Brevibacillus brevis genome traceless editing method based on reverse selection marker pheS* and application of brevibacillus brevis genome traceless editing method

Abstract

The invention discloses a genome traceless editing method of brevibacillus brevis based on a pheS * gene as a reverse selection marker and application of the genome traceless editing method. The invention aims to provide a genome traceless editing method established by taking Br. Brevis X23 as a model strain and taking a pheS * gene subjected to site-specific mutagenesis as a reverse selection marker and application of the genome traceless editing method. The invention provides a powerful and convenient genetic operation tool for subsequent basic research and application research in the strain, and promotes the development of metabolic engineering, combinatorial biosynthesis and synthetic biology.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and specifically relates to a soil biocontrol bacterium Bacillus brevis based on pheS * Methods and applications of scarless genome editing. Background Art

[0002] Brevibacillus spp. is one of the most widespread genera of Gram-positive bacteria, able to survive in a variety of environmental habitats, and has excellent properties such as high growth efficiency, easy electroporation transformation, available shuttle vectors, very low extracellular protease activity, and constitutive expression of heterologous proteins, making some strains of this genus excellent model strains and promising for development into a chassis cell with excellent performance.

[0003] Brevibacillus brevis is the producer of the non-ribosomal peptide antibiotic edeines, which has a strong biological control effect on economic crops of the Solanaceae family (such as peppers, tobacco, etc.), and has been effectively verified in pot experiments and field trials.

[0004] The main active substance produced by Bacillus brevis, ivermectin, has a good inhibitory effect on Gram-positive bacteria (such as Bacillus subtilis), Gram-negative bacteria (such as Escherichia coli and Acinetobacter baumannii), fungi (such as Fusarium), mycoplasma and tumor cells, but its wide application is subject to some restrictions due to the existence of certain animal cell toxicity.

[0005] In the previous work, the applicant's team has established a "scarless" gene editing technology based on the combination of Red / ET recombination and site-specific recombination Cre-loxP system in Bacillus brevis X23 strain, but it takes a long time and is not efficient. The biggest problem is that this technology is not truly scarless: after each round of editing, the two specific sites lox71 and lox66 undergo recombination, although the resistance gene between the two sites is eliminated, a "scar" remains - the new lox72 sequence, which generally does not participate in Cre-loxP-mediated recombination, but will greatly interfere with the recognition of specific sites in the next round of editing. Therefore, this technical solution is not suitable for the needs of multiple rounds of genome editing. Summary of the invention

[0006] In order to solve the defects of the prior art, the present invention improves a method for producing a pheS-based reverse screening marker for Bacillus brevis. * A method for scarless genome editing.

[0007] The present invention provides the following technical solutions.

[0008] The invention provides a soil biocontrol bacterium Brevibacillus based on pheS * The method for scarless genome editing using a gene as a reverse selection marker comprises the following steps:

[0009] S1 was constructed by overlapping extension PCR technique 43 Promoter, pheS carrying mutation site * gene and positive screening marker gene, as well as the P43 promoter, pheS * The ribosome binding site SD sequence is introduced between each of the gene and the positive screening marker gene to form a PA gene expression cassette with a core element; the pheS carrying the mutation site * The gene refers to the A309G encoding the protein relative to the PheS protein in the Br. brevis X23 strain;

[0010] S2 used overlap extension PCR technology to construct a target DNA fragment containing the PA gene expression cassette and the homology arms related to the gene to be deleted, called the LDPR fragment. The assembly order was as follows: the LF01 fragment of the 600-2000bp region on the left side of the gene to be deleted, the DR01 fragment of the 500-1200bp region downstream of the gene to be deleted as a direct repeat sequence, the PA expression cassette fragment, and the RF01 fragment of the 600-1000bp region between the genes to be deleted and immediately to the right of the LF01 fragment;

