A SLAH1 gene of Vigna serrata root system and its application

Abstract

This invention is the first to clone the SLAH1 gene from the root system of cowpea. Studies show that this gene can significantly enhance the plant's tolerance to stresses such as high salt content, promote plant growth, increase root length, increase plant biomass, enhance photosynthetic rate and relative chlorophyll content, and reduce electrolyte leakage rate and leaf drop rate. Transgenic soybeans with the SLAH1 gene show significantly enhanced salt tolerance, and hold promise for developing salt-tolerant transgenic soybean varieties for cultivation in saline-alkali land. This invention provides a new candidate gene for research on improving plant stress resistance, promoting plant growth, and altering plant phenotypes.

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to the SLAH1 gene in the root system of cowpea and its application. Background Technology

[0002] Saline-alkali land is widely distributed throughout the world and is known as the "skin disease of the earth." With the increasing severity of global climate change and the uneven distribution of water resources, the problem of saline-alkali land has become a significant challenge to the sustainable development of global agriculture. Salt-tolerant legumes, due to their unique salt tolerance, strong soil-improving ability, and versatility, have become key to solving the problem of coastal saline-alkali land.

[0003] Cowpea (scientific name: *Vigna marina* (Burm.) Merr.) is a perennial creeping or climbing herbaceous plant belonging to the genus *Vigna* in the family Leguminosae. Widely distributed in tropical coastal sandy areas, cowpea is a typical coastal halophyte, serving as excellent germplasm for constructing coastal green spaces and preventing wind erosion and sand fixation. It can also be used as food, forage, and green manure for humans. Due to its unique biological characteristics, it can adapt well to high-salt, sandy, arid, and infertile growing environments. Therefore, in-depth research on the stress-resistance regulatory genes of cowpea can not only reveal the regulatory role of cowpea's biological characteristics at the gene level but also identify genes with excellent regulatory functions, providing candidate genes for the improvement of crop varieties and genetic engineering breeding within the same genus or species. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a cowpea root SLAH1 gene and its application.

[0005] The first aspect of the present invention is to provide a root SLAH1 gene of cowpea, the coding region of which is shown in SEQ ID NO:1.

[0006] A second aspect of the present invention is to provide a protein encoded by the SLAH1 gene in the root system of cowpea as described in the first aspect of the present invention.

[0007] A third aspect of the present invention is to provide a recombinant vector containing the coding region of the SLAH1 gene of cowpea root as described in the first aspect of the present invention.

[0008] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is PHB and WMV069, but it should be understood that other plasmids or viruses can also be used.

[0009] Preferably, the original vector of the recombinant vector is a PHB expression vector, and the coding region of the SLAH1 gene of cowpea root is located between the BamHI and PstI restriction endonuclease sites of the PHB expression vector.

[0010] Preferably, the original vector of the recombinant vector is the WMV069 expression vector, and the coding region of the SLAH1 gene of cowpea root is located between the BamHI and SpeI restriction endonuclease sites of the WMV069 expression vector.

[0011] A fourth aspect of the invention is to provide a host bacterium containing the coding region of the SLAH1 gene of cowpea roots as described in the first aspect.

[0012] A fifth aspect of the present invention is to provide an expression cassette containing the coding region of the SLAH1 gene from cowpea roots as described in the first aspect of the present invention.

[0013] The sixth aspect of the present invention is to provide the application of the SLAH1 gene of cowpea root as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving plant salt tolerance.

[0014] The seventh aspect of the present invention is to provide the use of the SLAH1 gene of cowpea root as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in promoting plant growth.

[0015] The eighth aspect of the present invention is to provide the use of the SLAH1 gene of cowpea root as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing plant root length and / or increasing relative chlorophyll content and / or reducing electrolyte extravasation.

[0016] In one specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0017] The ninth aspect of the present invention is to provide the SLAH1 gene of cowpea roots as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention, in order to improve plant growth vigor and / or increase plant height, and / or increase plant biomass, and / or increase photosynthetic rate, and / or increase relative chlorophyll content, and / or reduce electrolyte leakage rate, and / or reduce leaf drop rate, and / or reduce Na+ in plant stems and leaves. + and Cl - Content and / or enhancement of Ca in plant leaves 2+ Application of content.

[0018] In one specific embodiment of the present invention, the plant is soybean.

