Sweet potato ibpsst2 gene and application thereof in promoting synthesis of plant anthocyanins
By providing the sweet potato IbPSST2 gene and its recombinant expression vector, the problem of unclear genetic basis for the formation of purple shoot tips in sweet potatoes was solved, and significant accumulation of anthocyanins in tobacco leaves and sweet potato roots was achieved, promoting the manifestation of the purple phenotype.
Patent Information
- Application Number
- CN202411923349.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-12-25
AI Technical Summary
The genetic basis and regulatory mechanism of purple stem tip formation in sweet potatoes are unclear, which hinders the breeding and genetic improvement of sweet potato varieties with purple stem tips. Existing technologies lack key genes that promote anthocyanin synthesis.
We provided the sweet potato IbPSST2 gene and its recombinant expression vector, which were then transferred into tobacco and sweet potato via transient expression and stem injection to promote anthocyanin synthesis.
It significantly increased the content of anthocyanins in tobacco leaves and sweet potato roots, resulting in the appearance of the purple phenotype and promoting the accumulation of anthocyanins.
Smart Images

Figure CN119685342B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, and more particularly to Ipomoea batatas IbPSST2 gene and its application in promoting plant anthocyanin synthesis. BACKGROUND
[0002] Ipomoea batatas L. belongs to Convolvulaceae genus. The above and underground parts of Ipomoea batatas L. are edible, and the above part of stem tip is edible part, which is called table sweet potato and is a special type of sweet potato. The color of sweet potato stem tip is varied, including dark green, light green, yellow green, green purple edge, light purple and purple. Generally, it can be divided into two categories: purple stem tip and non-purple stem tip. The purple stem tip rich in anthocyanin has high nutritional value and various health functions such as anti-aging and anti-tumor, and is an important quality trait of table sweet potato. At present, the stem tip color of the main table varieties of table sweet potato is mostly green, and the purple type is rarely seen. The genetic basis and regulation mechanism of the formation of purple stem tip of sweet potato are not clear, which seriously hinders the process of variety breeding and genetic improvement of table sweet potato with purple stem tip.
[0003] Anthocyanin is the material basis for the formation of purple stem tip of sweet potato. The anthocyanin biosynthesis pathway is highly conserved in plants, and a series of key enzyme genes in the synthesis pathway have been isolated and identified. The biosynthesis of anthocyanin requires the coordinated expression of multiple structural genes, and transcription factors are responsible for the precise temporal and spatial expression regulation of these structural genes. Studies have shown that the MBW (MYB-bHLH-WD40) ternary complex formed by transcription factors MYB, bHLH and WD40 affects the synthesis and accumulation of anthocyanin by activating or inhibiting the transcription of downstream structural genes; among them, MYB / bHLH is responsible for binding to the promoter of downstream genes, and WD40 is responsible for stabilizing the ternary complex. Especially, MYB transcription factor can be regulated at the transcriptional or post-transcriptional level by external environmental conditions and regulatory genes, affecting the accumulation of plant anthocyanin. For example, under light conditions, Arabidopsis bZIP transcription factor HY5 promotes the accumulation of anthocyanin by activating the transcription of AtMYB12 and AtMYB111 genes. Apple MdHY5 can bind to the E-box and G-box motifs of the MdMYB10 promoter to promote the synthesis of anthocyanin in fruits, and MdBBX20 can promote the binding of MdHY5 to the MdMYB1 promoter by forming a protein complex with MdHY5, thereby promoting the synthesis of anthocyanin in apples. Pear PpHY5 can enhance the expression of PpMYB10 by binding to the G-box motif of the PpMYB10 promoter to promote the synthesis of anthocyanin in pear skin; PpBBX16 and PpBBX18 can activate the transcription of PpMYB10 by interacting with PpHY5 to bind to the PpMYB10 promoter to induce the synthesis of anthocyanin in pear skin. However, the key genes regulating anthocyanin synthesis in sweet potato stem tip have not been identified.
[0004] Therefore, providing sweet potato IbPSST2 gene and its application in promoting plant anthocyanin synthesis is an urgent problem for those skilled in the art. SUMMARY
[0005] Therefore, the present application provides sweet potato IbPSST2 gene and its application in promoting plant anthocyanin synthesis.
[0006] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0007] The sweet potato IbPSST2 gene has a nucleotide sequence as shown in SEQ ID NO. 1.
[0008] Further, the protein encoded by the sweet potato IbPSST2 gene has an amino acid sequence as shown in SEQ ID NO. 2.
[0009] Further, the application of the sweet potato IbPSST2 gene in promoting plant anthocyanin synthesis.
[0010] Further, a recombinant expression vector pGreenII62-SK::IbPSST2 contains the sweet potato IbPSST2 gene.
[0011] Further, a recombinant bacterium I contains the recombinant expression vector pGreenII62-SK::IbPSST2.
[0012] Further, the application of the sweet potato IbPSST2 gene, the recombinant expression vector pGreenII62-SK::IbPSST2 or the recombinant bacterium I in promoting anthocyanin accumulation in tobacco leaves.
