Nucleic acid aptamer combination and application thereof in visual detection of staphylococcus aureus

Abstract

The invention belongs to the technical field of pathogenic bacteria detection, and provides a nucleic acid aptamer combination and application thereof in visual detection of staphylococcus aureus, the nucleic acid aptamer combination comprises AP1, AP2, CS, PMDs and DNA padlock; wherein the AP1 is a nucleic acid aptamer for specifically recognizing the staphylococcus aureus; cS is used as a complementary nucleic acid sequence, and AP2 is used as a nucleic acid aptamer and is closed by CS2; and the DNA padlock contains a PMDs complementary sequence. According to the invention, the detection specificity is improved by adopting a double-nucleic acid aptamer combined target recognition strategy, and the detection sensitivity is improved by adopting a magnetic bead target enrichment strategy and a rolling circle amplification strategy, so that the visual detection of staphylococcus aureus is realized. The method can specifically recognize staphylococcus aureus, is high in sensitivity, has the lowest detection limit of 10 CFU / mL, is good in repeatability, is less than 9 hours in total time consumption, and can be used for visual detection of staphylococcus aureus in an actual sample.

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogen detection, and specifically relates to a nucleic acid aptamer combination and its application in the visual detection of Staphylococcus aureus. More specifically, double nucleic acid aptamers are used to jointly identify Staphylococcus aureus, and a magnetic bead target enrichment strategy and a rolling circle amplification strategy are combined to achieve visual detection of Staphylococcus aureus. Background Art

[0002] Staphylococcus aureus ( Staphylococcus aureus ) is a common foodborne pathogen and one of the main pathogens of community infection and hospital infection. Staphylococcus aureus can cause a variety of diseases, such as soft tissue and skin infections, toxic shock, food poisoning, etc. It can also produce exotoxins, enter the sweat glands, skin mucosa or wounds, cause cell death, and cause suppurative inflammation, acute pneumonia, osteomyelitis, endocarditis, sepsis, and even life-threatening. Especially for people with low immunity, the harm is greater. In recent years, in addition to the epidemic of Staphylococcus aureus infection in pregnant women, parturients, and newborns, there have been reports of the bacteria colonizing in the female vagina. In addition, Staphylococcus aureus is also prone to drug-resistant strains, such as methicillin-resistant strains (MRSA), which are very harmful.

[0003] The classic detection method of Staphylococcus aureus is based on microbial culture and physiological and biochemical indicators. This method is stable, reliable and sensitive, but it often takes 24 to 48 hours or even several days. In clinical practice, it is easy to delay treatment and difficult to meet the needs of rapid diagnosis. Therefore, various modern molecular biology and immunology methods are used for the detection of Staphylococcus aureus, such as qPCR (Real-Time Quantitative Polymerase Chain Reaction), ELISA (Enzyme-Linked Immunosorbent Assays), NGS (Next-Generation Sequencing), etc. However, ELISA is limited by the high cost of antibodies and cannot meet the sensitivity requirements. qPCR and NGS detect specific DNA sequences of Staphylococcus aureus, which is fast, sensitive and accurate, but not simple, sample processing is complicated, and it relies on large professional instruments and professionals. Therefore, there is still a significant and urgent need to develop a fast, simple, sensitive and accurate detection method for the detection of Staphylococcus aureus.

[0004] In recent years, functional nucleic acid-mediated detection methods have developed rapidly. Aptamers targeting Staphylococcus aureus have been successfully screened. The color reaction catalyzed by PMDs (Peroxidase mimicking DNAzymes) is used for visual detection of Staphylococcus aureus. The Rolling Circle Amplification (RCA) strategy has also been used to detect the MecA gene of drug-resistant Staphylococcus aureus (MRSA). However, aptamers targeting Staphylococcus aureus are still very scarce. Moreover, the use of a single aptamer to identify the target requires very high specificity of the aptamer. Existing aptamers are difficult to achieve high detection specificity. Summary of the invention

[0005] The purpose of the present invention is to address the deficiencies in the above-mentioned prior art and provide a nucleic acid aptamer combination and its application in the visual detection of Staphylococcus aureus. More specifically, dual nucleic acid aptamers are used to jointly identify Staphylococcus aureus, and a magnetic bead target enrichment strategy and a rolling circle amplification strategy are combined to achieve visual detection of Staphylococcus aureus.

