuged at 10000 rpm for 1 min, and the liquid in the collection tube was discarded (repeated once); the EZ-10 Column was placed back in the collection tube and centrifuged at 10000 rpm for 30 s to remove the residual Wash Solution on the tube wall; the EZ-10 Column was placed in a clean 1.5 mL centrifuge tube, 20 - 40 μL of Elution Buffer (elution buffer) was added to the center of the adsorption membrane, incubated at 50 °C for 2 min, and centrifuged at 10000 rpm for 1 min to elute the DNA, which is the gel-recovered DNA.

[0125] ② Ligation of pMD18-T vector: 1 μL of pMD18-T vector and 4 μL of gel-recovered DNA were added to a microcentrifuge tube, 5 μL of Solution I was added, and the reaction was carried out at 16 °C for 1 h to obtain the DNA to be transformed.

[0126] ③ Transformation of DH5α competent cells: Take out DH5α competent cells from -70 °C and quickly place them on ice to thaw; add the DNA to be transformed into 100 μL of DH5α competent cells, gently flick the tube wall to mix evenly, and let it stand on ice for 30 min; after heat shock in a 42 °C water bath for 45 s, quickly place it on ice and let it stand for 2 min; add 900 μL of LB liquid medium (without antibiotics) to the centrifuge tube, mix well and place it in a shaker at 37 °C and 200 rpm for 45 min to recover, obtaining the first recovered bacterial liquid; take 50 μL of the first recovered bacterial liquid and evenly spread it on an LB solid medium plate containing amp r resistance and place it upright in a 37 °C incubator for 10 min. After the first recovered bacterial liquid is completely absorbed, invert the plate and culture it overnight to obtain the first plate.

[0127] ④ Pick monoclonal colonies on the first plate, shake the bacteria, and then use the universal primers RV-M (SEQ ID NO.8: 5’-GAGCGGATAACAATTTCACACAGG-3’) and M13-47 (SEQ ID NO.9: 5’-CGCCAGGGTTTTCCCAGTCACGAC-3’) of the pMD18-T vector for bacterial liquid PCR (i.e., the third PCR reaction). The reaction system and reaction program of the third PCR reaction are the same as above to obtain the third amplification product, and verify the third amplification product by agarose gel electrophoresis. As Figure 5 shown, obtain the bacterial liquid of the astakine gene of red swamp crayfish ligated to the pMD18-T vector, and the band size is about 490 bp. Send the successfully transformed bacterial liquid to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the sequencing result is as Figure 6 shown, indicating that the astakine gene with a promoting proliferation effect on HPT cells has been successfully cloned from the blood cells of red swamp crayfish. Among them, the complete CDS sequence (nucleotide sequence SEQ ID NO.10: 447 bp; amino acid sequence (Ast-pro) SEQ ID NO.11: 148 aa) of the astakine gene (Ast) of red swamp crayfish.

[0128] (4) Bioinformatics feature analysis

[0129] Use the DNAMAN software to compare and analyze the protein sequences of the cloned astakine of red swamp crayfish that have been sequenced and the protein sequences of other known shrimp astakines. Use the online prediction website SMART (http: / / smart.embl - heidelberg.de / ) to predict the related properties of the astakine protein of red swamp crayfish: functional domains, signal peptides, etc. As Figure 7 、 Figure 8As shown in the figure, the SMART online prediction website predicts that there is an endogenous signal peptide consisting of 20 amino acids at the N-terminus of the astakine protein, and predicts that the protein has a prokineticin domain, which plays a role in promoting angiogenesis and generation in vertebrates. Through sequence alignment and analysis with the astakine proteins of the signal crayfish (Pacifastacus leniusculus, PlAst and PlAst 2a), whiteleg shrimp (Litopenaeus vannamei, LvAst), kuruma shrimp (Marsupenaeus japonicus, MjAst) and tiger shrimp (Penaeus monodon, PmAst), it is found that they all contain 10 highly conserved cysteine sites and two amino acid conserved regions (GMCPC and TCQLP).

[0130] And the phylogenetic tree was constructed using MEGA 11 software, as Figure 9 shown. The signal crayfish and Chinese mitten crab (Eriocheir sinensis) and giant river prawn (Macrobrachium rosenbergii) are under different evolutionary roots, indicating that the signal crayfish has a relatively distant genetic relationship with the two; the signal crayfish and Chinese shrimp (Penaeus chinensis), tiger shrimp (P. monodon), whiteleg shrimp (L. vannamei), signal crayfish (P. leniusculus) and kuruma shrimp (M. japonicus) are under a common evolutionary root, indicating that the signal crayfish has a relatively close genetic relationship with them. In summary, the astakine gene has a certain degree of conservation in species evolution, but from the perspective of their distribution in different evolutionary branches, the astakine gene of the signal crayfish has a certain species specificity.