[0013] Further, a recombinant expression vector pCAMV35s::DsRed-IbPSST2 contains the sweet potato IbPSST2 gene.
[0014] Further, a recombinant bacterium II contains the recombinant expression vector pCAMV35s::DsRed-IbPSST2.
[0015] Further, the application of the sweet potato IbPSST2 gene, the recombinant expression vector pCAMV35s::DsRed-IbPSST2 or the recombinant bacterium II in promoting anthocyanin accumulation in sweet potato roots.
[0016] Compared with the prior art, the application provides sweet potato IbPSST2 gene and its application in promoting plant anthocyanin synthesis, obtains the sweet potato gene IbPSST2 for promoting anthocyanin synthesis of the stem tip of sweet potato, and constructs the coding region into an overexpression vector, and the vector is respectively introduced into tobacco and sweet potato through transient expression and stem section injection, and the IbPSST2 gene in the obtained transient expression tobacco leaf and the transgenic sweet potato root system has significant expression compared with the control leaf and root system, and the expression tobacco leaf and the transgenic sweet potato root system are purple. The IbPSST2 gene promotes the increase of the content of anthocyanin. BRIEF DESCRIPTION OF DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description only are the embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of the provided drawings.
[0018] Figure 1 The figure is a Manhattan plot of IbPSST2 gene identified by whole genome association analysis in the present application;
[0019] Figure 2 The figure is a scanning image of the stem tip leaf of the purple stem tip and the green stem tip sweet potato variety selected in the present application;
[0020] In the figure, a is a scanning image of the stem tip leaf of the sweet potato variety Yan 25 from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); b is a scanning image of the stem tip leaf of the sweet potato variety Xiguahong from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); c is a scanning image of the stem tip leaf of the sweet potato variety Australiazibai from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); d is a scanning image of the stem tip leaf of the sweet potato variety Xu 32 from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); e is a scanning image of the stem tip leaf of the sweet potato variety Guangcaishu No. 10 from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); f is a scanning image of the stem tip leaf of the sweet potato variety Sholu No. 1 from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); g is a scanning image of the stem tip leaf of the sweet potato variety Qixu 37 from the unexpanded leaf (NSL) to the fifth expanded leaf (SL-1 to SL-5); the scale is 1 cm;
[0021] Figure 3 The figure is an expression pattern diagram of the anthocyanin content and IbPSST2 gene of the stem tip of the purple stem tip and the green stem tip sweet potato variety in the present application;
[0022] Figure a is the anthocyanin content of Ipomoea batatas variety Yan 25 from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure b is the expression pattern of IbPSST2 gene in Ipomoea batatas variety Yan 25 from unexpanded leaves to the fifth expanded leaf; Figure c is the anthocyanin content of Ipomoea batatas variety Xiguahong from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure d is the expression pattern of IbPSST2 gene in Xiguahong from unexpanded leaves to the fifth expanded leaf; Figure e is the anthocyanin content of Ipomoea batatas variety Australia Zhibai from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure f is the expression pattern of IbPSST2 gene in Australia Zhibai from unexpanded leaves to the fifth expanded leaf; Figure g is the anthocyanin content of Ipomoea batatas variety Xu 32 from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure h is the expression pattern of IbPSST2 gene in Xu 32 from unexpanded leaves to the fifth expanded leaf; Figure i is the anthocyanin content of Ipomoea batatas variety Guangcaishu No. 10 from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure j is the expression pattern of IbPSST2 gene in Guangcaishu No. 10 from unexpanded leaves to the fifth expanded leaf; Figure k is the anthocyanin content of Ipomoea batatas variety Sholu No. 1 from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure l is the expression pattern of IbPSST2 gene in Sholu No. 1 from unexpanded leaves to the fifth expanded leaf; Figure m is the anthocyanin content of Ipomoea batatas variety Qixu 37 from unexpanded leaves (NSL) to the fifth expanded leaf (SL-1 to SL-5); Figure n is the expression pattern of IbPSST2 gene in Qixu 37 from unexpanded leaves to the fifth expanded leaf;
[0023] Figure 4 The figure is the pGreenII62-SK vector map of the application;
[0024] Figure 5 The figure is a schematic diagram of constructing a transient infection tobacco vector of the application;
[0025] Figure 6 The figure is the phenotype and detection diagram of the anthocyanin accumulation in tobacco leaves and Ipomoea batatas roots by IbPSST2 gene;
[0026] a is a phenotype diagram of IbPSST2 gene on anthocyanin accumulation in tobacco leaves; b is a result of gene expression quantity detection of wild type and transient overexpression of IbPSST2 gene; c is a result of anthocyanin content determination of wild type and transient overexpression of IbPSST2 gene in tobacco leaves; d is a root system diagram of IbPSST2 gene transgenic sweet potato under natural light; e is a root system diagram of IbPSST2 gene transgenic sweet potato under red excitation light, wherein the bright root system is a transgenic positive root system; f is a result of IbPSST2 expression quantity detection in wild type root system ck and overexpression of IbPSST2 root system; g is a root system longitudinal section phenotype diagram of wild type root system ck (purple skin and white heart); h is a root system longitudinal section phenotype diagram of overexpression of IbPSST2; i is a root system horizontal section phenotype diagram of wild type root system ck (purple skin and white heart); j is a root system horizontal section phenotype diagram of overexpression of IbPSST2; k is a result of anthocyanin content determination in wild type root system ck and overexpression of IbPSST2 root system; the scale of g, h, i and j is 100 µm;
[0027] Figure 7 The figure is a pCAMV35s::DsRed vector map of the application.
