Method for improving precise traceless gene editing efficiency of yarrowia lipolytica

Abstract

The invention discloses a method for improving precise traceless gene editing efficiency of yarrowia lipolytica, and belongs to the field of microbial gene engineering. The method for improving the precise traceless gene editing efficiency of the yarrowia lipolytica comprises the following steps: constructing a free gene editing plasmid containing recombinase and upstream and downstream homologous sequences of a sequence to be edited, and culturing after plasmid transformation. The method does not need to inhibit an NHEJ path, the finally obtained engineering bacteria do not leave redundant sequences or plasmids, and the precise gene editing efficiency of the yarrowia lipolytica can be obviously improved only through a single carrier.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and more specifically, relates to a method for improving the efficiency of precise and traceless gene editing of Yarrowia lipolytica, including constructing an episomal plasmid and a culture method thereof after transformation. Background Art

[0002] Yarrowia lipolytica is a widely studied oleophilic yeast that has attracted much attention for its superior performance in biotransformation and anabolism. It is a high-quality energy microorganism and a host for heterologous protein expression. Traditional production strain modification is achieved through mutagenesis, but the workload and time cost of mutagenesis are huge for the increasingly diverse trait requirements of production strains. With the development of gene editing technology, modifying metabolic pathways to meet production needs has become the first choice for upgrading and iterating production strains.

[0003] In recent years, the rapid development of gene editing technology, relying on the homologous recombination (HR) mechanism, has provided scientists with many powerful tools for the metabolic pathway modification of production strains. Through homologous recombination, it is possible to achieve precise knockout, insertion or replacement of specific genes, thereby effectively regulating metabolic pathways to meet the host traits required for production. In addition, the emergence of emerging gene editing technologies such as CRISPR-Cas has significantly improved the efficiency of gene editing, and has broad application prospects in synthetic biology and industrial microbial engineering.

[0004] Precise gene editing is often achieved through homologous recombination and double exchange. In yeast, homologous recombination and non-homologous end joining (NHEJ) are two mechanisms that jointly participate in the repair of broken DNA. As an atypical yeast, Yarrowia lipolytica is different from typical yeast (such as Saccharomyces cerevisiae). The NHEJ mechanism in its body is dominant, and the efficiency of homologous double exchange is low. Obtaining engineered bacteria with traceless and precise editing often requires a lot of screening, which is a huge workload. Generally speaking, the application of CRISPR-Cas technology in Yarrowia lipolytica is based on site-directed mutagenesis of NHEJ to complete gene knockout or knock-in. Due to the particularity of NHEJ, the accuracy of gene editing is difficult to control, especially the frameshift mutation caused by point mutation. Although the normal transcription of the target gene is blocked, whether the frameshift sequence will produce new functional proteins is also uncontrollable. For the construction of engineered bacteria, this introduces uncontrollable safety risks, and a large amount of sequencing costs also increase the research and development costs. At present, most methods to improve the efficiency of homologous double exchange are to change the genetic characteristics of the chassis bacteria, knock out the key NHEJ gene ku70 or integrate exogenous RAD52 recombinase to enhance the homologous recombination efficiency of Yarrowia lipolytica. Although this treatment method effectively enhances the efficiency of homologous recombination, it changes the genetic characteristics of the chassis bacteria and brings unknown risks to the stability of the entire genome. Therefore, enhancing the efficiency of homologous recombination without changing the genetic characteristics of the chassis bacteria is a problem that needs to be solved urgently. Summary of the invention

[0005] In view of the technical defects or improvement needs such as low efficiency of precise and traceless gene editing of Yarrowia lipolytica in the prior art or reliance on inhibition of the NHEJ pathway, the present invention provides a method for improving the efficiency of precise and traceless gene editing of Yarrowia lipolytica. Under the action of the recombinase expressed by the free plasmid of the present invention, the original main repair pathway is converted from the NHEJ (Non-Homologous End Joining) pathway to the HDR (Homology Dependent Repair) pathway, and the 5′ upstream homologous sequence and the 3′ downstream homologous sequence of the target fragment in the free plasmid are used as repair templates, and homologous recombination double exchange occurs with the Yarrowia lipolytica genome, so that the efficiency of homologous recombination is improved, precise gene editing is achieved, and then the plasmid is eliminated, and finally precise and traceless gene editing is achieved.