[0131] S3. Construction of the gene expression vector of the signal crayfish

[0132] (1)Cloning of the promoter

[0133] P2 promoter: The P2 promoter exists in the infectious hypodermal and hematopoietic necrosis virus (IHHNV) of shrimp. The cloning template is derived from the IHHNV genome stored in our laboratory. According to the IHHNV genome data (GenBank: AF273215.1) stored in the NCBI database, PCR amplification primers P2-F (SEQ ID NO.13: 5’-CCCAAGCTTCTGCGAGCGCTTCGCAGAAA-3’) and P2-R (SEQ ID NO.14: 5’-CGCGGATCCGGAATAGCCTCTTCACTCGT-3’) for the P2 promoter (nucleotide sequence: SEQ ID NO.12) were designed. The fourth PCR reaction system and reaction program were the same as above, and the amplification product of the P2 promoter, that is, the fourth amplification product, was obtained. And the fourth amplification product was verified by agarose gel electrophoresis. As Figure 10 shown, the nucleotide sequence band of the P2 promoter was obtained, with a size of about 110 bp.

[0134] WSV249 promoter: WSV249 (-504 / -1) and WSV249 (-300 / -1) promoters exist in the white spot syndrome virus (WSSV) of shrimp. The cloning template is derived from the WSSV virus genome. According to the WSSV genome data (GenBank: AF332093.3) stored in the NCBI database and experimental needs, PCR amplification primers for the WSV249 (-504 / -1) promoter (nucleotide sequence: SEQ IDNO.15) and the WSV249 (-300 / -1) promoter (nucleotide sequence: SEQ ID NO.16) were designed: WSV249 (-504 / -1) -F (SEQ ID NO.17: 5’-AGTCCAGTGTGGTGGAATTCTCTCAAAAACTTTTAAAAAATTTTT-3’), WSV249 (-300 / -1) -F (SEQ ID NO.18: 5’-AGTCCAGTGTGGTGGAATTCAGGCGAGTCATGTTTCTTGC-3’), and the common downstream primer WSV249-R (SEQ ID NO.19: 5’-CTTCGAACTATTACCATCATGGCTGCGAGAATGGTTTG-3’). The PCR reaction system and reaction program were the same as above, and the amplification product of the WSV249 (-504 / -1) promoter, that is, the fifth amplification product, and the amplification product of the WSV249 (-300 / -1) promoter, which was the sixth amplification product, were obtained. And the fifth and sixth amplification products were verified by agarose gel electrophoresis. As Figure 11As shown, WSV249 (-504 / -1) The amplified product band of the promoter is around 500 bp, WSV249 (-300 / -1) The amplified product band of the promoter is around 330 bp.

[0135] (2) Construction of the pIZ-OpIE2-P2-Ast-P2A-mCherry expression vector

[0136] pIZ-OpIE2-P2-Ast-P2A-mCherry expression vector: Using the purchased commercial plasmid pIZ-V5-His as the basic plasmid ( Figure 12 as shown), among which, the pIZ-V5-His basic vector contains the OpIE2 promoter (SEQ ID NO.20); and double digestion and ligation of the P2 promoter and P2A-mCherry (this fragment is from the laboratory plasmid template) are carried out in sequence. Among them, the hybrid promoter group OpIE2-P2-WSV249 can be formed by sequentially connecting the OpIE2 promoter, the P2 promoter and the WSV249 (-300 / -1) promoter (-300 / -1): SEQ ID NO.21. Here, the double digestion primers for the P2 promoter are SEQ ID NO.13 and SEQ ID NO.14; the double digestion primers for P2A-mCherry are P2A-mCherry-F (SEQ ID NO.22: 5’-CTAGTCTAGAGGAAGCGGAGCTACTAACTT-3’) and P2A-mCherry-R (SEQ ID NO.23: 5’-TCCCCGCGGTTACTTGTACAGCTCGTCCA-3’); the double digestion primers for the Ast (astakine) fragment are Ast-6-F (SEQ ID NO.24: 5’-CGCGGATCCATGATGGTAAT-3’) and Ast-6-R (SEQ ID NO.25: 5’-CCGGAATTCGAAGAATCCGTAGGAA-3’). The restriction endonucleases used for ligating the P2 promoter are Hind Ⅲ and BamHI; the restriction endonucleases used for ligating P2A-mCherry are Xba I and Sac Ⅱ, and at this time, the intermediate plasmid pIZ-OpIE2-P2-P2A-mCherry is generated. When using the intermediate plasmid to ligate the Ast gene, at this time, the restriction endonucleases used for ligating the Ast gene are BamH I and EcoR I. The enzyme used for ligating all fragments is T4 ligase. Finally, the ligation product of the obtained pIZ-OpIE2-P2-Ast-P2A-mCherry plasmid is transformed into DH5α competent cells, plated to pick monoclonal colonies for shaking culture, and the bacterial liquid PCR reaction is carried out in the same manner as above to obtain the seventh amplification product. And the seventh amplification product is verified by agarose gel electrophoresis. As Figure 13 shown, the inserted sequence P2-Ast-P2A-mCherry band is around 1300 bp. The successfully transformed bacterial liquid is sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing is correct, and the pIZ-OpIE2-P2-Ast-P2A-mCherry expression vector is as Figure 14 shown.