[0019] A tenth aspect of the present invention is to provide a primer pair, wherein the primer pair is F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG; or the primer pair is F':TATCAGAGATTGGCAGGGAACA and R':ACCAGGGACATGAAAAGGAAG.

[0020] This invention is the first to clone the SLAH1 gene from the root system of cowpea. Studies show that this gene can significantly improve the plant's survival ability under stresses such as high salt content, promote plant growth, increase root length, increase plant biomass, enhance photosynthetic rate and relative chlorophyll content, reduce electrolyte leakage rate, and reduce leaf drop rate. Transgenic soybeans with the SLAH1 gene show significantly enhanced salt tolerance, and hold promise for developing salt-tolerant transgenic soybean varieties for cultivation in saline-alkali land. This invention provides a new candidate gene for research on improving plant stress resistance, promoting plant growth, and altering plant phenotypes. Attached Figure Description

[0021] Figure 1 Phenotypic characteristics, root length, relative chlorophyll content, and electrolyte leakage rate of SLAH1 Arabidopsis thaliana after 6 days of treatment with 200 mM NaCl were determined. WT represented wild-type Arabidopsis, and lines 1-3 represented three plant types of SLAH1 transgenic Arabidopsis. The control group was grown under normal conditions.

[0022] Figure 2 The spectrum is for the empty vector of WMV069.

[0023] Figure 3 Phenotypic characteristics, photosynthetic rate, relative chlorophyll content, and electrolyte leakage rate were determined in SLAH1 soybeans after treatment with 200 mM NaCl for 12 days. JACK was a soybean variety transformed with an empty vector. The control group was grown under normal conditions.

[0024] Figure 4 After treating SLAH1 soybeans with 200mM NaCl for 12 days, the Na content in the roots, stems, and leaves was... + Cl - , Ca 2+ Content. JACK is a soybean variety transformed with an empty vector. CK represents normal cultivation conditions, and T represents treatment with 200 mM NaCl.

[0025] Figure 5 The fresh weight and leaf drop rate of SLAH1 soybean plants after 12 days of treatment with 200 mM NaCl were statistically analyzed. JACK is a soybean variety transformed with an empty vector. The control group was grown under normal conditions. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0027] Example 1: Cloning of the SLAH1 gene

[0028] The germplasm of *Cowpea* was collected from the seaside of Gancheng Town, Dongfang City, Hainan Province, at longitude 108.634°, latitude 18.867°, and altitude -9.35 meters. Total RNA was extracted from the roots of *Cowpea*, and the first strand of cDNA was obtained by reverse transcription. Using the first strand of cDNA as a template, PCR amplification was performed using primers F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG.

[0029] (1) PCR amplification reaction system:

[0030]

[0031] (2) PCR amplification reaction conditions:

[0032]

[0033] Melting curve:

[0034]

[0035] The amplification product was recovered to obtain the SLAH1 gene from cowpea roots. Sequencing was performed, and the coding region sequence of the SLAH1 gene from cowpea roots is shown in SEQ ID NO:1.

[0036] Example 2: Arabidopsis thaliana transgenic with the SLAH1 gene

[0037] 1. Cultivation of Arabidopsis thaliana

[0038] 1) Preparation of culture medium: MS medium was selected for Arabidopsis thaliana and prepared in advance (pH=5.8).

[0039] 2) Seed disinfection: Add 1 ml of 5% sodium hypochlorite solution (containing 1 drop of Tween) to a 1.5 ml centrifuge tube, invert and mix for 8 minutes, then rinse 5 times with sterile water;

[0040] 3) After sterilizing the seeds, mix them with culture medium at 40-50℃, pour them into a plate, and spread them evenly (about 4-5 ml of culture medium is needed for a small petri dish).

[0041] 4) Seal the petri dishes and vernalize them in a refrigerator at 4℃ for 2-3 days. Then, place them in an artificial climate chamber to begin germination and growth. The plant growth environment is as follows: relative humidity 60%; constant temperature 21-23℃; photoperiod of 16 hours of light followed by 8 hours of darkness; light intensity 80-200 μmol / m². 2 / S;

[0042] 5) Preparation of planting soil: Mix peat moss and vermiculite in a 2:1 ratio and set aside for later use;

[0043] 6) Soaking the soil: Fill the planting pot with soil to about 1cm from the rim, and soak it completely with Flower Perfection compound fertilizer (N, P, K = 20%, 20%, 20%).