[0006] According to the purpose of the present invention, a method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica is provided, comprising the following steps:

[0007] (1) constructing an episomal plasmid, wherein the episomal plasmid includes a 5′ upstream homologous sequence of the target fragment, a 3′ downstream homologous sequence of the target fragment, a gene editing system element, a recombinase expression cassette, a Yarrowia lipolytica positive selection marker, an Escherichia coli selection marker, an Escherichia coli replication origin, and a Yarrowia lipolytica replication origin;

[0008] (2) The free plasmid constructed in step (1) is transformed into Yarrowia lipolytica. The free plasmid cuts the target fragment by expressing the gene editing system, thereby inducing DNA breakage in Yarrowia lipolytica and initiating the DNA damage repair mechanism; under the action of the recombinase expressed by the free plasmid, the 5′ upstream homologous sequence and the 3′ downstream homologous sequence of the target fragment in the free plasmid are used as repair templates to undergo homologous recombination double exchange with the Yarrowia lipolytica genome, thereby improving the homologous recombination efficiency, thereby achieving efficient and precise gene editing, and then eliminating the plasmid to finally achieve precise and traceless gene editing.

[0009] Preferably, when the Yarrowia lipolytica replication origin is capable of eliminating the episomal plasmid, the Yarrowia lipolytica replication origin serves as an episomal plasmid elimination element;

[0010] When the Yarrowia lipolytica replication origin cannot eliminate the episomal plasmid, the Yarrowia lipolytica forward selection marker is used as a counter-selection marker for eliminating the episomal plasmid, that is, the Yarrowia lipolytica forward selection marker is used as a plasmid elimination element, and the episomal plasmid containing the forward selection marker is eliminated through counter-selection culture.

[0011] Preferably, the Yarrowia lipolytica positive selection marker is an antibiotic selection marker or an auxotrophic selection marker.

[0012] Preferably, the length of the upstream homologous sequence at the 5' end of the target fragment and the downstream homologous sequence at the 3' end of the target fragment is more than 750 bp.

[0013] Preferably, after the free plasmid is transformed into Yarrowia lipolytica, a solid screening medium or a liquid screening medium is used to screen and obtain transformants containing the free plasmid; the screening medium is a screening medium corresponding to the positive screening marker of Yarrowia lipolytica.

[0014] Preferably, the screening time is less than or equal to 7 days.

[0015] Preferably, the screening time is less than or equal to 3 days.

[0016] Preferably, the method for transforming Yarrowia lipolytica is a lithium acetate transformation method.

[0017] In general, the above technical solution conceived by the present invention has the following technical advantages compared with the prior art:

[0018] (1) The present invention can enhance the homologous double exchange efficiency of Yarrowia lipolytica without inhibiting the NHEJ pathway. The present invention does not need to modify the chassis bacteria to change its genetic characteristics. Compared with the previous methods of knocking out ku70, overexpressing or integrating heterologous rad52, only one free plasmid is needed to improve the homologous double exchange efficiency of Yarrowia lipolytica. After gene editing is completed, the plasmid can be eliminated to restore the genetic characteristics of Yarrowia lipolytica, that is, the genetic characteristics of Yarrowia lipolytica are changed only for a short period of time.

[0019] (2) The present invention can effectively achieve the scarless editing of the genomic DNA of Yarrowia lipolytica. It provides great convenience for the transformation of Yarrowia lipolytica. During the screening and culture process, the recombinase accumulates in the cell, and the main mode of DNA damage repair changes from the NHEJ pathway to the HDR pathway. When the nuclease in the gene editing system causes DNA damage, the homologous arms on the free plasmid can be used as repair templates to trigger the HDR repair mechanism and promote linear loop recombination. The efficiency of homologous recombination double exchange increases with time within a certain period of time and increases with the length of the homologous arms. Only one round of screening culture and no screening pressure culture or counter-screening culture is required to complete the scarless gene editing of the engineered bacteria.

[0020] (3) Under the action of the recombinase expressed by the free plasmid of the present invention, the original main repair pathway is converted from the NHEJ (Non-Homologous End Joining) pathway to the HDR (Homology Dependent Repair) pathway. The 5′ upstream homologous sequence and the 3′ downstream homologous sequence of the target fragment in the free plasmid are used as repair templates to undergo homologous recombination double exchange with the Yarrowia lipolytica genome, thereby improving the efficiency of homologous recombination and achieving precise gene editing. The plasmid is then eliminated, ultimately achieving precise and traceless gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 is the basic template plasmid used in the examples, Figure 1 A in the figure is a schematic diagram of the structure of plasmid pU3CRISPRyl, which was modified from pCRISPRyl, and Leu2 was replaced by Ura3 as a selection marker; Figure 1 B in FIG. 1 is a schematic diagram of the structure of pURCyl, which adds the Ylrad52 expression frame to pU3CRISPRyl.