[0137] Example 2

[0138] Using the pIZ-OpIE2-P2-P2A-mCherry intermediate plasmid constructed with the expression vector in Example 1 as a template, construct the pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry expression vector.

[0139] Connect the WSV249 (-504 / -1) promoter and the Ast gene to the pIZ-OpIE2-P2-P2A-mCherry intermediate plasmid by homologous recombination. WSV249(-504 / -1) - The restriction endonucleases used for Ast homologous recombination are EcoR I and XbaI. Among them, the primers for homologous recombination are Ast-7-R (SEQ ID NO.26: 5’-GTAGCTCCGCTTCCTCTAGAGAAGAATCCGTAGGAATTGTCCCCG-3’), SEQ ID NO.17 and SEQ ID NO.19. Finally, the obtained pIZ-OpIE2-P2-WSV249 (-504 / -1) - The homologous recombination product of the Ast-P2A-mCherry plasmid was transformed into DH5α competent cells, plated, single colonies were picked for shaking culture, and a bacterial liquid PCR reaction was carried out. The method was the same as above, and the eighth amplification product was obtained. And the eighth amplification product was verified by agarose gel electrophoresis, as Figure 15 shown, the inserted sequence WSV249 (-504 / -1) - The Ast band is around 900 bp. The successfully transformed bacterial liquid was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing was correct, and the pIZ-OpIE2-P2-WSV249 (-504 / -1) - The Ast-P2A-mCherry expression vector is as Figure 16 shown.

[0140] Example 3

[0141] Using the pIZ-OpIE2-P2-P2A-mCherry intermediate plasmid constructed with the expression vector in Example 1 as a template, pIZ-OpIE2-P2-WSV249 (-300 / -1) - The Ast-P2A-mCherry expression vector was constructed:

[0142] The WSV249 (-300 / -1) promoter and the Ast gene were ligated to the pIZ-OpIE2-P2-P2A-mCherry intermediate plasmid by homologous recombination. The WSV249 (-300 / -1) - The restriction endonucleases used for Ast homologous recombination are EcoR I and XbaI, and the primers for homologous recombination are SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.26. Finally, the pIZ-OpIE2-P2-WSV249 (-300 / -1) - The Ast-P2A-mCherry plasmid was obtained. Among them, an expression cassette (SEQ ID NO.27) was formed by connecting the hybrid promoter group and the Ast gene. The pIZ-OpIE2-P2-WSV249 (-300 / -1)The homologous recombination product of the -Ast-P2A-mCherry plasmid was transformed into DH5α competent cells, plated, single colonies were picked and cultured in shaking flasks, and a bacterial liquid PCR reaction was performed. The method was the same as above, and the ninth amplification product was obtained. The ninth amplification product was verified by agarose gel electrophoresis. As Figure 17 shown, the inserted sequence WSV249 (-300 / -1) -Ast band is around 750 bp. The successfully transformed bacterial liquid was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing was correct, and the pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry expression vector is as Figure 18 shown.

[0143] Example 4

[0144] The correctly verified pIZ-OpIE2-P2-Ast-P2A-mCherry plasmids, pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry plasmids and pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry plasmid bacterial liquids in Examples 1, 2, and 3 above were respectively mixed with 60% glycerol at a ratio of 2:1 and placed in a -80°C refrigerator for bacterial liquid preservation.

[0145] The plasmid large-scale extraction kits from Nanjing Novoprotein Scientific Inc. were used to extract 3 kinds of plasmids respectively (all reagents appearing in the following plasmid extraction are included in the plasmid large-scale extraction kit). The specific experimental steps are as follows:

[0146] ① The bacterial liquids containing pIZ-OpIE2-P2-Ast-P2A-mCherry plasmids, pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry plasmids and pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry plasmids were respectively inoculated into 200 mL of LB liquid medium (containing 50 μg / mL of bleomycin -1 ), cultured overnight at 37°C and 200 rpm / min, centrifuged at 8000 ×g for 4 min, and the supernatant was discarded;

[0147] ② Add 5 mL of column activation solution AB to the center of the membrane of the Maxi-Plasmid Spin Column with Collection Tube (large-scale plasmid extraction centrifuge tube equipped with a collection tube), centrifuge at 8000 ×g for 1 min, discard the effluent and let it stand for later use;

[0148] ③ Add 10 mL of colorless solution RB, shake the suspended bacteria thoroughly to mix the bacterial cells completely; add 10 mL of blue solution LB, gently invert and mix 5 - 8 times to lyse the bacteria completely, forming a blue and transparent solution, which is the lysis product.

[0149] ④ Add 10 mL of solution NB1 to the lysis product, gently mix 6 - 8 times (the color of the supernatant changes from blue to colorless, indicating complete neutralization) until a firm agglomerate is formed, and let it stand at room temperature for 5 min; centrifuge at 10000 ×g for 15 min, carefully avoid the precipitate, and pour the supernatant into a Push Filter and filter it into a new 50 mL centrifuge tube.