[0044] 7) Transplanting: 7-12 days after germination, select healthy seedlings with uniform growth and transplant them into potting soil that has been soaked in Flower Perfection solution beforehand. Cover them with plastic wrap and remove it after the seedlings have survived.

[0045] 8) Cultivate until bolting and flowering.

[0046] 2. SLAH1 gene-positive Agrobacterium

[0047] (1) Construction of recombinant vector

[0048] Total RNA was extracted from the roots of cowpea and reverse transcribed to obtain the first strand of cDNA. Using the first strand of cDNA as a template, and primers F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG, PCR amplification was performed. The reaction system and procedure are as follows:

[0049] PCR system:

[0050]

[0051] Reaction conditions:

[0052]

[0053] The amplification product was recovered to obtain the full-length SLAH1 sequence with BamHI and PstI restriction sites. The empty PHB vector and the full-length SLAH1 sequence with added restriction sites were digested with BamHI and PstI, and the two fragments were ligated. The resulting fragments were transformed into competent E. coli cells, plated on LB agar, and after single colonies grew, positive PCR was performed to obtain the PHB expression vector.

[0054] (2) Culture of Agrobacterium

[0055] Agrobacterium culture medium was LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0 (Note: Add 15 g agar per liter when preparing solid medium).

[0056] Take competent Agrobacterium cells stored at -80℃ and allow them to partially thaw at room temperature or in your hand, then insert them into ice while they are in an ice-water mixture. Add 0.1 μg (no more than 10 μl) of plasmid DNA to each 100 μl of competent cells, mix thoroughly by hand, and incubate sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min. Add 700 μl of antibiotic-free LB broth and incubate at 28℃ with shaking at 200 rpm for 2–3 h. Centrifuge at 6000 rpm for one minute to collect the bacteria, and resuspend approximately 100 μl of the supernatant by gently pipetting and spreading it onto an LB agar plate containing 50 μg / ml kanamycin. Invert the plate and incubate at 28℃ for 2–3 days. Randomly select one single colony for colony PCR, and label the correctly identified Agrobacterium single clone for later use.

[0057] Using a sterile pipette tip, pick up a labeled Agrobacterium single clone and inoculate it into 1.5 ml of LB liquid medium containing the appropriate antibiotic (using a 50 ml blue-cap centrifuge tube). Incubate at 30°C with shaking at 200 rpm for 24 h. Add 1% of the slightly shaken Agrobacterium culture to 100 ml of LB liquid medium containing antibiotic, and incubate at 30°C with shaking until OD600 = approximately 1.0. Centrifuge at 20°C, 4,000 rpm for 15 min and collect the cells. Resuspend the cells in transformation buffer until OD600 = approximately 1.0, and set aside for later use.

[0058]

[0059] 3. Transformation of Arabidopsis thaliana

[0060] Water the plants that are currently bolting and flowering thoroughly one day in advance. Invert the small pot and place all the inflorescences upside down into the bacterial solution that has been suspended in conversion buffer for about 30 seconds. Repeat the conversion process once after 7 days. After 2-3 weeks, reduce the amount of nutrient solution applied to accelerate aging. Collect the mature seeds in paper bags and store them in a desiccator for 7 days.

[0061] 4. Screening of transgenic Arabidopsis thaliana

[0062] 1) Preparation of culture medium: Arabidopsis thaliana culture medium is 1 / 2 MS (0.8% agar powder, sucrose-free, pH 5.8).

[0063] Preparation method for 1 / 2 MS (1 L):

[0064] MS Basal Salt Mixture (Phyto Technology Laboratories#M524): 2.17g

[0065] Murashige and SkoogVitaminpowder(Sigma#M3900): 0.5ml

[0066] Inositol 50mg

[0067] Add water to 1L and adjust the pH to 5.8.

[0068] Add 8g of fat powder and sterilize at 121℃ for 20 minutes.

[0069] 2) Seed disinfection: 70% ethanol for 1 min, add 1 ml of 7% sodium hypochlorite solution (containing 1 drop of Tween) for 10 min, invert and mix for 5 min, and rinse 5 times with sterile water.

[0070] 3) Resuspend the disinfected seeds in 100 μl of sterile water, and use a 1 ml pipette tip to spot them onto a 1 / 2 MS medium plate (the medium contains screening antibiotics: 50 μg / ml KAN or 30 μg / ml HYG or 50 μM Glufosinate-ammonium).