[0022] Figure 2It is a schematic diagram of the structure of the model plasmid pURCyl-HR of the free plasmid, including the positive screening marker Ura3 expression frame, the Cas9 expression frame, the sgRNA scaffold, the ampicillin resistance gene expression frame, the Escherichia coli replication origin, the yeast autonomous replication sequence CEN1, the Yarrowia lipolytica endogenous gene Ylrad52 expression frame, the sgRNA of the target sequence and the upstream and downstream homology arms of the target sequence.

[0023] Figure 3 This is a diagram of the working principle of the plasmid. Cas9 and sgRNA form an RNP complex, cut the target sequence, and trigger DNA damage repair. Under the action of the recombinase RAD52, the HDR repair pathway is dominant. The homologous arms in the plasmid serve as repair templates and undergo homologous recombination double exchange with the homologous sequences in the genome to complete gene editing.

[0024] Figure 4 is the plasmid used in Example 4, Figure 4 A in the figure is a schematic diagram of the structure of plasmid pURCyl-lip2sg1HR500, which is a free plasmid for knocking out lip2, and its homology arm length is 500 bp; Figure 4 B is a schematic diagram of the structure of plasmid pUlip2sg1HR500, which is used as a control plasmid 1. Figure 3 The A in the middle lacks the Ylrad52 expression cassette; Figure 4 C in the figure is a schematic diagram of the structure of plasmid pUHR-lip2, which serves as a control plasmid 2 and only contains the Ura3 expression cassette, the ampicillin resistance gene expression cassette, the Escherichia coli replication origin, the yeast autonomous replication sequence CEN1, and the upstream and downstream homology arms of lip2 with a length of 500 bp.

[0025] Figure 5 In the case where the homology arm is 500 bp, use Figure 4 The results of electrophoresis detection were verified by colony PCR of transformants of Yarrowia lipolytica lip2 knocked out by three plasmids. Figure 5 A in the figure is the result of pURCyl-lip2sg1HR500, lanes 1-16 are the selected transformants, lane CT is the genome amplification control, lane NG is the negative control with water as the template, and DNA Marker is DS5000 (the bands from top to bottom are 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 250bp, 100bp; the same below); Figure 5 B in the figure is the result of pUlip2sg1HR, lanes 1-16 are the selected transformants, lane CT is the genome amplification control, lane NG is the negative control with water as the template, and the DNA marker is DS5000; Figure 5The C in the figure is the result of pUHR-lip2, lanes 1-16 are the selected transformants, lane CT is the genome amplification control, lane NG is the negative control with water as the template, and the DNA Marker is DS5000.

[0026] Figure 6 The schematic diagram of the structure of three plasmids, pURCyl-lip2sg1HR1000, pURCyl-lip2sg1HR750, and pURCyl-lip2sg1HR250, contain lip2 upstream and downstream homology arms of 1000bp, 750bp, and 250bp in length, respectively. Together with the plasmid pURCyl-lip2sg1HR500, they are used to verify the effects of homology arm length and screening culture time on the double exchange efficiency of homologous recombination.

[0027] Figure 7 When the liquid SD-Ura was screened and cultured for 1 day, the streaking clones were PCR-confirmed for the electrophoresis test results. The DNA marker used was DS5000, the amplification template of the control lane CT was the Po1h genome, the amplification template of the control lane NG was water, and the amplification templates of the remaining lanes were all colony lysis products; Figure 7 The homology arm length used in A is 250 bp; Figure 7 The homology arm length used in B is 500 bp; Figure 7 The homology arm length used in C was 750 bp; Figure 7 The homology arm length used in D is 1000 bp.

[0028] Figure 8 When the liquid SD-Ura was screened and cultured for 2 days, the streaked clones were picked and PCR was performed to verify the electrophoresis detection results. The DNA marker used was DS5000, the amplification template of the control lane CT was the Po1h genome, and the amplification templates of the other lanes were all colony lysis products; Figure 8 The homology arm length used in A is 250 bp; Figure 8 The homology arm length used in B is 500 bp; Figure 8 The homology arm length used in C was 750 bp; Figure 8 The homology arm length used in D is 1000 bp.

[0029] Fig. 9 When the liquid SD-Ura was screened and cultured for 3 days, the streaked clones were picked and PCR was used to verify the electrophoresis detection results. The DNA marker used was DS5000, the amplification template of the control lane CT was the Po1h genome, and the amplification templates of the other lanes were all colony lysis products; Fig. 9 The homology arm length used in A is 250 bp; Fig. 9The homology arm length used in B is 500 bp; Fig. 9 The homology arm length used in C was 750 bp; Fig. 9 The homology arm length used in D is 1000 bp.