[0011] S3 uses homologous recombination technology to fuse the LDPR fragment with the backbone fragment of the Br.brevis-E.coli shuttle vector pBE194 to obtain the scarless editing plasmid pBE194-LDPR of the gene to be deleted; wherein the backbone fragment of the Br.brevis-E.coli shuttle vector pBE194 is double-digested with BamHI / SpeI or EcoRV / SmaI to double-digest the shuttle vector pBE194 to recover a vector backbone fragment with a length of 4.8 kb;

[0012] S4 electroporated the editing plasmid pBE194-LDPR into Bacillus brevis, and first obtained a transitional strain that was integrated into the target region on the chromosome through resistance screening. Then, the reagent p-Cl-Phe was used for reverse screening to obtain a target strain that deleted the target gene region on the chromosome and eliminated the plasmid sequence, thus achieving truly thorough and traceless editing on the X23 genome.

[0013] Specifically, the positive selection marker gene is an apramycin resistance gene.

[0014] In a specific embodiment, the strain is Bacillus brevis X23 strain.

[0015] Preferably, the step S1 specifically comprises: modifying the pheS carrying the site-directed mutation site* Gene fusion in P 43 Behind the strong promoter, pheS * Gene is then fused with a positive selection marker gene, and in P 43 Strong promoter and pheS * pheS * A SD sequence serving as a ribosome binding site is respectively inserted between the gene and the positive screening marker gene, thereby constructing a PA gene expression cassette.

[0016] Specifically, step S2 specifically includes: taking the 600-2000bp region on the left side of the gene to be deleted as the LF fragment, taking the 500-1200bp region downstream of the gene to be deleted as the DR fragment of the forward repeat sequence, taking the PA gene expression cassette as the PA fragment, and taking the 600-1000bp region between the right side of the LF fragment and the gene to be deleted as the RF fragment. The fusion order of the above four fragments is LF-DR-PA-RF, which is called the LDPR fragment.

[0017] In a specific embodiment, step S3 specifically includes: recovering a 4.8 kb DNA fragment as a vector backbone after double digestion of the shuttle plasmid pBE194 with BamHI / SpeI or EcoRV / SmaI, and fusing it with the LDPR fragment obtained in the previous step to construct a scarless editing plasmid pBE194-LDPR of the gene to be deleted.

[0018] Preferably, when the reagent p-Cl-Phe is used for reverse screening in step S4, the concentration of the reagent p-Cl-Phe is determined as follows: firstly, the concentration of the bacterial solution of Bacillus brevis is determined and then diluted with LB culture medium to OD 600 =1.0, and then dilute 10-fold to 10 -4 , take the dilution and spread it on LB solid culture medium containing different concentrations of reagent p-Cl-Phe in the range of 0.5-5mM. After spreading evenly, place it in a 30-37℃ incubator for incubation for 16-24h, observe the growth status and number of X23 colonies, and determine the appropriate concentration for using p-Cl-Phe screening.

[0019] In a specific embodiment, the resistance screening step in step S4 specifically includes: electro-transforming the edited plasmid pBE194-LDPR into Bacillus brevis, screening with an LB resistance plate containing an appropriate concentration of Apr, incubating in a 30-37°C incubator for 16-24 hours, picking transformants to LB culture solution containing an appropriate concentration of Apr and culturing in a 30-37°C constant temperature shaker for 12-20 hours, and then performing bacterial liquid PCR verification, randomly selecting several correct transformant bacterial liquids, i.e., transitional strains integrated into the target region on the chromosome, and extracting microorganisms from them. The volume was transferred to fresh antibiotic-free LB culture medium, incubated in a 30-37°C incubator for 12-20 hours, and then inoculated with an inoculation loop on an LB solid medium containing an appropriate p-Cl-Phe concentration, and incubated in a 30-37°C incubator for 16-24 hours. Several single colonies were randomly picked and transferred to antibiotic-free LB culture medium and cultured in a 30-37°C constant temperature shaker for 12-20 hours, and then PCR verification of the bacterial solution was performed, and the bacterial solution was optionally sequenced. If the results were all correct, it was the final strain in which the target gene region on the chromosome was deleted and the plasmid sequence had been eliminated.

[0020] The present invention provides application of the scarless editing method in gene editing of Bacillus brevis.

