Application of LUX gene in regulating the growth of poplar terminal buds
By knocking out the LUX gene in poplar using CRISPR/Cas9 gene editing technology, the problem of regulating the growth of poplar terminal buds was solved, achieving the technical effect of delaying growth cessation and dormancy under short-day conditions and promoting poplar growth.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2024-11-12
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies are insufficient to effectively regulate the seasonal growth of poplar terminal buds, which affects the growth and biomass accumulation of poplars under artificially controlled environments.
The LUX gene in poplar was knocked out using CRISPR/Cas9 gene editing technology. The LUX gene was used to regulate the growth of terminal buds and/or plant height and/or leaf number in poplar under short-day conditions. The target sequences were designed as AGGCTTCATGTGAATGATAC and ACTAGCGACTTAGCTCCTAC, using specific RNA molecules and Cas9 protein or their vectors.
It delayed the cessation of growth and dormancy of poplar terminal buds, promoted tree growth, and improved the growth efficiency of trees under short-day conditions.
Smart Images

Figure CN119685373B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically involving the application of the LUX gene in regulating the growth of poplar terminal buds. Background Technology
[0002] Poplar is a perennial woody plant that grows in temperate zones. Dormancy is an important physiological phenomenon for poplars to cope with winter growth adversity. Studies have shown that short-day conditions in autumn induce the terminal buds of poplars to stop growing, thus initiating dormancy. Suppressing the seasonal dormancy of poplars can help promote their growth under artificially controlled conditions, thereby improving photosynthetic carbon sequestration and biomass accumulation.
[0003] The seasonal growth of poplar terminal buds is comprehensively regulated by numerous genes, including the miR156-SPL module (PNAS, 2023, 120(48):e2311226120) and the CO / FT module (Science, 2006, 312(5776):1040-3). Due to the complexity of this trait, more genes regulating the seasonal growth of terminal buds need to be identified, thereby providing more effective technical means to regulate terminal bud growth.
[0004] To address the aforementioned problems, this invention aims to provide a novel gene that regulates the growth of poplar terminal buds. Summary of the Invention
[0005] The purpose of this invention is to provide a method for regulating the growth of poplar terminal buds.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] This invention provides the application of the LUX gene in regulating terminal bud growth and / or plant height and / or leaf number in poplar under short-day conditions, characterized in that the gene comprises any one of the following:
[0008] (1) Genes containing the sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, or SEQ ID NO.4;
[0009] (2) Genes encoding the sequence shown in SEQ ID NO.3 or SEQ ID NO.6;
[0010] (3) Genes numbered Potri.001G243600 or Potri.009G035000 in the poplar gene database.
[0011] The present invention also provides a method for promoting the growth of terminal buds and / or plant height and / or the increase of leaf number in poplar trees under short-day conditions, characterized in that the method comprises the following steps:
[0012] (1) Knock out the above-mentioned genes in poplar trees;
[0013] (2) Select plants with increased terminal bud growth and / or plant height growth and / or increased leaf number under short-day conditions.
[0014] In some implementations, the above-mentioned gene knockout method is a gene editing method.
[0015] In some implementations, the above-mentioned gene knockout method uses the CRISPR / Cas gene editing method, and the selected target sequences are AGGCTTCATGTGAATGATAC and
[0016] ACTAGCGACTTAGCTCCTAC.
[0017] The present invention also provides a reagent kit, characterized in that it comprises any one of the following:
[0018] (1) Able to simultaneously recognize CCTGAACTTGCTTCCGCCTT and
[0019] RNA molecules with target sequences shown in TGAGCCTCACCGTACTCCAC;
[0020] (2) A DNA molecule encoding the RNA described in (1);
[0021] (3) Vectors that express the RNA described in (1).
[0022] In some implementations, the kit described above also includes the Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein.
[0023] In some implementations, the aforementioned RNA molecule is
[0024] AAGGCGGAAGCAAGUUCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and
[0025] The combination of sequences shown in GUGGAGUACGGUGAGGCUCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuuu.