[0030] Fig.10 Results are shown for plasmid elimination after overnight growth in YPD for genomically verified clones. Fig.10 The two culture dishes on the left and right contain SD-Ura culture medium. Fig.10 The two culture dishes on the right side of the figure contain YPD culture medium, and the strain that grows only on YPD culture medium is the final engineered strain with the plasmid eliminated. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0032] The present invention provides a Yarrowia lipolytica episomal plasmid, which comprises a 5′-end upstream homologous sequence of a target fragment, a 3′-end downstream homologous sequence of a target fragment, a gene editing element, a recombinase expression cassette, a Yarrowia lipolytica positive screening marker, an Escherichia coli screening marker and a replication origin;

[0033] The target segment is a segment to be edited;

[0034] The gene editing system can enable Yarrowia lipolytica to trigger the HDR (Homology Dependent Repair) mechanism to repair DNA damage;

[0035] The recombinase can enhance the HDR pathway, thereby improving the homologous recombination efficiency of Yarrowia lipolytica;

[0036] The Yarrowia lipolytica positive screening marker is an antibiotic screening marker or an auxotrophic screening marker;

[0037] The plasmid is a shuttle plasmid, and its replication origins include the Escherichia coli replication origin and the Yarrowia lipolytica replication origin;

[0038] Two methods can be used to eliminate the plasmid. On the one hand, the Yarrowia lipolytica replication origin used has the property of achieving plasmid elimination in Yarrowia lipolytica, that is, the Yarrowia lipolytica replication origin is used as a plasmid elimination element; on the other hand, when the Yarrowia lipolytica replication origin is not used as a plasmid elimination element, the forward selection marker can also be used as a counter-selection marker for plasmid elimination, that is, the marker is used as a plasmid elimination element, and the plasmid containing the marker can be eliminated through a round of counter-selection culture.

[0039] Preferably, the gene editing system uses CRISPR-Cas9, and the Cas9 protein binds to the gRNA to form an RNP complex that can accurately cut specific sites in the Yarrowia lipolytica genome and trigger a DNA repair mechanism.

[0040] Preferably, the recombinase uses RAD52, which can enhance the homologous double exchange efficiency of the homologous sequences in the plasmid and the genome in the HDR mechanism.

[0041] Preferably, the forward selection marker uses an auxotrophic selection marker, specifically, Ura3 or Leu2 is used as the selection marker.

[0042] Preferably, the Yarrowia lipolytica replication origin uses the yeast autonomous replication sequence CEN1, and the episomal plasmid can be eliminated by overnight culture without selection pressure.

[0043] Preferably, the homologous sequence is not less than 750 bp in length.

[0044] According to another aspect of the present invention, a culture method after transformation of an episomal plasmid is provided.

[0045] Preferably, the steps include:

[0046] (1) The episomal plasmid is transformed into Yarrowia lipolytica, and a solid screening medium or a liquid screening medium is used to screen and obtain transformants containing the episomal plasmid; when the liquid screening medium is used for screening, the screening culture time is within 3 days (within a certain period of time, the proportion of the target strain will increase with time), and the screening medium is a screening medium corresponding to the positive screening marker of Yarrowia lipolytica; after the episomal plasmid is transferred into the Yarrowia lipolytica cells, the recombinase and the gene editing system can be expressed, and under the joint action of the gene editing system and the recombinase, the homologous recombination double exchange efficiency between the upstream homologous sequence at the 5′ end of the target fragment and the downstream homologous sequence at the 3′ end of the target fragment in the plasmid and the two homologous sequences in the genome is improved;

[0047] When the positive screening marker of Yarrowia lipolytica in the free-type plasmid is an antibiotic screening marker, an appropriate amount of corresponding antibiotics is added to the solid screening medium or liquid screening medium; correspondingly, when the positive screening marker of Yarrowia lipolytica in the free-type plasmid is an auxotrophic screening marker, the solid screening medium or liquid screening medium should be a corresponding auxotrophic medium; the certain period of time is generally 3 days and no more than 7 days; the target strain is a precisely edited strain required for the experiment;

[0048] (2) After isolating a single clone, the genome is verified and confirmed, that is, the transformants in which the target fragment is precisely edited are screened;

[0049] (3) The transformants in step (2) are cultured overnight in a Yarrowia lipolytica culture medium without screening pressure to obtain the final precise and traceless gene editing engineering strain;

[0050] The target strain can be cultured under conditions without positive screening pressure to eliminate the plasmid and obtain the final engineered strain; when the positive screening marker is Ura3, uracil and 5-fluoroorotic acid (5-FOA) can be added to the culture medium to complete the plasmid elimination, thereby obtaining the final engineered bacteria.

[0051] Preferably, the conversion method in step (1) is lithium acetate conversion;

[0052] Preferably, in step (3), YPD medium is used as the non-selection pressure medium.