[0021] Specifically, the target gene for gene editing is any non-essential gene region on the chromosome of Bacillus brevis, and the gene editing is gene deletion, insertion, or site-directed mutagenesis.

[0022] The present invention uses soil biocontrol bacteria Bacillus brevis X23 strain as a model material to develop a set of pheS-based * The reverse screening method of genes is applied to the elimination of gene editing vector sequences, achieving truly thorough genome editing without scars and improving the efficiency of existing genetic manipulation tools. This technical method has the following beneficial features: a) No need to modify the genome, shortening the reverse screening time and improving the reverse screening efficiency; b) It is non-cytotoxic and will not cause harm to the target strain; c) During reverse screening, not only the target editing gene fragment is deleted, but also the vector sequence itself is eliminated without any residue, facilitating continuous and unlimited genome editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Comparison of amino acid sequences of PheS proteins from different bacteria in the present invention.

[0024] Figure 2 Schematic diagram of the construction of the core element PA gene expression cassette in the present invention.

[0025] Figure 3 The electrophoresis gel diagram of each DNA fragment of the PA gene expression cassette, a core element, constructed in the present invention.

[0026] Figure 4 Schematic diagram of the construction and screening method of the scarless editing plasmid pBE194-LDPR in the present invention.

[0027] Figure 5 The present invention constructs the electrophoresis gel diagram of each DNA fragment of the scarless editing plasmid pBE194-LDPR01 and the plasmid enzyme digestion identification.

[0028] Figure 6 The tolerance test results of the Bacillus brevis X23 strain to the counter-screening reagent p-Cl-Phe are shown in the present invention.

[0029] Figure 7 PCR identification electrophoresis gel images of the transition strain X23::pBE194-LDPR01 and the final scarless editing strain X23Δtyc in the present invention.

[0030] Figure 8 Sequencing map of the PCR identification product of the scarless editing strain X23Δtyc in the present invention. DETAILED DESCRIPTION

[0031] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and understand the present invention, and are not intended to limit the present invention. The endpoints and any values ​​of the scope disclosed in the present invention are not limited to the precise scope or value, and these scopes or values ​​should be understood to include values ​​close to these scopes or values. For numerical ranges, between the endpoint values ​​of each scope, between the endpoint values ​​of each scope and a separate point value, and between separate point values, one or more new numerical ranges can be combined with each other, and these numerical ranges should be considered to be specifically disclosed in the present invention.

[0032] 1. Determination of the proposed mutation site of the pheS gene of Bacillus brevis strain X23.

[0033] a) The amino acid sequences of PheS proteins from different bacteria were searched and downloaded using the NCBI database, including those from Bacillus amyloliquefaciens (GenBank Accession No. WP_003152530.1), Escherichia coli (GenBank Accession No. NP_416229.1), Serratia plymuthica (GenBank Accession No. WP_004943598.1), Yersinia pestis (GenBank Accession No. WP_004393358.1), Thermus thermophilus (GenBank Accession No. WP_011229046.1), Streptomyces griseus (GenBank Accession No. WP_012381604.1), and Brevibacillus brevis, GenBank accession number ATF12231.1).

[0034] b) Bioinformatics tools such as MEGA and ESPript were used to compare the amino acid sequences of PheS proteins downloaded from different bacterial sources, and the conserved domain of PheS was analyzed to determine the proposed mutation site: A309G (see the comparison analysis figure Figure 1 ).

[0035] 2. Core element P43-pheS * -aac(3)IV(PA) gene expression cassette construction (schematic diagram see Figure 2 ).

[0036] a) Using PCR technology to amplify P 43 promoter part, and through P 43 The primer downstream of the promoter introduced the first ribosome binding site SD sequence.

[0037] PCR amplification of P 43 Primer sequences used for the promoter:

[0038] P 43 -F:gatcctgataggtggtatgtt(SEQ ID No: 1);

[0039] P 43 -R: TTCTTGCAACCGAGTTTGCACTCTAGATCTcctccttgtgtacattcctctcttacct (SEQ ID No: 2).