[0150] ⑤ Add 0.3 times the volume of isopropanol to the filtrate, invert and mix well, transfer the liquid to the centrifuge column in multiple portions, centrifuge at 8000×g for 1 min, discard the effluent until all the liquid passes through the centrifuge column.

[0151] ⑥ Add 5 mL of solution WB, centrifuge at 8000 ×g for 1 min, discard the effluent (repeat once); centrifuge at 8000 ×g for 3 min to completely remove the residual WB, place the centrifuge column in a new 50 mL Collection Tube, open the lid of the centrifuge column and let it stand at room temperature for 5 min to allow the ethanol to evaporate completely.

[0152] ⑦ Drop 1 mL of deionized water in the center of the centrifuge column, let it stand at room temperature for 5 min; centrifuge at 8000 ×g for 2 min to elute the DNA and store it at -20℃, which is the DNA of the above three plasmids (pIZ-OpIE2-P2-Ast-P2A-mCherry plasmid, pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry plasmid and pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry plasmid).

[0153] Detect the above three plasmids by 1.5% agarose gel electrophoresis, and the results are as Figure 19 shown. A is the agarose gel electrophoresis verification after large-scale extraction of pIZ-OpIE2-P2-Ast-P2A-mCherry expression plasmid (plasmid a), and the band around 1900 bp is the indication of the target plasmid; B is pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry (plasmid b) and pIZ-OpIE2-P2-WSV249 (-300 / -1)Verification of the large-scale extraction of the -Ast-P2A-mCherry expression plasmid (plasmid c) by agarose gel electrophoresis showed that the target plasmid indicator band appeared at around 2100 bp.

[0154] Test Example 1

[0155] Using the TransIT®-Insect Transfection Reagent, the expression efficiencies of pIZ-OpIE2-P2-Ast-P2A-mCherry, pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry and pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry, these three plasmids were verified in Sf9 cells. The specific experimental steps are as follows:

[0156] Plating Sf9 cells: 10 - 24 h before transfection of the above three plasmids, discard the medium in the Sf9 cell culture flask, add 1 mL of 0.25% trypsin digestion solution at room temperature to digest Sf9 cells for 30 s to 1 min. When observing under the microscope that the Sf9 cells shrink and have a detachment phenomenon, discard the 0.25% trypsin digestion solution, add fresh medium and resuspend the Sf9 cells, and inoculate them in a 48-well cell culture plate at a density of 2×10 5 cells / mL, and place the above 48-well cell culture plate in an incubator at 28°C for 10 - 24 h.

[0157] Preparation of transfection complexes: First, vortex the TransIT®-Insect Transfection Reagent and let it reach room temperature. Take 26 μL of Grace serum-free insect cell medium respectively, and add 260 ng of the above three plasmids respectively. After gently mixing, three DNA dilution solutions are formed; add 0.52 μL of TransIT®-Insect Transfection Reagent to each of the three DNA dilution solutions, mix gently, and incubate at room temperature for 15 - 30 min.

[0158] Distribute the transfection complexes into Sf9 cells in Sf9 insect cell medium: Drop the transfection complexes into different areas of the cell culture wells to make them evenly distributed.

[0159] Place the Sf9 cells after electroporation transfection in an incubator at 28°C for continued culture, and perform fluorescence observation and photography of mCherry at 24 h, 48 h, and 72 h after electroporation transfection. The results of fluorescence observation and statistics are as Figure 20 and Figure 21As shown, pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry expression vector had the highest expression efficiency, and the expression efficiencies at 24, 48, and 72 h after plasmid transfection were 34.87 ± 4.27%, 72.16 ± 2.07%, and 77.84 ± 3.21% respectively; followed by pIZ-OpIE2-P2-WSV249 (-504 / -1) -Ast-P2A-mCherry expression vector, and the expression efficiencies at 24, 48, and 72 h after plasmid transfection were 27.22 ± 2.08%, 58.69 ± 4.21%, and 61.35% ± 3.63% respectively; the expression vector with the lowest expression efficiency was pIZ-OpIE2-P2-Ast-P2A-mCherry expression vector, and the expression efficiencies at 24, 48, and 72 h after plasmid transfection were 25.74± 4.18%, 53.27 ± 2.91%, and 54.61 ± 4.22% respectively. In summary, based on the pIZ expression plasmid as the basic plasmid, the hybrid promoter OpIE2-P2-WSV249 (-300 / -1) -driven high-expression vector was: pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry, and the map and construction annotations were as Figure 22 shown, blue was the P2 promoter, green was the WSV249 (-300 / -1) promoter, orange was the astakine gene, pink was the P2A short peptide, and red was the mCherry fluorescent labeling gene which were connected in this way.

[0160] Test Example 2

[0161] The conditions of electroporation transfection in Test Example 1 were further optimized, and a gradient setting experiment was carried out on the voltage conditions.