[0053] The strains and plasmids used in the examples: Escherichia coli DH5α competent cells were purchased from Wuhan Bovino; Yarrowia lipolytica Po1h was preserved in this laboratory, pUAxp7166 was preserved in this laboratory, and pCRISPRyl was purchased from Addgene.

[0054] Enzymes and kits: restriction endonucleases were purchased from Takara and Thermo, enzyme preparations used for PCR were purchased from Novagen, and Lysis Buffer for Microorganism to Direct PCR was purchased from Takara; -Basic Seamless Cloning and Assembly Kit was purchased from Quanshijin; plasmid extraction kit and DNA recovery kit were purchased from Omega Company, and SD-Ura medium was purchased from Solebao.

[0055] Culture conditions: Escherichia coli was cultured at 37°C and Yarrowia lipolytica was cultured at 28°C.

[0056] Synthetic primers:

[0057]

[0058] CxUra-1FGCCCCAGATAAGGTTCCGATAAAAAG

[0059] lip2out-F GACCGTTTGCAGGGCTCATC

[0060] lip2out-R CCGAGGCAGGTATTGATGGTG

[0061] lip2up-1000F CATATCATATAAAACTAACAATGCAAAACTTCTCCGAGTCTGTGCC

[0062] lip2dw-1000R TTGTGGGGGGTAATTGGATTGAACTTCTGTCACAGATGATGCATTCAACAC

[0063] lip2up-750F CATATCATATAAAACTAACAATGCACTACTTGACTGTTGTCACAGAACCTGC

[0064] lip2dw-750R TTGTGGGGGGTAATTGGATTGAACGAGAGTCTTGCATCGCTGAAAC

[0065] lip2up-250F CATATCATATAAAACTAACAATGCACATCGTCGATCACCAAACACTATCTG

[0066] lip2dw-250R TTGTGGGGGGTAATTGGATTGAACATTTGCCATTCGTAACGCTGG

[0067] Example 1: A free plasmid for enhancing the efficiency of quasi-scarless gene editing in Yarrowia lipolytica

[0068] Attached Figure 1 A in the plasmid is the backbone plasmid pU3CRISPRyl of the plasmid transformed into pCRISPRyl, including a positive screening marker Ura3 expression cassette, a Cas9 expression cassette, an sgRNA scaffold, an ampicillin resistance gene expression cassette, an Escherichia coli replication origin, and a yeast autonomous replication sequence CEN1;

[0069] Attached Figure 1B in the figure is a template plasmid pURCyl with pU3CRISPRyl as the backbone, which is used to construct the episomal plasmid, including a positive screening marker Ura3 expression cassette, a Cas9 expression cassette, an sgRNA scaffold, an ampicillin resistance gene expression cassette, an Escherichia coli replication origin, a yeast autonomous replication sequence CEN1, and an Yarrowia lipolytica endogenous gene Ylrad52 expression cassette;

[0070] Attached Figure 2 The schematic diagram of the model plasmid pURCyl-HR of the free plasmid includes a positive screening marker Ura3 expression frame, a Cas9 expression frame, an sgRNA scaffold, an ampicillin resistance gene expression frame, an Escherichia coli replication origin, a yeast autonomous replication sequence CEN1, an expression frame of the Yarrowia lipolytica endogenous gene Ylrad52, an sgRNA of the target sequence, and upstream and downstream homology arms of the target sequence.

[0071] Example 2: Using the model plasmid in Example 1 to implement seamless knockout of the target fragment

[0072] The sgRNA sequence targeting the target fragment was screened and connected to pURCyl by seamless cloning. Then, the upstream homologous sequence at the 5′ end of the target fragment and the downstream homologous sequence at the 3′ end of the target fragment in the Yarrowia lipolytica genome were amplified and connected to pURCyl containing sgRNA by seamless cloning to obtain the model plasmid pURCyl-HR.

[0073] pURCyl-HR was transferred into Po1h by lithium acetate transformation method and screened using SD-Ura medium. During the screening and culture process, sgRNA combined with Cas9 protein to form RNP complex. According to the principle of base complementary pairing, the target sequence was precisely cut to cause double bond breakage, triggering DNA damage repair of HDR pathway. Under the action of overexpressed RAD52 recombinase, the upstream and downstream homologous sequences in the plasmid were used as repair templates to undergo linear-loop recombination with genomic DNA. After the homologous recombination double exchange was completed, the target fragment was knocked out without a trace (see Appendix). Figure 3 ), after genome verification, the plasmid pURCyl-HR can be eliminated by overnight culture in YPD medium to obtain the final scarless editing engineered bacteria.