[0040] Plasmid pBE194-P 43 (Qingshu Liu, Liang Zhang, Yunsheng Wang, Cuiyang Zhang, Tianbo Liu, Caichen Duan, Xiaoying Bian, Zhaohui Guo, Qingshan Long, Ying Tang, JieDu, Aiyu Liu, Liangying Dai, Dingjun Li*, Wu Chen*. Enhancement of edeine production in Brevibacillus brevis X23 via in situ promoter engineering[J]. Microbial Biotechnology, 202) was used as template, P 43 -F / P 43 -R is a primer that amplifies a 0.34 kb P 43 Promoter (see electrophoresis gel image Figure 3 ), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 10 min.

[0041] b) Overlap extension PCR was used to amplify the pheS carrying the mutation site. * gene, and through pheS * The first SD sequence was introduced by the upstream primer of the gene, the mutation site was introduced by two middle primers, and the pheS * The primer downstream of the gene introduced a second SD sequence.

[0042] Overlap extension PCR amplification of pheS * Primer sequences used for genes:

[0043] pheS * -F: aggtaagagaggaatgtacacaaggaggAGATCTAGAGTGCAAACTCGGTTGCAAGAA (SEQ ID No: 3);

[0044] pheSm-R:GTTCTACACCCATACCGAA GCC AAAGCCGCTGACTTCCTCA(SEQ ID No: 4);

[0045] pheSm-F:TGAGGAAGTCAGCGGCTTT GGCTTCGGTATGGGTGTAGAAC (SEQ ID No: 5);

[0046] pheS * -R: atcaattttattaaagttcatACTAGTACTcctccttCTAACCTCGATTGAATTGACG (SEQ ID No: 6).

[0047] First, X23 genomic DNA was used as a template, and pheS * -F / pheSm-R, pheSm-F / pheS * -R was used as primer to amplify two short fragments of 0.95 kb and 0.13 kb carrying the mutation site, which were recovered by gel recovery kit and used as templates for overlap extension PCR. * -F / pheS * -R is a primer that amplifies pheS with a length of 1.04 kb * Gene (see electrophoresis gel for Figure 3 ), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 1 min or 20 s, 35 cycles; extension at 72°C for 10 min.

[0048] c) The apramycin resistance gene aac(3)IV was amplified using PCR technology, and a second SD sequence was introduced using a primer upstream of the aac(3)IV gene.

[0049] Primer sequences used for PCR amplification of aac(3)IV gene:

[0050] aac(3)IV-F: CGTCAATTCAATCGAGGTTAGaaggaggAGTACTAGTatgcaatacgaatggcgaaaa (SEQ ID No: 7);

[0051] aac(3)IV-R: tcagccaatcgactggcgagc (SEQ ID No: 8).

[0052] Plasmid pBE194-P 43 (collected by Hunan Institute of Microbiology) as template and aac(3)Ⅳ-F / aac(3)Ⅳ-R as primers to amplify the aac(3)Ⅳ gene with a length of 0.81 kb (see electrophoresis gel image for details). Figure 3 ), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0053] d) Using overlap extension PCR technology, the three DNA fragments were fused to construct the core element P43-pheS * -aac(3)IV(PA) gene expression cassette.

[0054] The three DNA fragments (P 43 Promoter, pheS * gene and aac(3)Ⅳ gene) as templates, P 43 -F / aac(3)Ⅳ-R are upstream and downstream primers, amplifying the PA gene expression cassette with a length of 2.15 kb (see electrophoresis gel image for details). Figure 3 ), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 60°C for 20 s, extension at 72°C for 2 min, 35 cycles; extension at 72°C for 10 min.

[0055] 3. Construction of target fragment LF-DR-PA-RF (LDPR): The location and assembly order of the four DNA fragments LF, DR, PA and RF are shown in Figure 4 In the present invention, the non-ribosomal peptidase (NRPSs) encoding gene tycA-C in the tyrocidine biosynthesis gene cluster with a length of about 34 kb on the X23 genome is deleted as an example, and the constructed target fragment is named LDPR01.