[0026] The present invention also provides the application of the above-described kit in promoting the growth of terminal buds and / or plant height and / or the increase in the number of leaves in poplar trees under short-day conditions.
[0027] The innovation and beneficial effects of this invention are as follows: Through screening and testing, this invention has found that knocking out the LUX gene can achieve the technical effect of delaying the growth cessation and dormancy time of the apical buds of trees and promoting tree growth under short-day conditions. Attached Figure Description
[0028] Figure 14 shows the structural diagrams of photoperiodic genes and the locations of gene editing target sites.
[0029] Figure 2 gRNA expression cassette structures for four photoperiodic genes.
[0030] Figure 3 Image of PKSE401-ELF4 carrier.
[0031] Figure 4 ELF3 edits the genotype of the plant.
[0032] Figure 5 ELF4 edits the genotype of plants.
[0033] Figure 6 LUX edits the genotype of plants.
[0034] Figure 7 SPL9 edits the genotype of the plant.
[0035] Figure 8 Phenotypic characteristics of ELF3-edited plants. 717-4: Recipient control; ID70-NR9, ID70-NR11, ID70-NR12, ID70-NR15: Representing four edited plants elf3-9, elf3-11, elf3-12, and elf3-15, respectively. SD0W, SD2W, SD4W, SD6W: Representing 0, 2, 4, and 6 weeks after short-day treatment, respectively.
[0036] Figure 9 Phenotypic characteristics of ELF4-edited plants. 717-3: recipient control; ID168-NR1, ID168-NR2, ID168-NR7: representing three edited plants elf4-1, elf4-2, and elf4-7, respectively. SD0W, SD2W, and SD4W: representing 0, 2, and 4 weeks after short-day treatment, respectively.
[0037] Figure 10 Phenotypic characteristics of LUX-edited plants. 717-3: Recipient control; ID169-NR3, ID169-NR17, ID169-NR19: Represent three edited plants lux1-3, lux1-17, and lux1-19, respectively. SD0W, SD2W, SD4W, SD6W: Represent 0, 2, 4, and 6 weeks after short-day treatment, respectively.
[0038] Figure 11 Phenotypes of SPL9-edited plants. 717: Recipient control; ID145-NR1, ID145-NR4, ID145-NR5, ID145-NR9: Representing four edited plants spl9-1, spl9-4, spl9-5, and spl9-9, respectively. SD0W and SD4W: Representing 0 and 4 weeks after short-day treatment, respectively. Detailed Implementation
[0039] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.
[0040] In this application, the words “comprising,” “including,” or variations thereof should be understood to include other elements, numbers, or steps in addition to those described.
[0041] Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino-to-carboxyl orientation. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the terms “encoding” or “encoded” when used in the context of a particular nucleic acid mean that the nucleic acid contains the essential information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of the specific protein. The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue,” “amino acid residue,” or “amino acid” are used interchangeably herein to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids and, unless otherwise limited, may include known analogs of natural amino acids that can function in a similar manner to naturally occurring amino acids.