[0074] Example 3: Construction of template plasmid pURCyl for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica

[0075] (1) Using pCRISPRyl as a template, the plasmid backbone was amplified using primer pairs CRI-F and CRI-R, and using pUAxp7166 as a template, the Ura3 expression cassette was amplified using primer pairs Ura3-F and Ura3-R. The plasmid backbone and the Ura3 expression cassette were mixed at a molar ratio of 1:2 and then -Basic Seamless Cloning and Assembly Kit was used for infusion cloning. After incubation at 50°C for 15 min, the competent E. coli DH5α cells were transformed and plated on LB plates containing 100 μg / mL ampicillin. The clones were screened by colony PCR using the primer pair Ura3-F and Ura3-R. The clones that were verified by sequencing were named pU3CRISPRyl (see attached). Figure 1 A).

[0076] (2) pU3CRISPRyl was digested with Nde I and Aan I to recover the plasmid backbone. The Po1h genome was used as a template and the primer pairs Ylrad52-F / Ylrad-Nsi-R and ylrad-Nsi-F / Ylrad52-R were used to amplify the Ylrad52 expression cassette after the synonymous mutation. The above plasmid backbone and the two PCR amplified fragments were mixed at a molar ratio of 1:2:2 and then -Basic Seamless Cloning and Assembly Kit was used to transform E. coli DH5α competent cells by infusion cloning at 50°C for 30 min, and then spread on LB plates containing 100 μg / mL ampicillin. The clones were screened by colony PCR verification using Ylrad52-F and Ylrad52-R primer pairs. The clones verified by sequencing were named pURCyl (see Figure 1 B).

[0077] Example 4: Taking the knockout of lip2 as an example, the free plasmid of the present invention significantly improves the efficiency of double exchange of homologous recombination in Yarrowia lipolytica

[0078] (1) pU3CRISPRyl and pURCyl were linearized by Bln I and then recovered; PCR amplification was performed using primer pair lip2sg1F / lip2sg1R as templates, and the recovered fragment was the sgRNA insert; the above sgRNA insert was mixed with the above two linearized plasmids at a molar ratio of 20:1, and then -Basic Seamless Cloning and Assembly Kit was used to transform E. coli DH5α competent cells by infusion cloning at 50°C for 15 min, and then spread on LB plates containing 100 μg / mL ampicillin. Colony PCR verification was performed using primers ver-F and verlip2-1 for clone screening. The clones verified by sequencing were named pU3CRISPRyl-lip2sg1 and pURCyl-lip2sg1, respectively;

[0079] (2) pU3CRISPRyl-lip2sg1 and pURCyl-lip2sg1 were linearized by Nsi I and recovered; the Po1h genome was used as a template, and the upstream homology arm and downstream homology arm of lip2 with a length of 500 bp were amplified using primer pairs HRlip2up-500F / lip2up-R and lip2dw-rhF / HRlip2dw-500R respectively; the upstream homology arm and the downstream homology arm were simultaneously mixed with the two linearized plasmids at a molar ratio of 2:2:1, and then -Basic Seamless Cloning and Assembly Kit was used for infusion cloning. After incubation at 50°C for 30 min, the competent E. coli DH5α cells were transformed and plated on LB plates containing 100 μg / mL ampicillin. The verupHR-F and verPU-R primers were used for colony PCR screening. The clones verified by sequencing were named pUlip2sg1HR500 (as control plasmid 1, attached Figure 4 B) and pURCyl-lip2sg1HR500 (attached Figure 4 A).

[0080] (3) Using pUAxp7166 as a template, PCR amplification was performed using primer pair Amp-Ura-F / Amp-Ura-R, and the recovered product was the plasmid backbone; using pU3CRISPRyl as a template, PCR amplification was performed using primer pair CEN1-1F / CEN1-1R, and the recovered product was named fragment CEN1-1; plasmid pUlip2sg1HR500 was amplified using primer pair lip2up-500FRH / lip2dw-500RRH, and the recovered product was named fragment HRlip2-1; the above two fragments CEN1-1 and HRlip2-1 were simultaneously mixed with the above plasmid backbone at a molar ratio of 2:2:1, and then -Basic Seamless Cloning and Assembly Kit was used for infusion cloning. After incubation at 50°C for 30 min, the competent E. coli DH5α cells were transformed and plated on LB plates containing 100 μg / mL ampicillin. The clones were screened by colony PCR using primers CxUra-1F and lip2dw-500RRH. The clones verified by sequencing were named pUHR-lip2 (as control plasmid 2, attached Figure 4 C).