[0056] a) PCR was used to amplify the LF01 fragment of the 600-2000 bp region (left flanking) on ​​the left side of the gene to be deleted, and the homology arms required for recombination with the pBE194 vector backbone were introduced through upstream primers.

[0057] Primer sequences used for PCR amplification of LF01:

[0058] LF01-F: ggcacacgaaaaacaagttaagggatgcagtttatgcatcccttaacatcggattggatggcttatgg (SEQ ID No: 9);

[0059] LF01-R: aatcatcacaaagccgcgaccgtgtcccctccgataattggc (SEQ ID No: 10).

[0060] Using X23 genomic DNA as template and LF01-F / LF01-R as primers, amplify the 0.94 kb LF01 fragment (see electrophoresis gel image). Figure 5 In (A), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0061] b) Using PCR technology, amplify the 500-1200 bp region downstream of the gene to be deleted as the DR01 fragment of the direct repeat sequence (Directrepeat).

[0062] Primer sequences used for PCR amplification of DR01:

[0063] DR01-F: gccaattatcggaggggacacggtcgcggctttgtgatgatt (SEQ ID No: 11);

[0064] DR01-R: aacataccacctatcaggatccaacagtccaagagctcccac (SEQ ID No: 12).

[0065] Using X23 genomic DNA as template and DR01-F / DR01-R as primers, a 0.61 kb DR01 fragment was amplified (see electrophoresis gel image). Figure 5 In (A), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min.

[0066] c) PCR technology was used to amplify the PA01 fragment of the PA gene expression cassette with homology arms at both ends.

[0067] Primer sequences used for PCR amplification of PA01:

[0068] PA01-F: gtggggagctcttggactgttggatcctgataggtggtatgtt (SEQ ID No: 13);

[0069] PA01-R: attggtatgatttcccaacattcagccaatcgactggcgagc (SEQ ID No: 14).

[0070] The PA gene expression cassette constructed in the above implementation step 2 was used as a template and PA01-F / PA01-R as primers to amplify the 2.19 kb PA01 fragment (see electrophoresis gel image). Figure 5 In (A), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 2 min, 35 cycles; extension at 72°C for 10 min.

[0071] d) PCR technology was used to amplify the RF01 fragment immediately adjacent to the right side of the LF01 fragment and the 600-1000 bp region (right flanking) between the gene to be deleted, and the homology arms required for recombination with the pBE194 vector backbone were introduced through downstream primers.

[0072] Primer sequences used for PCR amplification of RF01:

[0073] RF01-F: gctcgccagtcgattggctgaatgttgggaaatcataccaat (SEQ ID No: 15);

[0074] RF01-R: TGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGgctgaacctgccgtaatcatg (SEQ ID No: 16).

[0075] Using X23 genomic DNA as template and RF01-F / RF01-R as primers, a 0.96 kb RF01 fragment was amplified (see electrophoresis gel image). Figure 5 In (A), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0076] e) The above four DNA fragments were sequentially fused using overlap extension PCR technology to construct LF01-DR01-PA01-RF01 (LDPR01).

[0077] The above four DNA fragments (LF01, DR01, PA01 and RF01) were used as templates and LF01-F / RF01-R were used as primers to amplify the 4.57 kb LDPR01 fragment (see the electrophoresis gel image). Figure 5 In (B), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 4 min 30 s, 35 cycles; extension at 72°C for 10 min.

[0078] 4. Construction of scarless editing plasmid pBE194-LDPR01 (schematic diagram see Figure 4 ).

[0079] a) Linearize the Br.brevis-E.coli shuttle vector pBE194 backbone: Double digest the plasmid pBE194-P with BamHI / SpeI 43(pBR322-ErmB-ori194-Apra, abbreviated as pBE194, Microbial Biotechnology, 2022, 15(2), 577-589)), or by EcoRV / SmaI double restriction enzyme digestion of plasmid pBE194-P 43 The recovered fragment of 4.8 kb is the pBE194 vector backbone (see electrophoresis gel image). Figure 5 (middle B).