[0028] Figure 8 The figure is a schematic diagram of construction of a sweet potato root system genetic transformation vector of the application. DETAILED DESCRIPTION
[0029] The technical solutions in the embodiments of the application will be described clearly and completely below with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the application.
[0030] The CDS sequence of the IbPSST2 gene is shown as SEQ ID NO. 1.
[0031] ATGGTTAATTCATTATCATCTGCATGGCCTTCGCCTTCGGGATTGATGAGAAAAGGTGCATGGACCGAAGAAGAAGATAATCTTTTGAGGAAGTGCATTCAGAAGTATGGGGAAGGGAAATGGCATCTAGTTCCCCTTAGAGCTGGGTTAAACAGGTGCAGAAAAAGTTGTAGATTGAGATGGTTGAACTATCTTCGTCCTGATATCAAACGAGGAGACTTCAGTGTGGATGAAGTTGATCTCATTATGCGCCTCCATCGACTCTTAGGCAACAGGTGGTCGCTTATTGCCGGCAGAATCCCGGGAAGAACAGCAAACGATGTGAAGAATTACTGGAACACCCATATTCAGAAGAAGGTATTTGCCATGGCTGCTGCTTCATCTAGGATGCAAGACAATTGGAAGGGCAAAGCCCCAGAAATCAGTAAAAACACCGTCGTTAAGCCTCAACCTCGGAGATTCTTAAACACCTCATCATTATCTCGGACACCAATGACCGGAAAAGCCACCGCCGTTACCAATTACGCTCAAATCCAAGCACACACGTTACCGCAGCGGGAAACAACAACAACATCGGACTTGGTAATGGAAAATGTTCAAAAAAACGACACAATCGCGAGTTTTCCGTCAGAGTTAGAAACAACAACGTTTGACGACAGAGTCCAGTGGTGGGAGGAATTGCTCTTTGACAAGGAACTCAACGATGAAGGAACCGCGTGCATGCACGAAGGTCAAATCGGTTGGTCTCACTTGCCAACTGATAT TGACCTTTTGGAACTTCTAAGCTAA ; SEQ ID NO. 1.
[0032] The amino acid sequence of the IbPSST2 gene is shown in SEQ ID NO. 2.
[0033] MVNSLSSAWPSPSGLMRKGAWTEEEDNLLRKCIQKYGEGKWHLVPLRAGLNRCRKSCRLRWLNYLRPDIKRGDFSVDEVDLIMRLHRLLGNRWSLIAGRIPGRTANDVKNYWNTHIQKKVFAMAAASSRMQDNWKGKAPEISKNTVVKPQPRRFLNTSSLSRTPMTGKATAVTNYAQIQAHTLPQRETTTTSDLVMENVQKNDTIASFPSELETTTFDDRVQWWEELLFDKELNDEGTACMHEGQIGWSHLPTDIDLLELLS; SEQ ID NO. 2.
[0034] Example 1 Localization of IbPSST2 gene
[0035] To obtain the relevant SNP sites, the relevant resequencing data was downloaded using a public database, the Ipomoea trifida reference genome was used for alignment by BWA software, and Samtools software was used to identify SNPs in the population, followed by filtering of the SNP sites (MAF > 5%, missing rate < 30%), and finally 1999880 SNPs sites were obtained. After determining the color trait classification, the EMMAX software was used for association analysis, the kinship matrix between individuals was automatically generated by the software, and then the Bonferroni test was used to test the significance of the association between the markers and the expression traits in GWAS, and the significant threshold value obtained was 5.0*10 -7 . LD analysis was performed on the significantly associated SNPs sites to determine the candidate interval, and SNPs with r 2 greater than 0.1 were combined into QTL, and finally at least 3 significantly associated SNP sites were retained as candidate QTL. Finally, a (P = 5.0 * 10 -7 ) threshold value was used to detect significant sites, and it was found that one QTL site was significantly associated with stem tip color, and the physical location of the QTL was (chr12: 1879095-3743995) (P = 5.0 * 10 Figure 1 ).
[0036] After the candidate QTL segments were obtained, the annotated genes in the positioning region were called out for functional annotation in the Ipomoea trifida genome, and finally 18 genes related to anthocyanin synthesis were found in Ipomoea trifida (Table 1). At the same time, combined with the expression pattern of these candidate genes, the genes specifically expressed in the stem tip were screened, and finally the candidate gene itf12g04080 was located in Ipomoea trifida.