[0081] (4) The three plasmids in step (2) and step (3) were transformed into Po1h by lithium acetate, and then solid SD-Ura medium was used as the screening medium. After culturing at 28°C for 2 days, the transformants were picked out, and the colonies were lysed using Lysis Buffer for Microorganism to Direct PCR. The lysate was used as a template and the primer pair lip2out-F / lip2out-R was used for colony PCR verification. The Po1h genome was used as the amplification template (3077 bp) as a control. The colonies with an amplification band size of 2072 bp were the target strains - homologous recombination double exchange knockout lip2. As shown in the attached figure Figure 5 As shown, when the homology arm is 500bp, the target bands were not detected in the two control groups, while in the experimental group pURCyl-lip2sg1HR500, only 4 colonies did not detect the target bands, accounting for 31.25% (5 / 16), and there were 3 colonies with only one target band, and the strains with complete homologous recombination double exchange accounted for 18.75% (3 / 16). It shows that the free plasmid of the present invention significantly improves the efficiency of homologous double exchange of Yarrowia lipolytica and enhances the efficiency of precise and traceless gene editing of Yarrowia lipolytica.

[0082] Example 5: Taking lip2 knockout as an example, the length of the homology arm and the screening culture time also affect the efficiency of homologous double exchange in Yarrowia lipolytica

[0083] (1) The plasmid pURCyl-lip2sg1 in Example 3 was linearized by Nsi I and then recovered; using the Po1h genome as a template, the upstream homology arm and downstream homology arm of lip2 with a length of 1000 bp were amplified using the primer pair lip2up-1000F / lip2up-R and lip2dw-rhF / lip2dw-1000R, respectively, and then the primer pair lip2up-1000F / lip2dw-1000R was used for fusion PCR to recover the homology arm fusion fragment updw1000; using the fragment updw1000 as a template, Primer pairs lip2up-750F / lip2dw-750R and lip2up-250F / lip2dw-250R were used to amplify the upstream homology arm and downstream homology arm fusion fragments updw750 and updw250 of lip2 with a length of 750 bp and 250 bp respectively; the upstream homology arm and downstream homology arm fusion fragments updw1000, updw750, and updw250 of lip2 were mixed with the two linearized plasmids at a molar ratio of 2:1, and then -Basic Seamless Cloning and Assembly Kit was used for infusion cloning. After incubation at 50°C for 15 min, the competent E. coli DH5α cells were transformed and plated on LB plates containing 100 μg / mL ampicillin. The verupHR-F and verPU-R primers were used for colony PCR screening. The clones verified by sequencing were named pURCyl-lip2sg1HR1000, pURCyl-lip2sg1HR750, and pURCyl-lip2sg1HR250 (see Appendix). Figure 6 ).

[0084] (2) The free plasmids pURCyl-lip2sg1HR1000, pURCyl-lip2sg1HR750, pURCyl-lip2sg1HR500 and pURCyl-lip2sg1HR250 were transformed into Po1h by lithium acetate, and then screened and cultured in liquid SD-Ura medium for 3 days. Every 24 hours, a single colony was isolated by streaking on solid SD-Ura medium using an inoculation loop. After 1 to 2 days of colony growth, the colony was picked and lysed using Lysis Buffer for Microorganism to Direct PCR. The lysate was used as a template and the primer pair lip2out-F / lip2out-R was used for colony PCR verification. The Po1h genome was used as the amplification template (3077 bp) as a control. The colony with an amplified band size of 2072 bp was the target strain, which was the colony with homologous recombination double exchange knockout lip2.

[0085] As attached Figure 7 As shown, when the liquid SD-Ura screening culture was carried out for 1 day, when the length of the homologous arm was 250bp, the 4 colonies obtained by streaking all contained the target strain, and all 4 colonies were colonies with incomplete homologous double exchange; when the length of the homologous arm was 500bp, the 6 colonies obtained by streaking all contained the target strain, of which 2 colonies were complete homologous recombination double exchange, accounting for 33.33%; when the length of the homologous arm was 750bp, the 7 colonies obtained by streaking all contained the target strain, and all 7 colonies were colonies with incomplete homologous double exchange; when the length of the homologous arm was 1000bp, the 9 colonies obtained by streaking all contained the target strain, of which 4 colonies were complete homologous recombination double exchange, accounting for 44.44%.

[0086] As attached Figure 8As shown, when the liquid SD-Ura screening culture was carried out for 2 days, when the length of the homologous arm was 250bp, 16 of the 17 colonies picked by streaking contained the target strain, accounting for 94.12%, of which 5 colonies were colonies with complete homologous double exchange, accounting for 29.41%; when the length of the homologous arm was 500bp, 14 of the 16 colonies picked by streaking contained the target strain, accounting for 87.50%, of which 6 colonies were complete homologous recombination double exchange, accounting for 37.50%; when the length of the homologous arm was 750bp, 15 of the 16 colonies picked by streaking contained the target strain, accounting for 93.75%, of which 10 colonies were colonies with complete homologous double exchange, accounting for 62.50%; when the length of the homologous arm was 1000bp, all 16 colonies picked by streaking contained the target strain, of which 11 colonies were complete homologous recombination double exchange, accounting for 68.75%.