[0080] b) Recombination and ligation of target fragment LDPR01 and pBE194 vector backbone: LDPR01 and pBE194 were mixed at a molar ratio of 1:1-10:1, and then appropriate amount of T4 DNA polymerase and corresponding buffer were added. After the above ingredients were gently mixed, in vitro ligation was performed. The reaction conditions were: 30℃ for 20 min, 75℃ for 20 min, and 50℃ for 30 min.

[0081] c) Desalting the ligation product: Place the cellulose microporous filter membrane in a disposable culture dish filled with sterile water, gently transfer the ligation product onto the membrane, cover the dish, let it stand at room temperature for 15-30 minutes, and then transfer it to a new EP tube.

[0082] d) Electroporation of the desalted ligation product into E. coli GBDir: The desalted ligation product was electroporated into E. coli GBDir, and resistance screening was performed using apramycin (Apr) at a concentration of 10-30 μg / mL. After the plasmid was extracted from the transformant, it was identified by double enzyme digestion with BamHI / SpeI. The gel image of enzyme digestion identification is shown in Figure 5 In B, the correct plasmid was named pBE194-LDPR01.

[0083] 5. Test on the tolerance of Br.brevis X23 strain to the counter-screening agent p-chlorophenylalanine (p-Cl-Phe) (results see Figure 6 ).

[0084] a) Pick a single colony of the activated Br.brevis X23 strain and inoculate it into LB culture medium and culture it in a constant temperature shaker at 30-37℃ for 12-16h. First determine the concentration of the bacterial solution, then dilute it with LB culture medium to OD 600 =1.0, and then dilute 10 times to 10 -4 .

[0085] b) 100 μL of the diluted bacterial solution was applied to LB solid culture medium containing different concentrations (0.5-5 mM) of the counter-screening reagent p-Cl-Phe. After evenly applied, the medium was placed in a 30-37°C incubator for incubation for 16-24 hours, and the growth status and number of X23 colonies were observed to determine that the concentration range of p-Cl-Phe used during screening was between 1-2.5 mM.

[0086] 6. Screening and obtaining of the scarless editing strain X23Δtyc.

[0087] a) The edited plasmid pBE194-LDPR01 was electroporated into the X23 strain, and the strain was screened using LB resistance plates containing 10-30 μg / mL Apr. The strain was incubated at 30-37°C for 16-24 hours, and the transformants were selected and transferred to LB culture medium containing 10-30 μg / mL Apr and cultured in a constant temperature shaker at 30-37°C for 12-20 hours. The transformants were then verified by PCR. The primers were designed on both sides of the aac(3)Ⅳ gene. The one that was correctly verified was the transition strain X23::pBE194-LDPR01 that was integrated into the target region on the chromosome.

[0088] The primer sequences used for PCR verification of whether plasmid pBE194-LDPR01 was transferred into the X23 strain were the same as those used for PCR amplification of the aac(3)IV gene: aac(3)Ⅳ-F / aac(3)Ⅳ-R.

[0089] The transformant culture obtained after Apr resistance screening was used as a template and aac(3)Ⅳ-F / aac(3)Ⅳ-R were used as primers to amplify the 0.81 kb aac(3)Ⅳ gene fragment (see electrophoresis gel image). Figure 7 In (A), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0090] The colony PCR verification results of 12 transformants randomly selected from the Apr resistance screening plate showed that all 12 were strongly positive, indicating that the transformation efficiency of the editing plasmid pBE194-LDPR01 into the X23 strain was 100%.

[0091] b) Randomly pick several colonies from the transition strain culture liquid, and transfer a small volume of the culture liquid to fresh antibiotic-free LB culture liquid. After incubation in a 30-37℃ incubator for 12-20 hours, use an inoculation loop to gently dip in the overnight culture liquid, streak inoculate on LB solid culture medium containing an appropriate p-Cl-Phe concentration, incubate in a 30-37℃ incubator for 16-24 hours, randomly pick several single colonies and transfer them to antibiotic-free LB culture liquid, and culture them in a 30-37℃ constant temperature shaker for 12-20 hours, then perform PCR verification on the culture liquid, and send the culture liquid to a professional company for sequencing. The sequencing primers are designed on both sides of the outer periphery of the gene region to be deleted. If both PCR verification and sequencing results are correct, it means that the target gene region on the chromosome has been deleted and the plasmid sequence has been eliminated. The final strain X23Δtyc.