[0162] The set constant conditions were an electric pulse duration of 300 μs, the number of pulses of 2 times, a pulse interval of 10 s, and the serum-free and antibiotic-free OCCM medium was used as the electroporation buffer. Using the crayfish HPT cells without electroporation transfection experiment as the control, 9 voltage gradient experimental groups were set, and the voltages of these 9 experimental groups were: 50, 100, 200, 300, 400, 500, 600, 800, and 1000 V. By detecting the cell viability of Calcein-AM in the crayfish HPT cells cultured for 1 d after electroporation transfection, the survival rates of each group of crayfish HPT cells were compared.

[0163] The results were as Figure 23 , 24As shown, the cell viabilities at voltages of 0, 50, 100, 200, 300, 400, 500, 600, 800, and 1000 V were 99.18 ± 1.12%, 85 ± 7.23%, 86 ± 4.41%, 87.36 ± 4.45%, 56.28 ± 1.14%, 43.49 ± 3.29%, 40.47 ± 6.05%, 9.85 ± 5.48%, 8.55 ± 3.16%, and 4.57 ± 1.41%, respectively. It can be seen that when the voltage ≤ 200 V, the cell viability of crayfish HPT cells was about 87.36 ± 4.45%; when the voltage > 200 V, the cell viability decreased significantly to below 56.28 ± 1.14%. Therefore, 200 V is the optimal voltage condition for plasmid electroporation of crayfish.

[0164] Test Example 3

[0165] The conditions of electroporation transfection in Test Example 1 were further optimized, and gradient setting experiments were carried out on the electric pulse conditions.

[0166] The set constant conditions were a voltage of 200 V (the optimal voltage obtained in Test Example 2), 2 pulse numbers, a pulse interval of 10 s, and serum-free and antibiotic-free medium as the electroporation buffer. Using crayfish HPT cells without electroporation transfection experiment as the control, 8 experimental groups with gradient electric pulse durations were set up. The electric pulse durations of these 8 experimental groups were: 1, 5, 10, 15, 20, 25, 30, and 40 ms. By detecting the cell viability of Calcein-AM in crayfish HPT cells cultured for 1 d after electroporation transfection, the cell viabilities of each group of crayfish HPT cells were compared.

[0167] The results are as Figure 25 、 26 shown. The cell viabilities at electric pulse durations of 0, 1, 5, 10, 15, 20, 25, 30, and 40 ms were 99.4 ± 0.61%, 98.27 ± 2.06%, 98.8 ± 0.87%, 95.14 ± 1.82%, 79.65 ± 3.54%, 54.4 ± 5.04%, 53.01 ± 2.75%, 52.3 ± 5.38%, and 36.1 ± 3.42%, respectively. Taking 50% cell viability as the judgment standard, it can be seen that when the electric pulse duration ≤ 30 ms, the cell viability was about 52.3 ± 5.38%; when > 30 ms, the cell viability of crayfish HPT cells decreased significantly to below 36.1 ± 3.42%. Therefore, 30 ms was selected as the optimal electric pulse duration for electroporation transfection.

[0168] Test Example 4

[0169] The conditions for electroporation transfection in Test Example 1 were further optimized, and experiments were carried out using different electroporation buffers (CytoMix, HEPES).

[0170] Constant conditions were set to optimize the electroporation buffer in the electroporation transfection experiment. Among them, the constant conditions set were a voltage of 200 V, 2 pulse numbers, a pulse interval of 10 s. Under the conditions of an electric pulse duration of 10, 20, 30, and 40 ms, using crayfish HPT cells without electroporation transfection experiment as a control, the effects of the two electroporation buffers, CytoMix and HEPES, were compared. By detecting the cell viability of Calcein-AM in crayfish HPT cells cultured for 1 d after electroporation transfection, the survival rates of each group of crayfish HPT cells were compared.

[0171] The results are as Figure 27 、 28 shown. The cell survival rates when using CytoMix buffer at electric pulse durations of 0, 10, 20, 30, and 40 ms were 99.23 ± 0.89%, 87.31 ± 5.22%, 75.48 ± 1.34%, 60.1 ± 6.57%, and 25.78 ± 3.28% respectively; the cell survival rates when using HEPES buffer at electric pulse durations of 0, 10, 20, 30, and 40 ms were 98.97 ± 0.73%, 90.45 ± 7.91%, 79.25 ± 4.57%, 65.13 ± 2.13%, and 51.1 ± 3.85% respectively. Taking 50% cell survival rate as the judgment standard, it can be seen that when using CytoMix electroporation buffer, at an electric pulse duration of 30 ms, the cell survival rate was about 60.1 ± 6.57%; when using HEPES electroporation buffer, at an electric pulse duration of 40 ms, the cell survival rate was about 51.1 ± 3.85%. However, in the subsequent electroporation transfection experiment of the high-efficiency expression vector of crayfish genes, it was found that using HEPES electroporation buffer could not transfer the plasmid into crayfish HPT cells (no fluorescence). Therefore, CytoMix was selected as the best electroporation buffer for electroporation transfection.