[0042] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Identification of sequence identity includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe may be a genomic DNA fragment, cDNA fragment, RNA fragment, or other oligonucleotide, and may be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on sequences from the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences can be performed under stringent conditions. As used herein, the terms "stringent conditions" or "stringent hybridization conditions" refer to conditions under which the probe will hybridize with its target sequence to a detectable extent (e.g., at least 2, 5, or 10 times the background) relative to hybridization with other sequences.Harsh conditions are sequence-dependent and vary across different environments. By controlling hybridization harshness and / or washing conditions, target sequences 100% complementary to the probe can be identified (homologous probe method). Alternatively, harsh conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, probe lengths are less than about 1000 or 500 nucleotides. Typically, harsh conditions are those where the salt concentration is less than about 1.5 M Na ions at pH 7.0 to 8.3, typically about 0.01 M to 1.0 M Na ion concentration (or other salts), and the temperature conditions are: at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides). Harsh conditions can also be achieved by adding a destabilizing agent such as formamide. Exemplary low-threshold conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, and 1% SDS (sodium dodecyl sulfate), followed by washing at 50°C to 55°C in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate). Exemplary medium-threshold conditions include hybridization at 37°C using 40% to 45% formamide, 1.0M NaCl, and 1% SDS, followed by washing at 55°C to 60°C in 0.5× to 1× SSC. Exemplary high-threshold conditions include hybridization at 37°C using 50% formamide, 1M NaCl, and 1% SDS, followed by a final wash at 60°C to 65°C in 0.1× SSC for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Hybridization duration is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity typically depends on post-hybridization washing, with key factors being the ionic strength and temperature of the final washing solution. The Tm (thermodynamic melting point) of DNA-DNA hybrids can be approximated by the formula from Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5℃ + 16.6 (logM) + 0.41 (%GC) - 0.61 (%formamide) - 500 / L; where M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "formamide%" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature at which 50% of the complementary target sequence hybridizes with a perfectly matched probe (at a given ionic strength and pH). Washing is typically performed at least until equilibration is reached and a low hybridization background level is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mispairing should lower Tm by approximately 1°C; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize with the desired sequence of homology. For example, if a sequence with ≥90% homology is required, Tm can be lowered by 10°C.Typically, the stringency conditions are selected to be approximately 5°C lower than the Tm of the specific sequence and its complementary sequence at the defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the Tm.
[0043] Unless otherwise specified, all figures representing amounts of components, reaction conditions, etc., used in this specification and claims should be understood to be modified by the term "about" in all cases. As used herein, the term "about," when referring to a measurable value such as mass, weight, time, volume, concentration, or percentage, means to cover variations of ±20% from a specified amount in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, because such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, peptides, etc. Therefore, unless indicated to the contrary, the numerical parameters listed in this specification and appended claims are approximate values that may vary depending on the desired characteristics sought to be obtained from the subject matter disclosed in this application.
[0044] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.
[0045] Example
[0046] Example 1: Knocking out the photoperiod gene in poplar trees using gene editing technology
[0047] Since the seasonal growth of poplar terminal buds is affected by photoperiod, the inventors screened for genes that influence the seasonal growth of terminal buds from plant rhythm and photoperiod regulation genes. Initially, ELF3, ELF4, LUX, and SPL9 genes were selected for seasonal growth testing of poplar terminal buds. Homologous genes of these genes in plants such as Arabidopsis and rice can affect flowering time and photoperiod responses.
[0048] The inventors plan to use the CRISPR / Cas9 gene editing method to knock out the ELF3, ELF4, LUX, and SPL9 genes respectively, and investigate the growth status of poplar terminal buds after gene knockout in order to clarify the influence of genes on terminal bud growth.
[0049] The gene sequences were retrieved from the Phytozome database. The ELF3 gene has one allele in poplar (Potri.006G233800), and the inventors designed two knockout sites at the first exon. The ELF4 gene has three alleles in poplar (Potri.008G068200, Potri.001G251600, and Potri.009G046400), and the inventors designed four knockout sites: gRNA1 and gRNA2 at Potri.008G068200; gRNA3 at Potri.001G251600; and gRNA4 at both Potri.001G251600 and Potri.009G046400. The LUX gene has two alleles in poplar (Potri.001G243600 and Potri.009G035000), and the inventors designed two knockout sites at conserved sequences of these two genes. The SPL9 gene has three alleles in poplar (Potri.016G048500, Potri.002G142400, and Potri.014G057800), and the inventors designed two knockout sites: gRNA1 at Potri.016G048500; and gRNA2 at Potri.002G142400 and Potri.014G057800. Based on the designed knockout sites, the inventors constructed one or more gRNA expression cassettes (basic structures are shown in...) for ELF3, ELF4, LUX, and SPL9. Figure 2 These gRNA expression cassettes are then combined with Cas9 expression cassettes to construct gene editing vectors. These vectors also contain streptomycin selection marker genes for antibiotic selection during genetic transformation, as well as a basic vector backbone (e.g., LB, RB, vector backbone regions, etc.).