[0092] The primer sequences used for PCR verification of whether the vector sequence has been eliminated are the same as those used for PCR amplification of the aac(3)IV gene: aac(3)Ⅳ-F / aac(3)Ⅳ-R.

[0093] The transformant culture obtained after p-Cl-Phe reverse screening was used as a template and aac(3)Ⅳ-F / aac(3)Ⅳ-R were used as primers to amplify the 0.81 kb aac(3)Ⅳ gene fragment (see electrophoresis gel image). Figure 7 In (B), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0094] Colony PCR verification results of 12 transformants randomly selected from the p-Cl-Phe reverse screening plate showed that the aac(3)Ⅳ gene had been eliminated in 11 transformants, and the reverse screening efficiency was 91.67%.

[0095] Two of the 11 positive transformants obtained above were randomly selected and sent to Beijing Qingke Biotechnology Co., Ltd.: their genomic DNA was first extracted, and then PCR was used to verify whether the target was deleted, and then the deleted gene interval was sequenced. The results were all correct, and finally the scarless editing strain X23Δtyc was obtained.

[0096] PCR verification of target gene deletion and sequencing of primer sequences used to delete gene intervals:

[0097] Ve01-F: gtgtgcaggccagcacattag (SEQ ID No: 17); Ve01-R: cgagatcgccggaatgatatt (SEQ ID No: 18).

[0098] Using the genomic DNA of the transformant extracted from Beijing Qingke Biotechnology Co., Ltd. as a template and Ve01-F / Ve01-R as primers, a 0.56 kb fragment of the deleted gene interval was amplified (see electrophoresis gel image). Figure 7 In (C), the reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min.

[0099] The sequencing results of the PCR products of the amplified deleted gene interval (including sequence) are detailed in Figure 8 For operations that require multiple rounds of genome editing, the scarless editing strains obtained using this screening method do not have a single base left, which is convenient, efficient, and safe.

Claims

1. A soil biocontrol bacterium Bacillus brevis based on pheS * A method for scarless genome editing in which a gene is a reverse selection marker, characterized in that: The following steps are involved: S1 was constructed by overlapping extension PCR technique 43 Promoter, pheS carrying mutation site * gene and positive selection marker gene, as well as P43 promoter, pheS * The ribosome binding site SD sequence is introduced between each of the gene and the positive screening marker gene to form a PA gene expression cassette with a core element; the pheS carrying the mutation site * The gene refers to the A309G encoding the protein relative to the PheS protein in the Br. brevis X23 strain; S2 used overlap extension PCR technology to construct a target DNA fragment containing the PA gene expression cassette and the homology arms related to the gene to be deleted, called the LDPR fragment. The assembly order was as follows: the LF01 fragment of the 600-2000bp region on the left side of the gene to be deleted, the DR01 fragment of the 500-1200bp region downstream of the gene to be deleted as a direct repeat sequence, the PA expression cassette fragment, and the RF01 fragment of the 600-1000bp region between the genes to be deleted and immediately to the right of the LF01 fragment; S3 uses homologous recombination technology to fuse the LDPR fragment with the backbone fragment of the Br. brevis-E. coli shuttle vector pBE194 to obtain the scarless editing plasmid pBE194-LDPR of the gene to be deleted; wherein the backbone fragment of the Br. brevis-E. coli shuttle vector pBE194 is double-digested with BamHI / SpeI or EcoRV / SmaI to double-digest the shuttle vector pBE194 to recover a vector backbone fragment with a length of 4.8 kb; S4 electroporated the editing plasmid pBE194-LDPR into Bacillus brevis, and first obtained a transitional strain that was integrated into the target region on the chromosome through resistance screening. Then, the reagent p-Cl-Phe was used for reverse screening to obtain a target strain that deleted the target gene region on the chromosome and eliminated the plasmid sequence, thus achieving truly thorough and traceless editing on the X23 genome.