[0087] As attached Fig. 9 As shown, when the liquid SD-Ura screening culture was carried out for 3 days, when the length of the homologous arm was 250bp, all 17 colonies picked by streaking contained the target strain, of which 8 colonies were colonies with complete homologous double exchange, accounting for 47.06%; when the length of the homologous arm was 500bp, all 17 colonies picked by streaking contained the target strain, of which 7 colonies were colonies with complete homologous recombination double exchange, accounting for 41.17%; when the length of the homologous arm was 750bp, all 17 colonies picked by streaking contained the target strain, of which 12 colonies were colonies with complete homologous double exchange, accounting for 70.58%; when the length of the homologous arm was 1000bp, 15 of the 17 colonies picked by streaking contained the target strain, accounting for 88.23%, of which 13 colonies were colonies with complete homologous recombination double exchange, accounting for 76.47%.

[0088] (3) After the genome-verified colonies are purified, they are inoculated into liquid YPD medium for overnight culture, and then streaked onto YPD solid medium. Select colonies and spot plate them onto solid SD-Ura and YPD medium. The ones that do not grow on SD-Ura medium but grow on YPD are the final engineered bacteria that have eliminated the free plasmid. Fig.10 As shown, after overnight culture in YPD, the plasmid elimination rate in the picked colonies was 55% (22 / 40).

[0089] In this example, the double exchange efficiency of homologous recombination tends to increase with the increase of screening and culturing time, and tends to increase with the increase of homology arm length.

[0090] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica, characterized in that: The following steps are involved: (1) constructing an episomal plasmid, wherein the episomal plasmid includes a 5′ upstream homologous sequence of the target fragment, a 3′ downstream homologous sequence of the target fragment, a gene editing system element, a recombinase expression cassette, a Yarrowia lipolytica positive selection marker, an Escherichia coli selection marker, an Escherichia coli replication origin, and a Yarrowia lipolytica replication origin; (2) The free plasmid constructed in step (1) is transformed into Yarrowia lipolytica. The free plasmid cuts the target fragment by expressing the gene editing system, thereby inducing DNA breakage in Yarrowia lipolytica and initiating the DNA damage repair mechanism; under the action of the recombinase expressed by the free plasmid, the 5′ upstream homologous sequence and the 3′ downstream homologous sequence of the target fragment in the free plasmid are used as repair templates to undergo homologous recombination double exchange with the Yarrowia lipolytica genome, thereby improving the homologous recombination efficiency, thereby achieving efficient and precise gene editing, and then eliminating the plasmid to finally achieve precise and traceless gene editing.

2. The method for improving the efficiency of precise and traceless gene editing in Yarrowia lipolytica according to claim 1, characterized in that When the Yarrowia lipolytica replication origin is capable of eliminating the episomal plasmid, the Yarrowia lipolytica replication origin serves as an episomal plasmid elimination element; When the Yarrowia lipolytica replication origin cannot eliminate the episomal plasmid, the Yarrowia lipolytica forward selection marker is used as a counter-selection marker for eliminating the episomal plasmid, that is, the Yarrowia lipolytica forward selection marker is used as a plasmid elimination element, and the episomal plasmid containing the forward selection marker is eliminated through counter-selection culture.

3. The method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica according to claim 1, characterized in that The Yarrowia lipolytica positive selection marker is an antibiotic selection marker or an auxotrophic selection marker.

4. The method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica according to claim 1, characterized in that The length of the upstream homologous sequence at the 5' end of the target fragment and the downstream homologous sequence at the 3' end of the target fragment is more than 750 bp.

5. The method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica according to claim 1, characterized in that: After the free plasmid is transformed into Yarrowia lipolytica, a solid screening medium or a liquid screening medium is used to screen and obtain transformants containing the free plasmid; the screening medium is a screening medium corresponding to the positive screening marker of Yarrowia lipolytica.

6. The method for improving the efficiency of precise and traceless gene editing in Yarrowia lipolytica according to claim 5, characterized in that The screening time is less than or equal to 7 days.

7. The method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica according to claim 6, characterized in that The screening time is less than or equal to 3 days.

8. The method for improving the efficiency of precise and scarless gene editing in Yarrowia lipolytica according to claim 1, characterized in that The method for transforming Yarrowia lipolytica is a lithium acetate transformation method.

Images