[0071] 4) Seal the petri dishes and vernalize them at 4℃ for 48 hours. Then, place them in an artificial climate chamber to begin germination and growth. The plant growth environment is as follows: relative humidity 60%; constant temperature 20-22℃; photoperiod of 16 hours of light followed by 8 hours of darkness; light intensity 80-200 μmol / M. 2 / S.

[0072] 5) After 8-15 days, observe and use positive PCR testing to distinguish positive transplants into the planting soil.

[0073] Preparation of planting soil: Mix peat moss and vermiculite in a 2:1 ratio and set aside for later use.

[0074] 6) Soaking the soil: Fill the planting pot with soil to about 1cm from the rim, and soak it completely with Flower Perfection compound fertilizer (N, P, K = 20%, 20%, 20%).

[0075] 7) Transplanting: 20 days after germination, select healthy seedlings with uniform growth and transplant them into potting soil that has been soaked in Flower Perfection fertilizer beforehand. Cover them with plastic wrap and remove it after the seedlings have survived.

[0076] 8) Continue culturing according to the culture method of non-transgenic normal Arabidopsis thaliana to obtain transgenic Arabidopsis thaliana seeds.

[0077] 5. Salt tolerance test

[0078] Transgenic Arabidopsis seeds germinated on a medium containing hygromycin and 200 mM NaCl, with wild-type Arabidopsis as a control (WT). Results were observed after 6 days. Figure 1 As shown, under 200 mM NaCl treatment, the root length, relative chlorophyll content, and photosynthetic rate of transgenic Arabidopsis thaliana were significantly higher than those of the control, while the electrolyte leakage rate was significantly lower, indicating that the salt tolerance of transgenic Arabidopsis thaliana was significantly better than that of the control. Under normal cultivation conditions, the root length of transgenic Arabidopsis thaliana and the control group increased significantly, while there was no significant difference in photosynthetic rate and electrolyte leakage rate.

[0079] Method for determining the relative chlorophyll content: The SPAD value of chlorophyll content was measured using a TYS-B chlorophyll meter (Zhejiang Top Company). The measurement was performed on healthy and mature leaves from the upper part of the plant.

[0080] Electrolyte extravasation rate determination method: Following Zou Qi's method (2004), the conductivity method was adopted and improved. 20 ml of deionized water was added to a 50 ml centrifuge tube, and the initial conductivity E0 (S0 < 0.4) was measured. Healthy and mature leaves were randomly cut from the upper part of the plant, washed with distilled water, and dried with absorbent paper. 0.5 g of each leaf was accurately weighed, cut into 1 cm segments, and placed in a test tube with the measured initial conductivity. The tube was shaken for 24 hours, and then the conductivity value E1 was measured using a DDS-320 digital conductivity meter (manufactured by Shanghai Dapu Instrument Co., Ltd.). The test tube was then sealed and placed in a boiling water bath for 30 minutes to kill the plant tissue. After removing the test tube, it was cooled to room temperature with tap water, shaken well, and the conductivity value E2 was measured using a conductivity meter. The relative conductivity was calculated using the formula EL(%) = (E1 - E0 / E2 - E0) × 100%.

[0081] Example 3: Transgenic SLAH1 soybean

[0082] 1. SLAH1 gene-positive Agrobacterium

[0083] (1) Construction of recombinant vector

[0084] Total RNA was extracted from the roots of cowpea and reverse transcribed to obtain the first strand of cDNA. Using the first strand of cDNA as a template, and primers F':TATCAGAGATTGGCAGGGAACA and R':ACCAGGGACATGAAAAGGAAG, PCR amplification was performed.

[0085] PCR reaction 50μm system:

[0086]

[0087] The reaction procedure is as follows:

[0088] The PCR instrument runs the following series of reactions

[0089]

[0090] The amplification product was recovered to obtain the full-length SLAH1 sequence with BamHI and SpeI restriction sites. The empty WMV069 vector and the full-length SLAH1 sequence with added restriction sites were digested with BamHI and SpeI, and the two fragments were ligated. The resulting fragments were transformed into competent E. coli cells, plated on LB agar, and after single colonies grew, positive PCR was performed to obtain the WMV069 expression vector.

[0091] The WMV069 empty vector was modified from the PCAMBIA3300 vector by Weimi Biotechnology Co., Ltd. The spectrum of the WMV069 empty vector is shown below. Figure 2 As shown.