2. The traceless editing method according to claim 1, characterized in that: The positive selection marker gene is an apramycin resistance gene.

3. The traceless editing method according to claim 1, characterized in that: The strain is Bacillus brevis X23 strain.

4. The traceless editing method according to claim 1, characterized in that: The step S1 specifically comprises: * Gene fusion in P 43 Behind the strong promoter, pheS * Gene is then fused with a positive selection marker gene, and in P 43 Strong promoter and pheS * pheS * A SD sequence serving as a ribosome binding site is respectively inserted between the gene and the positive screening marker gene, thereby constructing a PA gene expression cassette.

5. The traceless editing method according to claim 1, characterized in that: The step S2 specifically includes: taking the 600-2000bp region on the left side of the gene to be deleted as the LF fragment, taking the 500-1200bp region downstream of the gene to be deleted as the DR fragment of the forward repeat sequence, taking the PA gene expression cassette as the PA fragment, and taking the 600-1000bp region between the right side of the LF fragment and the gene to be deleted as the RF fragment. The fusion order of the above four fragments is LF-DR-PA-RF, which is called the LDPR fragment.

6. The traceless editing method according to claim 1, characterized in that: The step S3 specifically includes: recovering a 4.8 kb DNA fragment as a vector backbone after double digestion of the shuttle plasmid pBE194 with BamHI / SpeI or EcoRV / SmaI, and fusing it with the LDPR fragment obtained in the previous step to construct a scarless editing plasmid pBE194-LDPR of the gene to be deleted.

7. The traceless editing method according to claim 1, characterized in that: When the reagent p-Cl-Phe is used for reverse screening in step S4, the concentration of the reagent p-Cl-Phe is determined as follows: first, the concentration of the bacterial solution of Bacillus brevis is determined and diluted with LB culture medium to OD 600 =1.0, and then dilute 10-fold to 10 -4 , take the dilution and spread it on LB solid culture medium containing different concentrations of reagent p-Cl-Phe in the range of 0.5-5mM. After spreading evenly, place it in a 30-37℃ incubator for incubation for 16-24h, observe the growth status and number of X23 colonies, and determine the appropriate concentration for using p-Cl-Phe screening.

8. The traceless editing method according to claim 1, characterized in that: The resistance screening step in step S4 specifically includes: electro-transforming the edited plasmid pBE194-LDPR into Bacillus brevis, screening with an LB resistance plate containing an appropriate concentration of Apr, incubating in a 30-37°C incubator for 16-24 hours, picking up transformants and adding LB culture solution containing an appropriate concentration of Apr to a 30-37°C constant temperature shaker for 12-20 hours, and then performing bacterial liquid PCR verification, randomly selecting several correct transformant bacterial liquids, i.e., transition strains integrated into the target region on the chromosome, and taking a trace volume of the transfer enzyme from them. To fresh antibiotic-free LB culture medium, incubate in a 30-37°C incubator for 12-20 hours, then use an inoculation loop to streak on LB solid culture medium containing an appropriate p-Cl-Phe concentration, incubate in a 30-37°C incubator for 16-24 hours, randomly pick a few single colonies and add them to antibiotic-free LB culture medium and culture them in a 30-37°C constant temperature shaker for 12-20 hours, then perform PCR verification on the bacterial solution, and optionally sequence the bacterial solution. If all the results are correct, it is the final strain in which the target gene region on the chromosome has been deleted and the plasmid sequence has been eliminated.

9. Use of the scarless editing method according to any one of claims 1 to 8 in gene editing of Bacillus brevis.

10. The use according to claim 9, characterized in that the target gene for gene editing is any non-essential gene region on the chromosome of Bacillus brevis, and the gene editing is gene deletion, insertion, or site-directed mutagenesis.

Images