[0037] Table 1 Functional annotation of candidate genes
[0038] ID function itf13g04110 Anthocyanidin synthase (ANS, TT18) itf12g03120 Dihydroflavonol 4-reductase (DFR) itf15g02080 UDP-glucosyl transferase 78D2 (UGT78D2) itf03g06880 Flavanone 3-hydroxylase (F3H) itf03g05120 Glutathione S-transferase 26 (GST26, TT19) itf05g04930 Chalcone isomerase (CHI, TT5) itf00g50600 Cinnamate-4-hydroxylase (C4H) itf04g27920 Cinnamate-4-hydroxylase (C4H) itf02g12970 UDP-glucose: flavonoid 3-o-glucosyltransferase (UF3GT) itf09g24500 Cytochrome P450 75B1 (CYP75B1, TT7) itf06g25180 Acetyl-CoA carboxylase 1 (ACC1) itf04g09060 Chalcone synthase (CHS, TT4) itf04g05980 Transparent testa glabra 2 (TTG2, WRKY44) itf12g04080 myb domain protein 113 itf14g18840 bHLH transcription factor 42 (bHLH42, TT8) itf14g18730 bHLH transcription factor 42 (bHLH42, TT8) itf09g24510 Cytochrome P450 75B1 (CYP75B1, TT7) itf07g14140 Cinnamate-4-hydroxylase (C4H)
[0039] In order to further confirm the candidate gene controlling the color of sweet potato stem tip, the present application selects four kinds of purple stem tip sweet potato Australia purple white, watermelon red, Xu shu 32, and three kinds of green stem tip sweet potato Guangcaishu No. 10, Shu green No. 1, Qi Xu 37 to analyze the expression pattern of the candidate gene. First, these varieties are sampled from the unexpanded leaf to the fifth expanded leaf, a total of 6 leaf blades, and then the anthocyanin in each leaf blade is extracted by using organic solvent extraction method.
[0040] The anthocyanin of sweet potato leaf is extracted by using organic solvent extraction method, and the specific operation is as follows:
[0041] (1) Prepare 1% hydrochloric acid methanol solution, respectively, use a measuring cylinder to take 99mL methanol (Xilong 67-56-1) and 1mL hydrochloric acid (Guo Yao 7647-01-0), then mix the two in a glass bottle.
[0042] (2) Take three fresh plant tissues (tobacco leaves) and mix them as one biological repeat, and then put them in liquid nitrogen for quick freezing. Each test sample needs to be tested for three biological repeats.
[0043] (3) Put the test sample into the sample grinder (Shanghai Jingxin Tissuelyser-64), adjust the vibration frequency to 50 HZ, and grind the tissue for 120 seconds to fully grind the tissue. Then weigh 0.2g of powdered sample and pour it into a 2mL centrifuge tube.
[0044] (4) Add 1mL of 1% hydrochloric acid methanol to the centrifuge tube and store it at 4°C in the dark overnight. Shake during the period to fully extract. Set up a blank control without adding plant tissue sample and only adding 1mL of 1% hydrochloric acid methanol.
[0045] (5) The blank control and plant samples in (4) were placed in a centrifuge (Eppendorf SHPZ5424R) with a temperature of 4 °C and a speed of 12000 rpm, and centrifuged for 5 min. After centrifugation, 500 μL of supernatant was taken into a new centrifuge tube, 300 μL of chloroform (Guo Yao 8301-54-5) and 500 μL of ddH2O were added, and mixed to remove chlorophyll.
[0046] (6) The blank control and plant samples in (5) were placed in a centrifuge with a temperature of 4 °C and a speed of 12000 rpm, and centrifuged for 5 min. After centrifugation, 200 μL of supernatant (aqueous phase) was taken for anthocyanin content determination.
[0047] (7) The absorbance values of the samples and the blank control were measured at 530 nm and 657 nm using an enzyme marker (Thermo, Varioskan TMLUX).
[0048] (8) The relative content of anthocyanin was calculated using the following formula: Anthocyanin content = (OD 530 -0.25 x OD 657 ) / m; where OD 530 is the optical density of anthocyanin at 530 nm wavelength; OD 657 is the optical density of chlorophyll at 657 nm wavelength (Note: m: sample mass, unit g, set three biological replicates, each group was measured 3 times).
[0049] It was found that in purple stem tip sweet potato varieties, the anthocyanin content from the unexpanded leaves to the fifth expanded leaves showed a gradual decreasing trend, and the anthocyanin content in the third or fourth leaf showed a significant decrease (a, b, c, d); in green stem tip seedlings, the anthocyanin content in each part was low, and there was no obvious change trend (e, f, g). Figure 2 Figure 2
[0050] Further qRT-PCR analysis of Itf12g04080 expression in the 8 sweet potato stem tips was carried out, the specific steps were as follows:
[0051] 1) The polysaccharide polyphenol plant total RNA extraction reagent (TIANGEN, DP441) was used to extract sweet potato stem tip RNA, and the specific extraction steps were the same as the product instruction. The extracted RNA was measured for concentration using a Nanophotometer N60 Touch microspectrophotometer, and the integrity of the RNA was detected by agarose gel electrophoresis.
[0052] 2) cDNA synthesis. The qualified RNA extracted in step (1) was reverse transcribed using the reverse transcription kit HiScript II QRT Super Mix for qPCR (Vazyme, R222), and the obtained cDNA was used for IbPSST2 gene real-time fluorescence quantitative (qRT-PCR) analysis. The reverse transcription system and reaction conditions were the same as the product instructions. All the cDNAs obtained by reverse transcription were stored at -80°C.
[0053] 3) qRT-PCR experiment. According to the full-length CDS sequence of IbPSST2, gene-specific qRT-PCR primers IbPSST2_RT-F / R were designed. qRT-PCR experiment was carried out with cDNA as template.
[0054] The sequences of primers IbPSST2_RT-F / R are as follows:
[0055] IbPSST2_RT-F: 5'-CCTTCGCCTTCGGGATTGAT-3'; SEQ ID NO. 3;
[0056] IbPSST2_RT-R: 5'-GATGCCATTTCCCTTCCCCA-3'; SEQ ID NO. 4.
[0057] qRT-PCR reaction system: total volume 15 μL, of which cDNA template 1.5 μL, forward and reverse primers each 0.75 μL, 2 χ chamQ SYBR Master Mix (Vazyme, Q311) 7.5 μL, ddH2O 4.5 μL (primers were synthesized in General Biological Systems (Anhui) Co., Ltd.). qRT-PCR reaction program: 95°C pre-denaturation for 30 seconds, 95°C for 10 seconds, 60°C for 30 seconds for 40 cycles, and melting curve was made (qRT-PCR reaction instrument was BIO-RAD CFX Connect Real-Time System). After obtaining the data, the relative expression of the gene was calculated by 2 TM method. –∆∆Ct
[0058] The results showed that the expression pattern of Itf12g04080 was relatively close to the change of anthocyanin content in four varieties, especially the expression pattern of Itf12g04080 was basically consistent with the change trend of anthocyanin content in Australian purple white and Xushu 32 (a-h). In green stem tip sweet potato, the expression pattern of Itf12g04080 was not consistent with the change trend of anthocyanin in sweet potato stem tip (i). Figure 3 Figure 3 i-n). According to this, the applicant believes that Itf12g04080 is a major gene regulating the color of sweet potato stem tips, and Itf12g04080 is named IbPSST2 (Purple Sweetpotato Stem Tips 2).
[0059] Example 2 Cloning of IbPSST2 gene
[0060] 1) RNA extraction and cDNA synthesis
[0061] (1) Total RNA was extracted from sweet potato stem tips using polysaccharide polyphenol plant total RNA extraction reagent (TIANGEN, DP441), and the specific extraction steps were the same as the product instruction. The concentration of the extracted RNA was measured using a Nanophotometer N60 Touch microspectrophotometer, and the integrity of the RNA was detected by agarose gel electrophoresis.
[0062] (2) cDNA synthesis. The qualified RNA obtained in step (1) was reverse transcribed using reverse transcription kit HiScriptIII 1 st Strand cDNA Synthesis Kit (+gDNAwiper) (Vazyme, R312), and the obtained cDNA was used for IbPSST2 gene CDS amplification. The reverse transcription system and reaction conditions were the same as the product instruction. All the cDNAs obtained by reverse transcription were stored at -80°C.
[0063] In the Sweetpotato Genomic Source (http: / / sweetpotato.plantbiology.msu.edu / ) website, the nucleotide sequence of IbPSST2 gene was further obtained by searching the genome sequence of Ipomoea trifida, a wild relative of sweet potato, with Itf12g04080 as ID. PCR primers IbPSST2-F / R were designed to amplify the full-length CDS of the gene, and the cDNA of purple stem tip sweet potato Xu32 was used as the template for PCR amplification.
[0064] The sequences of primers IbPSST2-F / R are as follows:
[0065] IbPSST2-F: 5'-ATGGTTAATTCATTATCATCTGCATGG-3'; SEQ ID NO. 5;
[0066] IbPSST2-R: 5'-TTAGCTTAGAAGTTCCAAAAGGTCA-3'; SEQ ID NO. 6.
[0067] PCR reaction system total volume 20 μL: 2 × PrimeSTAR Max Premix (PrimeSTAR Max DNA Polymerase, TAKARA) 12.5 μL, 0.5 μL of each forward and reverse primer, 1.0 μL of cDNA template (about 100 ng / μL), ddH2O to 20 μL (primers are synthesized in General Biosystems (Anhui) Co., Ltd.). The PCR reaction program is: 98℃ denaturation for 10 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 60 seconds, 35 cycles, and after the reaction, 4℃ storage. The PCR product was detected by gel electrophoresis: the PCR product was electrophoresed for 30 min at 100-120V with 1% agarose added with EB (ethidium bromide) on the gel imaging system (Bio-RAD ChemiDOC TM XR). The results prove that the CDS of IbPSST2 gene is 789 bp. The gel block at the position of the target fragment is cut off, and the agarose gel DNA recovery kit (TIANgel Midi Purification Kit) is used for recovery (the operation steps are the same as the product manual). The recovered fragment is cloned into the full-size T vector (pEASY-Blunt Simple Cloning Kit) (the ligation steps are the same as the product manual). The obtained clone is positively identified by conventional colony PCR (2 × Taq Master Mix) detection, and the positive colonies are subjected to plasmid extraction (Tiangen plasmid extraction kit), and all operation steps are the same as the product manual. The positive plasmid is sent to General Biosystems (Anhui) Co., Ltd. for sequence determination. The CDS sequence of IbPSST2 gene is finally obtained as shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.
[0068] Example 3 IbPSST2 gene is applied to promote the accumulation of anthocyanins in tobacco leaves
[0069] The diploid wild type Nicotiana benthamiana used in the application is stored in Jiangsu Normal University. The specific planting method is as follows: sterile nutrient soil is placed in a pot and fully watered, covered with plastic wrap after sowing and leaving air holes, and placed in a culture box or greenhouse, with a culture condition of 20-24℃, relative humidity 50%, light 16 h / dark 8 h. After the seedlings grow two true leaves, they are transplanted to individual pots (according to the ratio of nutrient soil, vermiculite, perlite 5:1:1) for culture, with a culture condition of 20-24℃, relative humidity 50%, light 16 h / dark 8 h. Periodic watering and pest control are carried out during the period, and the subsequent transient infection experiment can be carried out after the tobacco grows to six to eight leaf stage (about 4 weeks).
[0070] 1) According to the pGreenII62-SK vector (schematic diagram is shown inFigure 4 ) Sequence, IbPSST2 gene primer IbPSST2_62sk-F / R containing homologous recombination linker was designed for vector construction, and T vector fusion plasmid containing IbPSST2 gene was used as template, high-fidelity DNA polymerase (PrimeSTAR Max DNA Polymerase, TAKARA) was used for PCR amplification.
[0071] The sequence of primer IbPSST2_62sk-F / R is as follows:
[0072] IbPSST2_62sk-F:
[0073] 5’- gccgctctagaactagtggatcc ATGGTTAATTCATTATCATCTGCATGG-3’; SEQ ID NO. 7;
[0074] IbPSST2_62sk-R:
[0075] 5’- ttggtaccgggccccccctcgag TTAGCTTAGAAGTTCCAAAAGGTCA-3’; SEQ ID NO. 8;
[0076] The underlined lowercase letters in the primer are linker sequences.
[0077] 2) The amplification product was subjected to agarose gel electrophoresis, gel recovery, fragment recovery, and homologous recombination with the linearized pGreenII62-SK vector digested with restriction enzyme (T4 DNA ligase, Promega) to construct the IbPSST2 gene expression vector pGreenII62-SK-IbPSST2. Figure 5). The pGreenII62-SK vector was linearized by restriction enzymes Bam HI (NEB, R0136V) and Xho I (NEB, R0146V) according to the product manual, and the enzyme reaction system was as follows: pGreenII62-SK plasmid 3-5 μg, 10×NEB buffer 5 μL, restriction enzymes 2 μL each, and ddH2O to 50 μL; the enzyme reaction program was 37 °C for 12 h. The linearized pGreenII62-SK vector was obtained by agarose gel electrophoresis detection, gel recovery, and fragment recovery from the above-mentioned enzyme digestion product and was used for homologous recombination. The homologous recombination (ClonExpress II One Step Cloning Kit, Vazyme, C112) was carried out according to the product manual, and the reaction system was as follows: linearized vector 70 ng, insert fragment about 32 ng, 5×CE II buffer 4 μL, homologous recombination enzyme 2 μL, and ddH2O to 20 μL; the reaction program was 37 °C for 30 min. The obtained ligation product was transformed into E. coli DH5α (TOLOBIO, CC96102) by heat shock transformation, and after transformation, the plate was incubated at 37 °C overnight until single colonies were grown. The single colonies were identified by PCR using gene-specific primers IbPSST2-F / R, and the positive single colonies identified were subjected to shaking culture and plasmid extraction. The plasmid was sequenced, and the plasmid with correct sequencing was transformed into Agrobacterium GV3101 (pSoup-p19) (TOLOBIO, CC96303) by heat shock transformation.
[0078] 3) The Agrobacterium containing the fusion plasmid was streaked on YEP (Qingdao Haibo HB8474) solid medium containing 50 mg / L Kan and 25 mg / L rifampicin, and incubated at 28 °C for 48 h. The single colonies grown were subjected to small shaking culture (2 mL YEP liquid medium containing 50 mg / L Kan and 25 mg / L rifampicin, 28 °C, 250 r / min shaking culture overnight (OD 600 value about 1.0)) and large shaking culture (1:100 by volume, i.e., 500 μL small shaking culture liquid was inoculated into 50 mL fresh YEP liquid medium containing 50 mg / L Kan and 25 mg / L rifampicin, and incubated at 28 °C, 250 r / min for about 12 h until the OD 600Value reaches 0.8 to 1.0) expansion, followed by suspension treatment, ready for transient infection. Suspension treatment method is as follows: IM suspension (10 mM MgCl2 (Guo Yao 10012818), 10 mM MES (Suolai Bao M8010-10) is configured to 500 mL of sterile water, adjust pH to 5.6, finally add 100 μM acetyl syringe ketone (Suolai Bao M8110-1)); the resulting bacteria 5000 r / min centrifugation 5 min, discard the supernatant, resuspend the bacteria with 10 mL IM suspension, centrifuge again and keep the bacterial pellet; dilute the bacteria with IM suspension to OD 600 In the range of 0.6-0.8, after suspension, incubate in 28℃ incubator for 2-3 h.
[0079] 4) Transient infection experiment selects 6 to 8 leaf stage and good growth state diploid wild type Benin tobacco leaves for injection. The infection method is: the bacterial solution containing pGreenII62-SK::IbPSST2 plasmid (OD 600 =0.8) is injected in one half of the leaf; the other half of the leaf is injected with pGreenII62-SK empty bacterial solution (OD 600 =0.8). The injection method is: first use the needle to puncture the place where injection is needed, then use the syringe without needle to inject the bacterial solution into the leaf until the half leaf is filled. After the infection is completed, the tobacco is placed in 25℃ for 12 h dark treatment, then cultured under 16 h light / 8 h dark conditions for about a week before observing the phenotype.
[0080] 5) The leaves showing phenotype (the half tobacco leaf injected with pGreenII62-SK::IbPSST2 bacterial solution presents purple color, and the half tobacco leaf injected with pGreenII62-SK empty vector is still green) (a), are sampled using a puncher with a diameter of 1 cm. Part of the samples are subjected to RNA extraction, and the expression amount of IbPSST2 is detected by qRT-PCR (b), and part of the samples are subjected to anthocyanin content determination (c). Figure 6 a), are sampled using a puncher with a diameter of 1 cm. Part of the samples are subjected to RNA extraction, and the expression amount of IbPSST2 is detected by qRT-PCR (b), and part of the samples are subjected to anthocyanin content determination (c). Figure 6 c). Figure 6
[0081] Example 4 IbPSST2 gene is applied to promote the accumulation of anthocyanin in sweet potato root system
[0082] 1) The transgenic sweet potato recipient material Xu Zishu No. 8 is stored in Jiangsu Normal University. The tuber of Xu Zishu No. 8 is buried in nutrient soil and placed at room temperature to germinate. After a week, when the seedlings grow out, they are moved to a plant culture room with a temperature of 30℃ and a relative humidity of 50%, and cultured under light for 16 hours / dark for 8 hours for about 2-4 weeks, until the length of the aboveground part is about 30 cm.
[0083] 2) pCAMV35s::DsRed vector reference: Yu, Y., Xuan, Y., Bian, X., Zhang, L., Pan, Z., Kou, M., Cao, Q., Tang, Z., Li, Q., Ma, D., Li, Z., Sun, J., 2020. Overexpression of phosphatidylserine synthase IbPSS1 affords cellular Na(+)homeostasis and salt tolerance by activating plasma membrane Na(+) / H(+)antiport activity in sweet potato roots. Hortic Res 7, 131.
[0084] Based on the pCAMV35s::DsRed vector (see graph) Figure 7 The IbPSST2 gene primer IbPSST2_TNRT-F / R containing the homologous recombination adapter was designed for vector construction. The T vector fusion plasmid containing the IbPSST2 gene was used as a template, and high-fidelity DNA polymerase was selected for PCR amplification.
[0085] The primer IbPSST2_TNRT-F / R sequence is as follows:
[0086] IbPSST2_TNRT-F:
[0087] 5'- cttcactgttgatacacgcgt ATGGTTAATTCATTATCATCTGCATGG-3'; SEQ ID NO.9;
[0088] IbPSST2_TNRT-R:
[0089] 5'- tgttgattcagaattgtcgac TTAGCTTAGAAGTTCCAAAAGGTCA-3'; SEQ ID NO. 10.
[0090] The underlined lowercase letters in the primers are the linker sequences.
[0091] 3) The amplified products were subjected to agarose gel electrophoresis, gel excision and fragment recovery, and then homologous recombination was performed with the enzyme-digested linearized pCAMV35s::DsRed vector. Figure 8). The pCAMV35s::DsRed vector was linearized by restriction endonuclease Mlu I (NEB, R3198V) and Sal I (NEB, R0138V) according to the product manual. The enzyme cutting system was as follows: 3-5 μg of pCAMV35s::DsRed plasmid, 5 μL of 10×NEB buffer, 2 μL of each restriction endonuclease, and ddH2O to 50 μL. The enzyme cutting reaction program was as follows: 37°C, 12 hours. The linearized pCAMV35s::DsRed vector was obtained by agarose gel electrophoresis detection, gel recovery, and fragment recovery of the above-mentioned enzyme cutting product, and was used for homologous recombination. The homologous recombination was strictly performed according to the product manual. The reaction system was as follows: 192 ng of linearized vector, about 32 ng of insertion fragment, 4 μL of 5×CE II buffer, 2 μL of homologous recombination enzyme, and ddH2O to 20 μL. The reaction program was as follows: 37°C, 30 minutes. The obtained ligation product was transformed into Escherichia coli DH5α by heat shock transformation. After transformation, the plate was cultured at 37°C for overnight to grow single colonies. The single colonies were identified by PCR using gene-specific primers IbPSST2-F / R. The positive single colonies identified were subjected to shake culture, and the plasmid pCAMV35s::DsRed-IbPSST2 was extracted. The plasmid was sequenced, and the plasmid with correct sequencing was transformed into Agrobacterium rhizogenes K599 (Weidi Biology, AC1080) by heat shock transformation.
[0092] 4) The Agrobacterium rhizogenes containing the fusion plasmid was streaked on TY solid medium (yeast powder (Solarbio, LP0021) 3 g / L, peptone (Solarbio, LP0042) 5 g / L, CaCl2 (Shanghai National Pharmaceutical, 10005861) 10 mmol / L, agarose (Solarbio, NO.A8200) 15 g / L, containing 50 mg / L Kan) and inverted in a 28°C incubator for 48 hours. The single colonies grown were subjected to small shaking (positive monoclonal Agrobacterium was picked into 2 mL of TY liquid medium (containing 50 mg / L Kan) and cultured at 28°C at 250 r / min for overnight (OD 600 value of about 1.0), large shaking (large shaking was performed at a volume ratio of 1:100, that is, 500 μL of small shaking bacterial liquid was inoculated into 50 mL of fresh TY liquid medium (containing 50 mg / L Kan) and cultured at 28°C at 250 r / min for about 12 hours until the OD 600 value reached 0.8 to 1.0), and then was subjected to suspension treatment for ready-to-use transient infection. The suspension treatment method was the same as step 3) of Example 3.
[0093] 5) Cut the seedlings of 8# purple-fleshed sweet potato with about 15 cm length (need to keep 2-3 leaves, including 2-3 internodes), inject the bacterial liquid (OD 600 = 0.8) with fusion plasmid and the bacterial liquid (OD 600 = 0.8) with empty vector into the internodes of the seedlings respectively with 1 mL syringe. After injection, the seedlings were placed at room temperature for 1 hour, then cut into the nutrient soil, and cultured at room temperature for about one month under 16 h light / 8 h dark condition.
[0094] 6) Dig out the injected seedlings from the soil, wash the root system with tap water, and observe whether the roots emit fluorescence under red fluorescence. The roots emitting fluorescence are the transgenic positive roots (d, e). The wild type root system CK (purple skin and white heart) and the transgenic positive roots were longitudinally and transversely cut, and the anthocyanin accumulation of the roots was observed under optical microscope (Olympus CX43) (g-j). Figure 6 Figure 6 g-j).
[0095] 7) Extract RNA from the transgenic positive roots, and detect the expression of IbPSST2 by qRT-PCR (f), and determine the anthocyanin content of a part of the samples (k). Figure 6 Figure 6 k).
[0096] Overexpression of IbPSST2 gene in tobacco and sweet potato root system was carried out, and it was found that IbPSST2 could significantly promote the accumulation of anthocyanin in tobacco leaves and sweet potato roots compared with the control. The gene can be used for genetic improvement of the color of sweet potato stem tip.
[0097] The above description of disclosed embodiments enables one skilled in the art to make or use the present application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Thus, the present application is not to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Ipomoea batatas IbPSST2 a gene characterized in that, The nucleotide sequence thereof is shown as SEQ ID NO.
1.
2. The sweet potato of claim 1 IbPSST2 A protein encoded by the gene, characterized in that, The amino acid sequence thereof is shown as SEQ ID NO.
2.
3. The sweet potato of claim 1 IbPSST2 Use of the gene in promoting anthocyanin synthesis in tobacco or sweet potato.
4. A recombinant expression vector pGreenll 62-SK: IbPSST2 characterized in that, Sweet potato containing the gene of claim 1 IbPSST2 gene.
5. A recombinant bacterium I, characterized in that, The recombinant expression vector pGreenll 62-SK of claim 4: IbPSST2 .
6. The sweet potato of claim 1 IbPSST2 the recombinant expression vector pGreenll 62-SK of claim 4: IbPSST2 or the use of the recombinant bacteria I of claim 5 in promoting the accumulation of anthocyanins in tobacco leaves.
7. A recombinant expression vector pCAMV35s::DsRed- IbPSST2 characterized in that, Sweet potato containing the gene of claim 1 IbPSST2 gene.
8. A recombinant bacterium II, characterized in that, The recombinant expression vector pCAMV35s::DsRed according to claim 7 IbPSST2 .
9. The sweet potato of claim 1 IbPSST2 the recombinant expression vector pCAMV35s::DsRed of claim 7 IbPSST2 IbPSST2 or the use of the recombinant bacteria II of claim 8 in promoting the accumulation of anthocyanins in the root system of sweet potato.