[0092] (2) Culture of Agrobacterium

[0093] 1) Add 20 μl Agrobacterium (EHA105-WM) + 1 μl recombinant plasmid, incubate on ice for 5 min, flash freeze in liquid nitrogen for 5 min, incubate in water at 37℃ for 5 min, and incubate on ice for 5 min. Add 100 μl of antibiotic-free LB, shake at 200 rpm for 2 h at 28℃, and directly plate onto a plate containing the corresponding bacterial antibiotic + rifampin, and incubate at 28℃ for 2 days.

[0094] 2) Pick a single clone of bacteria and shake it:

[0095] Two days later, select one monoclonal antibody and place it in a 5ml sterile EP tube. Add 2ml of the corresponding bacterial antibiotic and rifampin beforehand, and shake overnight.

[0096] 3) Preservation of glycerol bacteria: 400 μl of bacterial culture + 100 μl of 75% sterile glycerol, label properly, and store at -70℃. Extract plasmid from the remaining bacterial culture and transform it into E. coli (1 μl of plasmid + 20 μl of competent E. coli cells, incubate on ice for 30 min, heat shock at 42℃ for 35 s, incubate on ice for 2 min, add 100 μl of antibiotic-free LB, shake at 37℃ and 200 rpm for 1 h, plate, add LB and corresponding bacterial antibiotic, and incubate at 37℃ for 1 day).

[0097] 4) Select a single clone, shake the culture in the morning, and send the culture directly for sequencing in the evening, selecting a portion for sequencing.

[0098] 5) If the sequencing feedback is correct and the Agrobacterium is verified to be working properly, the prepared Agrobacterium can be used for subsequent transformation experiments.

[0099] 2. Genetic transformation

[0100] Using soybean cultivar JACK, which had germinated for 1 day, as material, explants were placed in petri dishes containing 50 ml of Agrobacterium suspension. Approximately 150 explants were treated within 2 hours and incubated at room temperature for 30 minutes for infection. After infection, the Agrobacterium suspension was discarded, and the explants were placed in a co-culture medium and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to resting medium and cultured in light at 25°C for 7 days. Then, they were placed on the appropriate resistance selection medium and cultured for three weeks to induce resistant shoots. These shoots were then transferred to the appropriate resistance elongation medium and cultured in light for 6-9 weeks. The regenerated seedlings were then subjected to rooting culture.

[0101] After transplanting into seedling trays, gene testing was performed on T0 plants, yielding positive plants. These positive plants exhibited significantly higher growth vigor and biomass than the control. Primers: Bar-F1: CCATCGTCAACCACTACATCGAGACA and Bar-R1: CTTCAGCAGGTGGGTGTAGAGCGT, amplifying a size of 269 bp. The reaction mixture (20 μl) consisted of: 10 μl 2*PCR buffer, 7 μl H2O, 1 μl upstream primer (10 μM), 1 μl downstream primer (10 μM), and 1 μl DNA. The reaction procedure was as follows:

[0102]

[0103]

[0104] 3. Salt tolerance test

[0105] After transgenic soybean seedlings were cultured to the T2 generation, one-month-old transgenic soybean seedlings grown in sand culture were used as a control. The seedlings were then irrigated with Hongland nutrient solution (control) and Hongland nutrient solution containing 200 mM NaCl, respectively, once daily. Soybean seedlings transformed with an empty vector served as a blank control (JACK). Results were observed after 12 days. Figure 3 and Figure 4 , Figure 5 As shown ( Figure 3 All the potted plants in the image above were watered with Hongland nutrient solution containing 200mM NaCl. The first pot on the left is the control (soybeans transformed with an empty vector), and the second to fourth pots on the left are SALH1 soybeans. Under salt treatment, the transgenic soybean seedlings showed significantly higher growth vigor, plant height, and biomass than those transformed with an empty vector, significantly lower leaf drop rate than the control, significantly higher photosynthetic rate and relative chlorophyll content than the control, and significantly lower electrolyte leakage rate than those transformed with an empty vector. NaCl in the stems and leaves... + Cl - The content of all samples was significantly lower than that of soybeans transformed with empty vectors, and the leaf Ca content was also significantly lower. 2+ The content was significantly higher than that of soybeans converted from empty vectors ( Figure 4 (Group T in the text). This indicates that the salt tolerance of soybeans transgenic with the SLAH1 gene is significantly enhanced, and it is expected to be used to develop salt-tolerant transgenic soybean varieties. Under normal cultivation conditions (control), neither the empty vector-transformed soybeans nor the CML37 transgenic soybeans showed leaf blight, i.e., the leaf blight rate was 0; the relative chlorophyll content, relative water content, and leaf blight rate did not differ significantly. Under normal cultivation conditions, the Na+ content in soybean roots, stems, and leaves... + Cl - The content difference was not significant. Figure 4 (CK group in the text). Under normal cultivation conditions, the fresh weight of SLAH1 transgenic soybeans was significantly higher than that of soybeans transgenic with an empty vector.