[0172] Test Example 5

[0173] Crayfish HPT cells were chemically transfected using TransIT®-Insect Transfection Reagent (TransIT®-Insect transfection reagent), and the ratios of 4 transfection reagents / DNA were 1:1, 2:1, 3:1, and 4:1. The specific operation was as follows: Crayfish HPT cells were evenly inoculated into a 48-well cell culture plate and placed at 28°C, 3% CO 2Under this environment, culture for 24 h until the plating density of crayfish HPT cells reaches approximately 90% state. Prepare transfection complexes using the transfection method in Test Example 1 and add them to the corresponding cell wells. After 6 h, replace the fresh medium to reduce reagent toxicity, and take fluorescence images at 24 h, 48 h, and 72 h after transfection using an inverted fluorescence microscope, and count the transfection efficiency of transfection reagents at different ratios.

[0174] The results are as Figure 29 , 30 shown. At 24 h after chemical transfection, the transfection rates of transfection reagent / DNA ratios of 1:1, 2:1, 3:1, and 4:1 are 3.27 ± 0.41%, 8.45 ± 0.45%, 1.69 ± 0.64%, and 1.54 ± 0.43% respectively; at 48 h after chemical transfection, the corresponding changes in transfection rates are 7.72 ± 0.35%, 10.28 ± 0.42%, 1.74 ± 0.61%, and 1.63 ± 0.40%; and at 72 h after chemical transfection, the transfection rates are 6.3 ± 0.77%, 13.18 ± 0.31%, 1.94 ± 0.31%, and 1.8 ± 0.42% respectively. Therefore, when the transfection reagent / DNA ratio is 2:1, the transfection efficiency reaches the highest, and increasing the ratio on this basis will be accompanied by an increase in cell toxicity.

[0175] Test Example 6

[0176] According to the results of Test Examples 2, 3, and 4, the optimal electrotransfection conditions for crayfish HPT cells can be determined as: voltage 200 V, electric pulse time 30 ms, number of electric pulses 2 times, electric pulse interval 10 s, and electrotransfection buffer is CytoMix.

[0177] Use the chemical transfection method and the above optimal electrotransfection conditions to transfect the pIZ-OpIE2-P2-WSV249 (-300 / -1) -Ast-P2A-mCherry plasmid obtained in Example 3 into crayfish HPT cells cultured in vitro in 2D, and the transfection method is the same as described in Test Example 1.

[0178] The results are as Figure 31 , 32 shown. For the electrotransfection method: the plasmid expression efficiencies at 24, 48, and 72 h after plasmid transfection are 2.67 ± 0.52%, 5.21 ± 0.37%, and 2.13 ± 0.24% respectively; for the chemical transfection method: the plasmid expression efficiencies at 24, 48, and 72 h after plasmid transfection are 8.45 ± 0.45%, 10.28 ± 0.33%, and 13.18 ± 0.51% respectively.

[0179] The mCherry gene was further detected by semi - quantitative RT - PCR. The experiment was carried out using PrimeScript™ RT reagent Kit and Premix Taq™. The primers designed for mCherry were mCherry - F: 5’ - ATGGTGAGCAAGGGCGAG - 3’ (SEQ ID NO.28) and mCherry - R: 5’ - TTACTTGTACAGCTCGTCCA - 3’ (SEQ ID NO.29); the primers for the internal reference gene β - actin used were Cq - β - actin - F: 5’ - ATGTGTGACGAAGAGGAGCTG - 3’ (SEQ ID NO.30) and Cq - β - actin - R: 5’ - TTAGAAGCACTTGCGGTGGAC - 3’ (SEQ ID NO.31). The number of cycles for semi - quantitative PCR amplification of mCherry was 26, and the other PCR reaction systems and PCR reaction procedures were the same as those described in Example 1.

[0180] The results were as Figure 31 、 33 、shown in Figure 34. For the electroporation method: the expression of the mCherry gene could be detected at 24 h, the expression level gradually increased at 48 h, and no longer increased after 72 h. Moreover, with the increase in the cell culture time after electroporation, the cell state became worse and the cells died after about one week; for the chemical transfection method: the expression of the mCherry gene could be detected at 24 h, the expression levels at 48 h and 72 h gradually increased, and the growth of the transfected cells was not affected and they could be continuously cultured for more than 3 months.

[0181] Test Example 7

[0182] The pIZ - OpIE2 - P2 - WSV249 (-300 / -1) - Ast - P2A - mCherry plasmid obtained in Example 3 was transfected into the 3D - cultured crayfish HPT cell spheres in vitro by electroporation and chemical transfection methods. The results were as Figure 35 、 36 shown. For the electroporation method: the plasmid expression efficiencies at 24 h, 48 h and 72 h after plasmid transfection were 1 ± 0.16%, 1.04 ± 0.08% and 1.68 ± 0.13% respectively; for the chemical transfection method: the plasmid expression efficiencies at 24 h, 48 h and 72 h after plasmid transfection were 1.19 ± 0.11%, 2.12 ± 0.16% and 2.56 ± 0.19% respectively.

[0183] The mCherry gene was further detected by semi - quantitative RT - PCR. The steps of semi - quantitative RT - PCR detection were the same as those in Test Example 6. The results were as Figure 35 、37 As shown in Figure 38, for the electroporation method, the expression of the mCherry gene could be detected at 24 h, and the expression levels gradually increased at 48 and 72 h. Moreover, as the cell culture time increased after electroporation, the cells could not aggregate and grow well, and the cell debris increased after about one week. For the chemical transfection method, the expression of the mCherry gene could be detected at 24 h, and the expression levels gradually increased at 48 and 72 h.

[0184] Test Example 8

[0185] Detection of astakine gene overexpression and the proliferation of Cherax quadricarinatus HPT cells

[0186] The semi - quantitative RT - PCR technique was used, with the expression of the proliferating cell nuclear antigen (PCNA) gene as a marker factor for the proliferation of C. quadricarinatus HPT cells. Combining with the EdU proliferation detection experiment, the effect of astakine gene overexpression on the proliferation of C. quadricarinatus HPT cells was evaluated.

[0187] The detailed steps are as follows: HPT cells cultured in vitro for 4 d (the cell proliferation state is the best at this stage) were selected for plasmid chemical transfection. The specific primers for astakine were designed as CqAst - 7 - F: 5’ - ATGATGGTAATAGTTCGAAGTGTGT - 3’ (SEQ ID NO.32) and CqAst - 7 - R: 5’ - TCAGAAGAATCCGTAGGAATTGTCC - 3’ (SEQ ID NO.33); the specific primers for PCNA were designed as CqPCNA - F: 5’ - ATGTTTGAGGCTCGTCTT - 3’ (SEQ ID NO.34) and CqPCNA - R: 5’ - AGGTGATAGTGGAGTGGC - 3’ (SEQ ID NO.35). At 72 h after chemical transfection of C. quadricarinatus HPT cells, the expression levels of astakine and PCNA genes were detected and the cell proliferation rate was counted.

[0188] The results are as Figure 39 、 40As shown, the transfection efficiency of the astakine gene in crayfish HPT cells reached 18.01 ± 1.83%. Compared with the control group (NT represents the untransfected negative control group, that is, cells without transfection), the astakine transgenic HPT cells showed more vigorous mitotic activity 72 h after transfection. Most of the cells in the dividing state were not only the astakine-high-expressing cells themselves, but also the nearby cells, and this local proliferation effect was particularly significant. Quantitative detection found that the cell proliferation rates of the untransfected (NT) and mock-transfected (MT) control groups were 19.47 ± 2.07% and 18.76 ± 0.74% respectively; in contrast, the cell proliferation rate of the experimental group (PT) after transfection reached 25.69 ± 1.19%, showing a significant increase in cell proliferation activity, and the proliferation rate increased by about 7% ( Figure 40 ). Further verification was carried out by semi-quantitative PCR ( Figure 41 , 42 ), and it was found that on the 3rd day after transfection in the experimental group, the expression levels of astakine and proliferating cell nuclear antigen (PCNA) genes were significantly higher than those in the control group.

[0189] It can be concluded that through the modification of the shrimp virus promoter and the optimization of the transfection method, the present invention successfully developed a hybrid promoter group (OpIE2-P2-WSV249 (-300 / -1) ) and a transgenic expression vector (pIZ-OpIE2-P2-WSV249 (-300 / -1) applicable to the hematopoietic tissue cells of red claw crayfish for 2D and 3D culture.-Ast-P2A-mCherry). The coding sequence of the astakine of red swamp crayfish was cloned and inserted into a transgenic expression vector. Under the electroporation transfection conditions of voltage 200 V, electric pulse time 30 ms, number of electric pulses 2 times, electric pulse interval 10 s, and electroporation buffer being CytoMix, and under the chemical transfection conditions of transfection reagent / DNA ratio of 2:1, overexpression of the astakine gene was achieved. Among them, under the chemical transfection conditions, the expression efficiency reached about 18%, the proliferation rate of transgenic cells increased by about 7%, and healthy and stable growth was maintained for more than three months. For other freshwater crayfish, such as Parastacidae or Cambaridae, Parastacidae includes Astacopsis gouldi, Euastacus malacops, Euastacus fluviatilis or Euastacus destructor, and Cambaridae includes Procambarus clarkii, Cambaroides dauricus, Cambaroides similis or Astacopsis nana, the 2D or 3D cell culture system is also applicable, and this transgenic vector is also applicable for overexpression of the astakine gene. Therefore, the present invention provides a reliable transgenic vector for the study of shrimp gene functions. The transgenic vector of the hematopoietic tissue cells of the disclosed freshwater crayfish can support the expression and functional study of foreign genes, provide experimental materials for the detection of shrimp viruses for non-diagnostic purposes, and can also ensure the healthy growth of the hematopoietic tissue cells of crayfish after transgenic operation, laying a foundation for the development of shrimp immortalized cell lines.