[0050] The inventors transformed the aforementioned vectors into poplar trees. The vectors were constructed using the GoldenGate cloning method to create the targeting vector (BMC Plant Biol. 2014, 14:327). The specific construction method is as follows:
[0051] (1) PCR amplification of the target fragment of the homologous recombination targeting vector: After identifying the effective knockout gRNA, two pairs of primers were designed according to the selected gRNA site. Using the intermediate vector pCBC-DT1T2 as a template, the target fragment of the homologous recombination targeting vector was amplified by PCR using phanta enzyme. The amplification program was 98℃ for 3 min pre-denaturation, followed by 30 cycles of 98℃ for 15 s, 60℃ for 30 s, and 72℃ for 1 min, and finally extension at 72℃ for 10 min.
[0052] (2) Ligating the target fragment of the homologous recombination targeting vector to the final vector: Enzyme digestion and ligation reactions were performed using ECO31I restriction enzyme and T7 ligase. The reaction was carried out at 37℃ for 5 min in a PCR instrument (ECO31I digestion reaction), followed by an reaction at 25℃ for 10 min (T7 ligase ligation reaction). This process was repeated 30 times. The amplified target fragment of the homologous recombination targeting vector was then ligated to the final vector PKSE401. Figure 3 (The final vector structure is shown using the ELF4 editing vector as an example).
[0053] (3) Transform the constructed final vector into E. coli, pick a few single clones from the screening medium to perform colony PCR to detect positive strains, and sequence the correct bands to ensure that the target fragment sequence is correct and without frameshift mutations.
[0054] (4) Amplify and culture positive Escherichia coli strains and extract vector plasmids containing the target fragment.
[0055] (5) The constructed vector was transformed into GV3101 Agrobacterium and colony PCR was performed to obtain positive strains, which were then transformed into Populus alba × Populus tremula (717) as a recipient hybrid of Populus alba × Populus tremula.
[0056] The genetic transformation system of poplar mainly refers to Science. 2006, 312(5776):1040-3. The main process is as follows: preparing OD 600Approximately 0.6% Agrobacterium was used to inoculate poplar leaf petiole explants for 30-60 minutes. After washing, the explants were incubated in the dark for about 2 days before being transferred to differentiation medium, with the medium changed every 14 days. After about 2 months, they were transferred to proliferation medium, and after about 1 month, they were transferred to rooting medium. The inoculation medium, suspension, and regeneration medium required for genetic transformation were all referenced in Science. 2006, 312(5776):1040-3. Each vector was used to infect 60 explants, and the transformation-positive plants were selected to analyze the editing of the target gene.
[0057] For target gene editing detection, primers were designed for each gRNA, with primers positioned 200 bp upstream and downstream for amplification. The first step was to determine if large fragment deletions were present. The second step involved designing adapter primers to amplify the surrounding sequences of the gRNA, followed by Hi-Tom sequencing (http: / / www.hi-tom.net / hi-tom / index-CH.php). 1000 reads were sequenced from the PCR product of each gRNA amplification. After the sequences were returned, the results were processed, and the genotypes before and after editing were compared and analyzed.
[0058] ELF3 yielded four plantlets with successful target gene editing: elf3-9, elf3-11, elf3-12, and elf3-15. Figure 4 ELF4 yielded three successfully edited plants with the target gene: elf4-1, elf4-2, and elf4-7. Figure 5 LUX obtained three plantlets with successful target gene editing: lux1-3, lux1-17, and lux1-19. Figure 6 SPL9 produced four plants with successful target gene editing: spl9-1, spl9-4, spl9-5, and spl9-9. Figure 7 ).