[0106] Photosynthetic rate measurement method: The net photosynthetic rate (Pn, μmol·CO2 m) of leaves was measured using a Li-6400 XT photosynthesis system (USA). -2 s -1 The photosynthesis measurement parameters were set as follows: CO2 concentration 400 μmol·mol⁻¹ -1 The flow rate was 400 μmol·s. -1 The light intensity is 1000 μmol·m -2 s -1 The leaves measured were randomly selected from the upper part of the plant, showing healthy and mature growth.

[0107] The formula for calculating the leaf withering rate is: the percentage of leaves with withering symptoms in 50% of the area out of the total number of leaves (Feng, 2018).

[0108] Method for determining the relative chlorophyll content: The SPAD value of chlorophyll content was measured using a TYS-B chlorophyll meter (Zhejiang Top Company). The measurement was performed on healthy and mature leaves from the upper part of the plant.

[0109] Electrolyte extravasation rate determination method: Following Zou Qi's method (2004), the conductivity method was adopted and improved. 20 ml of deionized water was added to a 50 ml centrifuge tube, and the initial conductivity E0 (S0 < 0.4) was measured. Healthy and mature leaves were randomly cut from the upper part of the plant, washed with distilled water, and dried with absorbent paper. 0.5 g of each leaf was accurately weighed, cut into 1 cm segments, and placed in a test tube with the measured initial conductivity. The tube was shaken for 24 hours, and then the conductivity value E1 was measured using a DDS-320 digital conductivity meter (manufactured by Shanghai Dapu Instrument Co., Ltd.). The test tube was then sealed and placed in a boiling water bath for 30 minutes to kill the plant tissue. After removing the test tube, it was cooled to room temperature with tap water, shaken well, and the conductivity value E2 was measured using a conductivity meter. The relative conductivity was calculated using the formula EL(%) = (E1 - E0 / E2 - E0) × 100%.

[0110] Na + , Ca 2+ Content determination method: Microwave digestion-ICP OES method; Cl - Content determination method: Argentometric titration (direct titration).

[0111] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this utility model are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A root system of cowpea SLAH1 Genes, characterized by, Its coding region sequence is shown in SEQ ID NO:

1.

2. The root system of *Cowpea* as described in claim 1 SLAH1 Proteins encoded by genes.

3. Contains the root system of cowpea as described in claim 1 SLAH1 Recombinant vectors, host bacteria, or expression cassettes for gene coding regions.

4. The recombinant vector according to claim 3, characterized in that, The original vector for the recombinant vector was a PHB expression vector, derived from cowpea roots. SLAH1 The gene coding region is located between the BamHI and PstI restriction endonuclease sites in the PHB expression vector.

5. The root system of *Corydalis yanhusuo* as described in claim 1 SLAH1 The application of genes, or proteins as described in claim 2, or recombinant vectors, host bacteria, or expression cassettes as described in claim 3, in improving plant salt tolerance and / or promoting plant growth; wherein the plant is Arabidopsis thaliana and / or soybean.

6. The root system of *Corydalis yanhusuo* as described in claim 1 SLAH1 The application of genes, or proteins as described in claim 2, or recombinant vectors, host bacteria, or expression cassettes as described in claim 3, in increasing root length and / or increasing relative chlorophyll content and / or reducing electrolyte efflux, wherein the plant is Arabidopsis thaliana treated with 200 mM NaCl.

7. The root system of *Corydalis yanhusuo* as described in claim 1 SLAH1 Genes, or proteins as described in claim 2, or recombinant vectors, host bacteria, or expression cassettes as described in claim 3, can improve plant growth vigor and / or increase plant height, and / or increase plant biomass, and / or enhance photosynthetic rate, and / or increase relative chlorophyll content, and / or reduce electrolyte leakage rate, and / or reduce leaf drop rate, and / or reduce Na+ in plant stems and leaves. + and Cl - Content and / or enhancement of Ca in plant leaves 2+ The plant in question is soybean treated with 200 mM NaCl.

Images