[0006] The present invention screens nucleic acid aptamers through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology, enriches the nucleic acid aptamer library for Staphylococcus aureus, and uses a dual nucleic acid aptamer combined target recognition strategy to specifically identify Staphylococcus aureus, combines the magnetic bead target enrichment strategy with the rolling circle amplification strategy, and realizes the visual detection of Staphylococcus aureus.

[0007] The present invention is achieved by the following technical solutions: a nucleic acid aptamer combination, wherein the nucleic acid aptamer combination is AP1, AP2, CS, PMDs, and DNA padlock; Wherein: the AP1 is a nucleic acid aptamer that specifically recognizes Staphylococcus aureus; The CS serves as a complementary nucleic acid sequence, and AP2 serves as a nucleic acid aptamer blocked by CS2; The DNA padlock contains a PMDs complementary sequence.

[0008] Furthermore, the nucleotide sequence of AP1 is shown in SEQ ID NO.1; the nucleotide sequence of AP2 is shown in SEQ ID NO.2; the nucleotide sequence of CS is shown in SEQ ID NO.3; the nucleotide sequence of PMDs is shown in SEQ ID NO.4; and the nucleotide sequence of the DNA padlock is shown in SEQ ID NO.5.

[0009] A biotin label is added to the 3' end of the AP1; and PO4 is added to the 5' end of the DNA padlock nucleotide sequence.

[0010] The present invention also provides application of the nucleic acid aptamer combination in visual detection of Staphylococcus aureus.

[0011] Furthermore, a dual nucleic acid aptamer combined target recognition strategy was used to improve the detection specificity; the magnetic bead target enrichment strategy and the rolling circle amplification strategy were combined. The specific method is as follows: (1) Add biotin-labeled AP1 and incubate with the target Staphylococcus aureus suspension to allow AP1 to bind to the target. Add streptavidin magnetic beads to enrich the target bound to AP1 on the surface of the magnetic beads. Perform magnetic separation, discard the supernatant, and collect the magnetic beads. (2) A mixed solution of AP2 and CS is added to the magnetic beads for incubation. AP2 specifically binds to the target to be detected, resulting in the release of CS. The supernatant containing CS is centrifuged and a DNA padlock solution containing a PMDs complementary sequence, T4 DNA ligase buffer, and T4 DNA ligase are added for incubation. CS binds to the DNA padlock to obtain an enzyme-ligated product. (3) taking the enzyme-linked product obtained in step (2), adding phi29 DNA polymerase buffer, dNTP solution, and phi29 DNA polymerase, mixing and incubating to obtain an isothermal amplification product containing PMDs; (4) Add KCl and Hemin to the isothermal amplification product, mix well and incubate, add TMB single-component colorimetric solution, mix well and incubate to catalyze TMB reaction for color development; (5) Finally, the reaction was terminated with 0.1 mol / L sulfuric acid to obtain a yellow sample. The sample was then detected using an ELISA reader with a detection wavelength of 450 nm and deionized water as a reference.

[0012] Before use, AP1 was denatured at 95°C for 5 min, slowly cooled to room temperature, and stored at -20°C. Before use, AP2 and CS were mixed at a concentration ratio of 1:1, denatured at 95°C for 5 min, slowly cooled to room temperature, and stored at -20°C.

[0013] In step (1), AP1 was 1 μmol / L, and AP1 was incubated with Staphylococcus aureus at 37°C for 40 min; after adding streptavidin magnetic beads, the mixture was incubated at 37°C for 40 min; In step (2), the concentrations of AP2 and CS were 5 μmol / L respectively, and the mixed solution of AP2 and CS was incubated with the Staphylococcus aureus magnetic beads at 37°C for 40 min; the temperature of the T4 DNA ligase ligation reaction was 22°C; The temperature for phi29 DNA polymerase extension in step (3) is 30°C; In step (4), 250 mmol / L KCl and 2.5 μmol / L Hemin were added to the solution to be developed. The volume ratio of TMB single-component colorimetric solution to the solution to be developed was 1:1, and the color development reaction conditions were 25°C and 15 min.

[0014] When Staphylococcus aureus does not exist in the sample to be tested, AP2 and CS complementary sequences are not decomposed, CS does not bind to the DNA padlock, the DNA padlock cannot be enzymatically linked into a ring, rolling circle amplification cannot be initiated, PMDs are not generated, the color development reaction does not proceed, and the final sample color is colorless. The detection limit of Staphylococcus aureus is 10 CFU / mL.

[0015] The detection technology route is as follows Figure 2 As shown. A dual nucleic acid aptamer joint recognition target strategy is used to improve detection specificity. The magnetic bead target enrichment strategy and rolling circle amplification strategy are combined to improve detection sensitivity.

[0016] The present invention adopts the SELEX method to screen and obtain nucleic acid aptamers that can specifically bind to Staphylococcus aureus, and adopts a double nucleic acid aptamer joint recognition target strategy to improve specificity, and adopts a magnetic bead target enrichment strategy and a rolling circle amplification strategy to improve sensitivity, thereby achieving high specificity, high sensitivity, and visual detection of Staphylococcus aureus. The method can specifically identify Staphylococcus aureus, and has high detection sensitivity, a minimum detection limit of 10 CFU / mL, good repeatability, and a total time consumption of less than 9 hours, and can be used for visual detection of actual samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the stem-loop structure of nucleic acid aptamer 1 (AP1 minus biotin); Figure 2 It is the technical route of the present invention; Figure 3 The feasibility analysis test results; in the figure: A-test sample, B-test control, C-0.5 μmol / L PMDs color development, D-no PMDs control, E-deionized water; Figure 4 PAGE electrophoresis of samples during the detection process; in the figure: M-Marker, lane 1-enzyme-linked product of the control group, lane 2-RCA product of the control group, lane 3-enzyme-linked product of the experimental group, lane 4-RCA product of the experimental group, lane 5-DNA padlock, lane 6-AP1, lane 7-AP2+CS, lane 8-AP2, lane 9-CS; the sample volume is 5 μL; Figure 5 The specificity test results are shown in the figure: A-Staphylococcus aureus, B-Escherichia coli, C-Herbaceae, D-control; Figure 6For sensitivity detection; in the figure: A-10 4 CFU / mL, B-10 3 CFU / mL, C-10 2 CFU / mL, D-10 CFU / mL, E-control; Figure 7 is the repeatability test result; in the figure: S1-sample 1, C1-control 1, S2-sample 2, C2-control 2, S3-sample 3, C3-control 3, S4-sample 4, C4-control 4; Figure 8 It is a reproducible test; in the figure: S1-tap water sample, C1-tap water control, S2-egg drop soup sample, C2-egg drop soup control, S3-AD calcium milk sample, C3-AD calcium milk control; Fig. 9 Verification of nucleic acid aptamer specificity; in the figure: (I) median fluorescence intensity, A-Staphylococcus aureus, B-Bacillus subtilis, C-Escherichia coli; (II) Staphylococcus aureus; (III) Bacillus subtilis; (IV) Escherichia coli. DETAILED DESCRIPTION

[0018] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0019] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0020] Technical equivalents to the specific embodiments described that are apparent to those skilled in the art using no more than routine experimentation are intended to be encompassed by this application.

[0021] The experimental methods in the following examples are all conventional methods unless otherwise specified. The instruments and equipment used in the following examples are all conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0022] 1. Experimental Materials: All DNA sequences were synthesized by Shanghai Saiheng Biotechnology Co., Ltd. All chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. All experimental consumables were purchased from Beijing Dingguo Biotechnology Co., Ltd. Unless otherwise specified, all experimental water was deionized water. Staphylococcus aureus ( Staphylococcus aureus )ATCC6538 (abbreviated as "golden grape"), Bacillus subtilis ( Bacillus subtilis )168 (referred to as "subtilis"), Escherichia coli ( Escherichia coli ) K12 (abbreviated as “large intestine”) were purchased from China General Microorganism Culture Collection Center.

[0023] Full wavelength microplate reader, Molecular Devices SpectraMax ABS plus. Flow cytometer, BD, USA, C6. PCR instrument, Biometra Tone 96G. Electrophoresis device, Bio-Rad. Metal bath, Dalong, HCM100-Pro. Micropipette, Eppendorf.

[0024] 2. Experimental Methods 1. Bacterial culture and preparation of bacterial suspension: Take Staphylococcus aureus (referred to as "S. aureus") stored at -80 ℃ and inoculate it into LB liquid culture medium, and culture it at 37 ℃ and 200 r / min until OD 600nm 0.8~1.0, take 1 mL of bacterial solution and centrifuge at 10000 r / min for 1 min to collect the bacteria, wash twice with deionized water. Resuspend the bacteria in deionized water and adjust the OD 600nm 0.1, temporarily stored at 4℃.

[0025] 2. Screening and specificity verification of nucleic acid aptamers: The SELEX method was used to screen nucleic acid aptamers.

[0026] A. Preparation of ssDNAs library: The library (L1) sequence is: CACGGATCCTGACAAG-N40-CAGCTCCGTCCG; Forward Primer (FP): CACGGATCCTGACAAG; Reverse Primer 1 (RP1): CGGACGGAGCTG; Reverse Primer 2 (RP2): A20-Sp-CGGACGGAGCTG (Sp is the spacer).

[0027] Using L1 sequence as template and FP / RP1 as primers for PCR amplification, a double-stranded DNA product LFP was obtained; then using LFP as template and FP / RP2 as primers for PCR amplification, a double-stranded DNA product LPD was obtained. Urea PAGE electrophoresis was used to separate the L1 single strand as the ssDNA library.

[0028] B. Screening and specificity verification: After incubating the L1 single chain with Staphylococcus aureus for 1 hour, centrifuge at 5000 r / min for 5 minutes, discard the supernatant, wash the precipitate twice with PBS solution, add 400 μL of 20 mmol / L NaOH solution, and dissociate in a 75 ℃ metal bath for 3 minutes. After the dissociation is completed, neutralize with 4 μL of 5 mol / L HCl solution, centrifuge at 5000 r / min for 15 minutes, collect the supernatant in a 1.5 mL centrifuge tube, denature at 95 ℃ for 3 minutes, and freeze at -20 ℃ for 1 minute. The product is used as the ssDNAs library after positive screening for negative screening.

[0029] The ssDNAs library after positive screening was incubated with Bacillus subtilis for 1 h, centrifuged at 5000 r / min for 15 min, and the supernatant was collected in a 1.5 mL centrifuge tube, denatured at 95 °C for 3 min, and frozen at -20 °C for 1 min. The obtained product was used as the ssDNAs library after the entire round of screening for the next round of screening.

[0030] After 10 rounds of screening, ssDNAs from every 5 rounds of screening were sent for sequencing, and the sequencing primers were FP / RP1. According to the sequencing results, the nucleic acid aptamer was labeled with the green fluorescent group FAM as a fluorescent probe. Bacillus subtilis and Escherichia coli were used as negative targets, and Staphylococcus aureus was used as a positive target. After the fluorescent probe was incubated with the target, the unbound probe was washed away, and the fluorescent signal was detected by flow cytometry. The signal difference between the positive target and the negative target was used to judge the binding specificity.

[0031] C. Feasibility analysis 1. DNA sequence design and denaturation treatment: AP1: The nucleic acid aptamers obtained by the above screening (such as Figure 1 The 3' end of the protein was labeled with biotin.

[0032] AP2:ATATACACCCACCTCGCTCCCGTGACACTAATGCTATTTTTT; CS:AGTGTCACGGGAGCGAGG; PMDs:TGGGTAGGGCGGGTTGGG; DNA Padlock: PO4-CGTGACACTCCCAACCCGCCCTACCCAAAACCCAACCCGCCCTACCCAAAA-CCCAACCCGCCCTACCCTCGCTCC.

[0033] AP2+CS (AP2 and CS 10 μmol / L each mixed), AP1 (10 μmol / L), denature at 95 ℃ for 5 min, slowly cool to room temperature, and store at -20 ℃.

[0034] 2. Incubation, ligation, isothermal amplification and color development: Prepare bacterial suspension according to the above bacterial culture method, take 100 μL, add 20 μL AP1 and 80 μL deionized water, mix well and incubate at 37℃ for 40 min. Add 25 μL streptavidin magnetic beads, mix well and incubate at 37℃ for 40 min. Magnetic separation, discard the supernatant, and wash three times with deionized water. Add 20 μL AP2+CS mixture, incubate at 37℃ for 40 min, take the supernatant (containing CS), store at 4℃ for later use.

[0035] Take 10 μL of supernatant (containing CS), add 1 μL of deionized water, 5 μL of 10 μmol / L DNA padlock solution, 2 μL of T4 DNA ligase buffer, and 2 μL of T4 DNA ligase in sequence, and mix well. Incubate at 22 ℃ for 1.5 h to obtain the enzyme-linked product. Take 10 μL of the enzyme-linked product, add 9 μL of deionized water, 3 μL of phi29 DNA polymerase buffer, 6 μL of 25 mmol / L dNTP solution, and 2 μL of phi29 DNA polymerase in sequence, and mix well. Incubate at 30 ℃ for 4 h, inactivate at 65 ℃ for 10 min, obtain the isothermal amplification product, and store at 4 ℃ for later use. Replace the bacterial suspension with deionized water as a control.

[0036] Add 5 μL (2 M) KCl and 5 μL (20 μmol / L) Hemin to 30 μL isothermal amplification product, mix well, and incubate at 25°C for 30 min. Add 50 μL TMB single-component colorimetric solution, mix well, incubate at 25°C for 15 min, and terminate the reaction with 0.1 mol / L sulfuric acid. Detection was performed using an ELISA reader, with 1 nm as the scanning unit for full-band scanning, 450 nm as the detection wavelength, and deionized water as the reference.

[0037] PMDs control color development system: pH 7.5 HEPES 25 mmol / L; KCl 250 mmol / L; PMDs 0.5 μmol / L; Hemin 2.5 μmol / L.

[0038] D. Sensitivity and specificity: According to “OD 600nm The Staphylococcus aureus liquid with a concentration of 1 corresponds to 3.7×10 8 CFU / mL”, and adjust the colony count to 1×10 8 CFU / mL, and then diluted to 1×10 7 , 1×10 6 , 1×105 , 1×10 4 , 1×10 3 , 1×10 2 , 10, 1 CFU / mL, temporarily stored at 4°C.

[0039] Similarly, "OD 600nm The E. coli liquid with a concentration of 1 corresponds to 3.1×10 8 CFU / mL, OD 600nm The Bacillus subtilis liquid with a value of 1 corresponds to 9.5×10 7 CFU / mL”, and the colony count was adjusted to 1×10 8 CFU / mL. Dilute to 1×10 3 CFU / mL, temporarily stored at 4 ℃.

[0040] According to the above analysis method, Staphylococcus aureus suspensions of different concentrations were used for sensitivity analysis, and Escherichia coli suspensions and Bacillus subtilis suspensions were used as control experiments for specificity analysis.

[0041] E. Repeatability and reproducibility: Repeatability and reproducibility experiments were carried out according to the above analytical methods. The concentration of Staphylococcus aureus liquid was 1×10 3 CFU / mL. Tap water, egg drop soup, and AD calcium milk were used instead of deionized water to prepare bacterial suspensions for reproducibility experiments.

[0042] The specific method is as follows: 1. Detection of Staphylococcus aureus in tap water: Use tap water as solvent to prepare a tap water suspension of Staphylococcus aureus with a concentration of 1×10 3 CFU / mL. The tap water suspension of Staphylococcus aureus was used as the test sample (S1), and tap water was used as the test control (C1). The actual tap water sample was tested according to the above analytical method.

[0043] 2. Detection of Staphylococcus aureus in egg drop soup: Egg drop soup was used as solvent to prepare a suspension of Staphylococcus aureus in egg drop soup. The concentration of Staphylococcus aureus was 1×10 3 CFU / mL. The golden staphylococcus egg drop soup suspension was used as the test sample (S2), and the egg drop soup was used as the test control (C2). The actual egg drop soup sample was tested according to the above analytical method.

[0044] 3. Detection of Staphylococcus aureus in AD calcium milk: Using AD calcium milk as solvent, prepare AD calcium milk suspension of Staphylococcus aureus with a concentration of 1×10 3 CFU / mL. The Staphylococcus aureus AD calcium milk suspension was used as the test sample (S3), and the AD calcium milk was used as the test control (C3). The actual AD calcium milk sample was tested according to the above analysis method.

[0045] 2. Experimental Results 1. Screening and specificity verification of nucleic acid aptamers: Using the SELEX method, after 15 rounds of screening, the nucleic acid aptamer AP1 was obtained. Figure 1 As shown. A FAM fluorescently labeled synthetic probe was added to the 3' end of the nucleic acid aptamer AP1, and it was combined with Staphylococcus aureus, Bacillus subtilis, and Escherichia coli, respectively. After incubation and elution, the fluorescence signal intensity was detected by flow cytometry. The results are shown in Fig. 9 As shown in the figure, there is a significant difference in fluorescence intensity between the sample and the background when Staphylococcus aureus binds to the probe, while there is no significant difference in fluorescence intensity between the samples of Escherichia coli and subtilis and the background. From the median of fluorescence intensity, there are significant differences between Staphylococcus aureus and Escherichia coli, and between Staphylococcus aureus and subtilis. This shows that the nucleic acid aptamer screened has the recognition specificity for Staphylococcus aureus.

[0046] 2. Detection principle: Figure 2 As shown, biotin-labeled aptamer 1 (AP1) is incubated with a target (Staphylococcus aureus) suspension to allow AP1 to bind to the target. Then, streptavidin magnetic beads are added, and the affinity between streptavidin and biotin label is used to enrich Staphylococcus aureus on the surface of magnetic beads. Magnetic separation is performed, the supernatant is discarded, and the magnetic beads are collected. Then, a solution of aptamer 2 (AP2) blocked with a complementary nucleic acid sequence (CS) is added. Because AP2 can specifically bind to Staphylococcus aureus, CS is released, and then binds to a DNA padlock (containing a PMDs complementary sequence). After enzyme linkage and RCA isothermal amplification, a large number of PMDs are produced. Then, TMB reaction is catalyzed to develop color (blue), and finally, the reaction is terminated by sulfuric acid to obtain a yellow sample. When the target does not exist, the AP2+CS complementary sequence will not decompose, and CS cannot bind to the DNA padlock, so the DNA padlock cannot be linked to a ring by enzyme, and the rolling circle amplification RCA cannot be initiated, and a large number of PMDs will not be produced. The color development reaction will not proceed, and the color of the sample tends to be colorless. Based on the color difference between samples containing the target and those not containing the target, they can be distinguished by naked eye or by measuring the absorbance value at a detection wavelength of 450 nm for accurate distinction.

[0047] 3. Feasibility analysis results: Staphylococcus aureus suspension (OD 600nm 0.1) as the test sample, deionized water as the test control, according to the above method, Figure 2 The color samples were scanned by the full band of the microplate reader (300nm~800nm), and a strong absorption peak was found at 450nm, so 450nm was selected as the detection wavelength. 450nm Test results such as Figure 3 As shown, the OD of the test sample and the control 450nmThe difference is very significant. At the same time, the color intensity of PMDs (0.5 μmol / L) control was compared with the sample, and the color intensity of PMDs was significantly lower than that of the test sample, indicating that a large amount of PMDs has been amplified in the sample. PAGE electrophoresis of the sample during the test process ( Figure 4 ) also further supports this speculation. The RCA product of the experimental group (lane 4) showed a large band that could not enter the lane. This was the long-chain DNA (containing a large number of PMDs sequences) produced by extension. The RCA product of the control group (lane 2) had less long-chain DNA. Comparing lanes 1 and 3, it can be seen that a large number of bands close to 200 bp in size appeared in the enzyme-linked product of the experimental group (enzyme-linked product), while the DNA padlocks were significantly reduced; a large number of DNA padlocks remained in the control group. Based on the above results, the S. aureus detection method constructed by the present invention is feasible.

[0048] 4. Specificity and sensitivity: The bacterial suspensions of Staphylococcus aureus, Herba Subtilis and Escherichia coli (1×10 3 CFU / mL) as the test sample, and deionized water as the control. Figure 2 The test was performed according to the test process shown in the figure, and the test specificity analysis was performed. Figure 5 As shown, the detection signals of the Staphylococcus aureus group and the other groups are significantly different, while the detection signals of the Escherichia coli group, the Bacillus subtilis group and the control group are not significantly different. This shows that the method of the present invention has good detection specificity for Staphylococcus aureus.

[0049] Different concentrations of Staphylococcus aureus suspension were used as test samples, and deionized water was used as control. Figure 2 The test was performed according to the test process shown in the figure, and the test sensitivity analysis was performed. Figure 6 As shown, 10 2 CFU / mL and higher bacterial concentrations showed a very significant difference in detection signal compared with the control group. There was also a detection signal at 10 CFU / mL, which was significantly different from the control group, but the signal was significantly weakened, so 10 CFU / mL was the minimum detection limit of this method.

[0050] 5. Repeatability and reproducibility: Staphylococcus aureus suspension (1×10 3 CFU / mL) was used as the test sample, and deionized water was used as the control. Figure 2 The test was carried out according to the test process shown in the figure, and the test repeatability analysis was performed. Figure 7 As shown in the figure, after four repetitions, the difference between the sample group and the control group was very significant, and the standard deviation within the group was small, which showed that this method had good detection repeatability.

[0051] Actual samples (tap water, egg drop soup, AD calcium milk) were used instead of deionized water to prepare Staphylococcus aureus suspension (1×10 3CFU / mL), with deionized water as the control. Figure 2 The test process shown in the figure was used to test actual samples and conduct test reproducibility analysis. Figure 8 As shown, the differences in detection signals between the three actual sample groups (tap water, egg drop soup, and AD calcium milk) and their respective control groups were very significant, indicating that this method can be used to detect these three actual samples.

[0052] The time consumption of this method is as follows: incubation of AP1 with samples for 40 min, incubation with magnetic beads for 40 min, incubation with AP2+CS for 40 min, enzyme ligation for 1.5 h, RCA amplification for 4 h, incubation with Hemin for 30 min, color development with TMB for 15 min, and other operation time, the total time does not exceed 9 h. Given the current efficiency of ligase and DNA polymerase, there is a lot of room for shortening the time consumption if they are replaced with enzymes with better performance. The detection limit of this method (10 CFU / mL) is not far from the 4.4 CFU / mL in the literature [1] and the current highest level of 1 CFU / mL [2]. If the conditions are optimized appropriately, the detection limit of this study may still be lowered.

[0053] The present invention adopts the SELEX method to screen and obtain nucleic acid aptamers that can specifically bind to Staphylococcus aureus, and adopts a double nucleic acid aptamer joint recognition target strategy to improve specificity, and adopts a magnetic bead target enrichment strategy and a rolling circle amplification strategy to improve sensitivity, thereby achieving high specificity, high sensitivity, and visual detection of Staphylococcus aureus. The method can specifically identify Staphylococcus aureus, and has high detection sensitivity, a minimum detection limit of 10 CFU / mL, good repeatability, a total time consumption of less than 9 hours, and can be used for visual detection of actual samples.

[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention. References: [1] Wang X, Wang X, Wei S, et al. Target-Triggered hybridizationchain reaction self-assembly of G-quadruplex DNAzyme for colorimetric detection of Staphylococcus aureusin milk[J]. Microchemical Journal, 2023,193: 109180. [2] Li Y, Tang X, Wang N, et al. Argonaute-DNAzyme tandem biosensingfor highly sensitive and simultaneous dual-gene detection of methicillin-resistant Staphylococcus aureus [J]. Biosensors and Bioelectronics, 2024, 244:115758。

Claims

1. A nucleic acid aptamer combination, characterized in that: The aptamer combination is AP1, AP2, CS, PMDs, and DNA padlock; Wherein: the AP1 is a nucleic acid aptamer that specifically recognizes Staphylococcus aureus; The CS serves as a complementary nucleic acid sequence, and AP2 serves as a nucleic acid aptamer blocked by CS2; The DNA padlock contains a PMDs complementary sequence.

2. The nucleic acid aptamer combination according to claim 1, characterized in that: The nucleotide sequence of AP1 is shown in SEQ ID NO.1; the nucleotide sequence of AP2 is shown in SEQ ID NO.2; the nucleotide sequence of CS is shown in SEQ ID NO.3; the nucleotide sequence of PMDs is shown in SEQ ID NO.4; and the nucleotide sequence of the DNA padlock is shown in SEQ ID NO.

5.

3. The nucleic acid aptamer combination according to claim 1 or 2, characterized in that: A biotin label is added to the 3' end of the AP1; and PO4 is added to the 5' end of the DNA padlock nucleotide sequence.

4. Use of the nucleic acid aptamer combination according to claim 1 or 2 in visual detection of Staphylococcus aureus.

5. The use according to claim 4, characterized in that: The double nucleic acid aptamer joint target recognition strategy is adopted to improve the detection specificity; the magnetic bead target enrichment strategy and the rolling circle amplification strategy are combined. The specific method is as follows: (1) Add biotin-labeled AP1 and incubate with the target Staphylococcus aureus suspension to allow AP1 to bind to the target. Add streptavidin magnetic beads to enrich the target bound to AP1 on the surface of the magnetic beads. Perform magnetic separation, discard the supernatant, and collect the magnetic beads. (2) A mixed solution of AP2 and CS is added to the magnetic beads for incubation. AP2 specifically binds to the target to be detected, resulting in the release of CS. The supernatant containing CS is centrifuged and a DNA padlock solution containing a PMDs complementary sequence, T4 DNA ligase buffer, and T4 DNA ligase are added for incubation. CS binds to the DNA padlock to obtain an enzyme-ligated product. (3) taking the enzyme-linked product obtained in step (2), adding phi29 DNA polymerase buffer, dNTP solution, and phi29 DNA polymerase, mixing and incubating to obtain an isothermal amplification product containing PMDs; (4) Add KCl and hemin to the isothermal amplification product containing PMDs, mix well and incubate, add TMB single-component colorimetric solution, mix well and incubate, and catalyze TMB reaction for color development; (5) Finally, the reaction was terminated with 0.1 mol / L sulfuric acid to obtain a yellow sample. The sample was then detected using an ELISA reader with a detection wavelength of 450 nm and deionized water as a reference.

6. The use according to claim 5, characterized in that: Before use, AP1 was denatured at 95°C for 5 min, slowly cooled to room temperature, and stored at -20°C. Before use, AP2 and CS were mixed at a concentration ratio of 1:1, denatured at 95°C for 5 min, slowly cooled to room temperature, and stored at -20°C.

7. The use according to claim 5, characterized in that: In step (1), the concentration of AP1 was 1 μmol / L, and AP1 was incubated with Staphylococcus aureus at 37°C for 40 min; after adding streptavidin magnetic beads, the mixture was incubated at 37°C for 40 min; In step (2), the concentrations of AP2 and CS were 5 μmol / L respectively, and the mixed solution of AP2 and CS was incubated with the Staphylococcus aureus magnetic beads at 37°C for 40 min; the temperature of the T4 DNA ligase ligation reaction was 22°C; The temperature for phi29 DNA polymerase extension in step (3) was 30°C; In step (4), 250 mmol / L KCl and 2.5 μmol / L Hemin were added to the solution to be developed. The volume ratio of TMB single-component colorimetric solution to the solution to be developed was 1:1, and the color development reaction conditions were 25°C and 15 min.

8. The use according to claim 5, characterized in that: When Staphylococcus aureus does not exist in the sample to be tested, AP2 and CS complementary sequences are not decomposed, CS does not bind to the DNA padlock, the DNA padlock cannot be enzymatically linked into a ring, rolling circle amplification cannot be initiated, PMDs are not generated, the color development reaction does not proceed, and the final sample color is colorless.

9. The use according to claim 5, characterized in that: The detection limit of Staphylococcus aureus is 10 CFU / mL.

Images