[0190] The terms and expressions used herein are for descriptive purposes only, and the present invention should not be limited to these terms and expressions. The use of these terms and expressions does not mean excluding any equivalent features of the illustration and description (or parts thereof), and it should be recognized that various modifications that may exist should also be included within the scope of the claims. Other modifications, variations and substitutions may also exist. Accordingly, the claims should be regarded as covering all such equivalents.

[0191] Similarly, it should be noted that although the present invention has been described with reference to the current specific embodiments, those of ordinary skill in the art in this technical field should recognize that the above embodiments are only used to illustrate the present invention, and various equivalent changes or substitutions can be made without departing from the spirit of the present invention. Therefore, as long as the changes and modifications of the above embodiments are within the scope of the spirit of the present invention, they will fall within the scope of the claims of the present invention.

Claims

1. A transgenic vector for hematopoietic cells of freshwater crayfish, characterized in that: The transgenic vector comprises an expression cassette, and the expression cassette comprises a hybrid promoter group; the nucleotide sequence of the hybrid promoter group is shown in SEQ ID NO.

21.

2. The transgenic vector of freshwater crayfish hematopoietic tissue cells according to claim 1, characterized in that: The expression cassette is composed of the hybrid promoter group and Ast Gene connection structure; Ast The nucleotide sequence of the gene is shown in SEQ ID NO.

10.

3. The transgenic vector of freshwater crayfish hematopoietic tissue cells according to claim 2, characterized in that: The transgenic vector is pIZ-OpIE2-P2-WSV249 (-300 / -1) - Ast -P2A- mCherry ; pIZ-OpIE2-P2-WSV249 (-300 / -1) - Ast -P2A- mCherry The nucleotide sequence of the OpIE2 promoter is shown in SEQ ID NO.20, the nucleotide sequence of the P2 promoter is shown in SEQ ID NO.12, and the WSV249 (-300 / -1) The nucleotide sequence of the promoter is shown in SEQ ID NO.

16.

4. A method for constructing a transgenic vector for hematopoietic tissue cells of freshwater crayfish, characterized in that: The following steps are involved: Step A: Obtaining freshwater crayfish hematopoietic factors Ast Gene; Freshwater crayfish hematopoietic factor Ast The nucleotide sequence of the gene is shown in SEQ ID NO.10; the freshwater crayfish is a red claw crayfish; Step B: P2 promoter and WSV249 (-300 / -1) promoter for cloning; using pIZ-V5-His as the basic vector, and sequentially cloning the P2 promoter and P2A- mCherry The intermediate vector pIZ-OpIE2-P2-P2A- mCherry ; Step C: Place the WSV249 (-300 / -1) Promoter and the freshwater crayfish hematopoietic factor Ast The gene was sequentially connected to the intermediate vector pIZ-OpIE2-P2-P2A- mCherry The transgenic vector pIZ-OpIE2-P2-WSV249 was obtained. (-300 / -1) - Ast -P2A- mCherry ; the pIZ-OpIE2-P2-WSV249 (-300 / -1) - Ast -P2A- mCherry The nucleotide sequence of the OpIE2 promoter is shown in SEQ ID NO.20, the nucleotide sequence of the P2 promoter is shown in SEQ ID NO.12, and the WSV249 (-300 / -1) The nucleotide sequence of the promoter is shown in SEQ ID NO.

16.

5. The method for constructing a freshwater crayfish hematopoietic tissue cell transgenic vector according to claim 4, characterized in that: The step A comprises: Step A-1: ​​culturing freshwater crayfish hematopoietic tissue cells using a 2D or 3D culture system to obtain freshwater crayfish hematopoietic tissue cells; Step A-2: Extract RNA and prepare cDNA from the hematopoietic tissue cells of the freshwater crayfish, and use the prepared cDNA as a template to perform freshwater crayfish hematopoietic factor Ast Gene cloning, obtaining the Ast The complete CDS sequence of the gene.

6. An application of the transgenic vector as described in any one of claims 1 to 3 in the culture of hematopoietic tissue cells of freshwater crayfish, the establishment of hematopoietic tissue cell lines, the overexpression of exogenous genes in hematopoietic tissue cells, the study of shrimp antiviral genes or the detection of shrimp viruses; the application is for non-diagnostic and therapeutic purposes; the freshwater crayfish is red claw crayfish.

7. The use according to claim 6, characterized in that: Using electrofection or chemical transfection to achieve overexpression of exogenous genes in freshwater crayfish hematopoietic tissue cells; The operating parameters of the electrotransfection method are: voltage 200 V, electric pulse time 30 ms, number of electric pulses 2 times, electric pulse interval 10 s, and electrotransfection buffer is CytoMix; The operating parameters of the chemical transfection method are: the ratio of transfection reagent to plasmid DNA in the transfection complex is 2:1; the time for incubating the freshwater crayfish hematopoietic tissue cells with the transfection complex is ≤ 6 h.

Citation Information

Patent Citations

  • Expression vector

    CN105238816A

  • Transfection method for expressing freshwater crayfish cell exogenous gene and application thereof

    CN108486115A

  • Compositions for genome editing and methods of use thereof

    WO2022006310A2