[0059] Example 2: Trait survey of gene-edited poplar trees
[0060] Plants whose target genes were successfully edited were selected to investigate flower bud development after short-day treatment.
[0061] Gene-edited and control materials were cultured under long-day conditions (16-18 hours of light) for two months, then transferred to short-day conditions (8 hours of light and 16 hours of darkness) for treatment. The ambient temperature was 22°C with light and 20°C without light. Every 5 days, the initial plant height, leaf increase, and other growth indicators of poplar seedlings under different treatments were investigated. The changes in terminal bud growth status were also investigated according to the scoring criteria for terminal bud growth status, and bud set score data were obtained.
[0062] Bud formation is scored as follows: 3 points (Score value 3): Vigorous growth, characterized by active growth of the apical meristem, continuously producing new stipules and leaves, with the stipules pointing vertically upwards. 2 points: Cessation of growth, characterized by the apical meristem no longer producing new stipules and leaves, the stem nodes no longer elongating, and the apex exhibiting an inverted triangular shape. 1 point: Bud formation, characterized by stipules and ovules completely enveloping the bud, the bud scales being green, and the leaves being fully expanded. 0 points: The terminal bud hardens and turns red, entering a deep dormant state.
[0063] The results showed that knocking out the ELF3 and LUX genes delayed the cessation of terminal bud growth in poplar trees, while increasing the number of leaves and plant height. Figure 8 and Figure 10 This indicates that knocking out the ELF3 and LUX genes can achieve the technical effect of delaying the growth arrest and dormancy time of tree apical buds and promoting tree growth under short-day conditions. However, knocking out ELF4 and SPL9 cannot achieve the above technical effect. Figure 9 and Figure 11 ).
[0064] The LUX genome sequences are shown in SEQ ID NO.1 and SEQ ID NO.4, the coding region sequences are shown in SEQ ID NO.2 and SEQ ID NO.5, and the amino acid sequences are shown in SEQ ID NO.3 and SEQ ID NO.6, respectively.
[0065] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.
Claims
1. The application of the LUX gene knockout combination in promoting terminal bud growth and / or plant height growth and / or leaf number increase in poplar under short-day conditions, characterized in that, The gene combinations are as follows (1) and (2): (1) The gene with the sequence shown in SEQ ID NO. 2 or the gene numbered Potri.009G035000 in the poplar gene database; (2) The gene with the sequence shown in SEQ ID NO. 5 or the gene numbered Potri.001G243600 in the poplar gene database.
2. A method for promoting terminal bud growth and / or plant height growth and / or leaf number increase in poplar trees under short-day conditions, characterized in that, The method includes the following steps: (1) Knock out the gene combination described in claim 1 in poplar trees; (2) Select plants with increased terminal bud growth and / or plant height and / or increased leaf number under short-day conditions.
3. The method according to claim 2, characterized in that, The method for knocking out genes is to use gene editing methods.
4. The method according to claim 3, characterized in that, The gene knockout method is the CRISPR / Cas gene editing method, and the selected target sequences are CCTGAACTTGCTTCCGCCTT and TGAGCCTCACCGTACTCCAC.
5. The application of a reagent kit in promoting terminal bud growth and / or plant height growth and / or leaf number increase in poplar trees under short-day conditions, characterized in that: Including any of the following: (1) RNA molecules that can simultaneously recognize the target sequences shown in CCTGAACTTGCTTCCGCCTT and TGAGCCTCACCGTACTCCAC; (2) The DNA molecule encoding the RNA described in (1); (3) A vector expressing the RNA described in (1); The kit also includes Cas9 protein or nucleic acid molecules encoding Cas9 protein or vectors expressing Cas9 protein; The RNA molecule described is a combination of the sequences shown in AAGGCGGAAGCAAGUUCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu and GUGGAGUACGGUGAGGCUCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuuu.