Primer, kit and detection method for detecting ALDH2 gene mutation

Abstract

The invention belongs to the technical field of molecular biological detection, and particularly relates to a primer, a kit and a detection method for detecting ALDH2 gene mutation. It is found for the first time that in ALDH2 * 2 gene specificity crRNA design, after a small amount of mismatched bases are added, ALDH2 mutant types can be efficiently distinguished by combining a CRISPR-Cas12a system. The detection method provided by the invention comprises the following steps: firstly, carrying out nucleic acid isothermal amplification on a sample to be detected by virtue of the specific RPA primer, then carrying out recognition combination and cutting on an RPA amplification product by virtue of a CRISPR-Cas12a fluorescence detection system, activating an ssDNA fluorescence probe to obtain a split product, and judging by virtue of fluorescence color development; or a CRISPR-Cas12a test paper detection system reads the result of the test paper strip, so that the detection of the c.1510Ggt of the ALDH2 * 2 gene is realized; c point mutation can be efficiently, accurately and quickly detected.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological detection, and specifically relates to a primer, a kit and a detection method for detecting ALDH2 gene mutation, and efficiently distinguishes ALDH2 wild type and mutant type based on RPA and CRISPR-Cas12a system. Background Art

[0002] Recombinase Polymerase Amplification (RPA) is known as a nucleic acid detection technology that can replace PCR. Under 37-42°C, the protein-DNA complex formed by the combination of the recombinase that can bind to single-stranded nucleic acid (oligonucleotide primer) and the primer searches for homologous sequences in double-stranded DNA to exchange chains. DNA synthesis is initiated under the action of the strand displacement DNA polymerase, and then the replaced DNA chain binds to the single-stranded DNA binding protein (SSB) to prevent further replacement. The RPA system can achieve detectable levels of amplification products within ten minutes. CRISPR / Cas12a (clustered regularly interspaced short palindromic repeats crispr associated gene) is an endonuclease that can achieve DNA cutting function under the guidance of specific RNA. It can be used for genome editing. It also has non-specific collateral cutting activity that can achieve the cutting of fluorescent probes to produce fluorescence. It can be used as a tool for in vitro detection of biological molecules under room temperature conditions.

[0003] Aldehyde dehydrogenase 2 (ALDH2) is a key enzyme in the metabolic pathway of active aldehydes in vivo and in vitro. It belongs to the acetaldehyde dehydrogenase family. Its main functions include metabolizing active aldehydes in the body: acetaldehyde, acrolein, 3,4-dihydroxyphenylacetaldehyde (DOPAL), malondialdehyde (MDA) and 4-hydroxynonenal (4-HNE), etc. Alcohol is metabolized to acetaldehyde in the liver and then converted into acetic acid. Acetaldehyde has hepatotoxicity and muscle toxicity, and increases the risk of cardiovascular and cerebrovascular diseases and cancer.

[0004] The speed of acetaldehyde removal in the body mainly depends on the activity of ALDH2 enzyme. Its encoding gene ALDH2 gene is polymorphic and prone to gene mutation. The glutamic acid at the 487th position of the ALDH2 amino acid sequence is replaced by lysine, resulting in a significant loss of catalytic activity of the synthesized acetaldehyde dehydrogenase. The wild-type gene encoding the normal enzyme is ALDH2*1, and the point mutation of c.1510G>C, the mutant gene encoding the inactivated enzyme (named ALDH2*2, is one of the most common gene mutations in humans. It is estimated that 560 million people worldwide (about 8% of the world's population) carry this gene, of which about 35% to 45% are in Southeast Asian populations. The mutation at this site affects the activity of the enzymes encoded by ALDH2, including acetaldehyde dehydrogenase, nitroesterase, etc.

[0005] Nitroglycerin is widely used in the treatment of cardiovascular diseases. Nitrolipase is used to denitrate nitroglycerin to produce nitric oxide, which plays a role in dilating blood vessels. When ALDH2*2 mutation exists, the effect of nitrolipase is severely reduced, thereby affecting the efficacy of nitroglycerin. The detection of this mutation site provides clues for the patient's related treatment and reduces ineffective medication.

[0006] At present, the main detection technology for this mutation is fluorescent PCR, which has good accuracy, but has disadvantages such as long detection time, high equipment requirements, and complex operation. Compared with the traditional PCR method, the RPA combined with CRISPR nucleic acid detection system has a rapid response, low equipment requirements, and simple operation.

[0007] However, due to the fault tolerance of the CRISPR system, that is, when there are a few mismatched bases in the target sequence, the guide RNA can still bind to the mutation point sequence, causing the enzyme cutting effect of the CRISPR system. Therefore, the guide RNA that matches the wild strain sequence can bind to the mutation point sequence, and vice versa. The design of conventional guide RNA cannot distinguish between wild strain sequences and mutant sequences. In order to solve this problem, the inventor innovatively used the fault tolerance of CRISPR to introduce mismatched guide RNA. For sequences with single-base mutations, the guide RNA can still bind to the mutant sequence by adding one more mismatch point; but since there are two mismatched points between the mismatched guide RNA and the wild strain sequence, the binding efficiency is greatly reduced, making it impossible to activate the enzyme cutting effect of the CRISPR system normally and unable to generate fluorescent signals. By screening mismatched guide RNA for ALDH2 mutation point detection, the inventor can provide fast and effective detection clues for nitroglycerin medication guidance when primary medical care or experimental equipment is insufficient, and can also indicate the risk of diseases such as Alzheimer's, while reminding people with ALDH2 mutation points to drink moderately. Summary of the invention

[0008] The present invention provides primers, a kit and a detection method for detecting ALDH2 gene mutations. It is found for the first time that in the design of crRNA specific for the c.1510G>C mutation point of the ALDH2*2 gene, after adding a small amount of mismatched bases, the targeted recognition function and collateral cleavage activity of CRISPRCas12a are used to recognize the DNA site and cut the signal reporter molecule, so that the wild type and mutant types of ALDH2 can be efficiently distinguished.

[0009] Based on the above technical objectives and technical problems, the present invention provides the following technical solutions:

[0010] A primer for detecting ALDH2 gene mutation, comprising an RPA-specific isothermal amplification primer for the ALDH2 gene;

[0011] The RPA specific isothermal amplification primers for the ALDH2 gene (NC_000012.12:111803796-111804368) include a forward primer and a reverse primer, and the sequences are as follows:

[0012] RPA-3F (SEQ ID NO: 13)CTCGTTTTCAAATTACAGGGTCAACTGCTATG,

[0013] RPA-2R (SEQ ID NO: 15) CCAACAGACCCCAATCCCCCAGCAGGCTCC.

[0014] The primers are used in detecting ALDH2 gene mutations.

[0015] An ALDH2 gene mutation detection kit, comprising the RPA specific isothermal amplification primers for the ALDH2 gene and a CRISPR-Cas12a fluorescence or test paper detection system;

[0016] The CRISPR-Cas12a fluorescence or detection system includes 10×NEBuffer 2.1 and DEPC water.

[0017] Among them, the CRISPR-Cas12a fluorescence detection system also includes crRNA, Cas12a protein, and ssDNA fluorescent probe specific to the c.1510G>C mutation point of the ALDH2*2 gene;

[0018] Among them, the CRISPR-Cas12a test strip detection system also includes crRNA specific to the c.1510G>C mutation point of the ALDH2*2 gene, Cas12a protein, and CRISPR-LFA ssDNA reporter (CRISPR single system detection test strip);

[0019] Wherein, the Cas12a protein is LbCas12a protein;

[0020] The sequence of the specific crRNA for the c.1510G>C mutation point of the ALDH2*2 gene is shown in SEQ ID NO: 6:

[0021] crRNA-mm1 (SEQ ID NO: 6)UAAUUUCUACUAAGUGUAGUACUUUAGUGUCUGCCUGCAGCCCG;

[0022] The ssDNA fluorescent probe is a single-stranded DNA probe double-labeled with a fluorescent group and a fluorescent quenching group, and the sequence of the single-stranded DNA probe is FAM-TTATT-Quencher.

[0023] The present invention also provides a method for detecting ALDH2 gene mutation, comprising the following steps:

[0024] 1) Obtain the kit; 2) Obtain a sample to be tested, and perform isothermal amplification based on the RPA-specific isothermal amplification primer to obtain an RPA amplification product; 3) Use the CRISPR-Cas12a system to identify, cut, and activate the RPA amplification product obtained in step 2) to obtain a cleavage product; 4) Perform a CRISPR-Cas12a detection system (a CRISPR-Cas12a fluorescence detection system or a CRISPR-Cas12a test paper detection system) on the cleavage product obtained in step 3); and combine the first-generation sequencing results of the cleavage product to complete the detection of the c.1510G>C point mutation of the ALDH2*2 gene.

[0025] The RPA amplification system is as follows: 2.4uL 10mM RPA upstream primer, 2.4uL 10mM RPA downstream primer, mix well and add the sample to be tested to a final concentration of 0.5nM; then add 2.5uL MgOAc solution was added with DEPC water to 50uL, and amplification was initiated by heating in a 37°C metal bath for 10 minutes to obtain PRA amplification products.

[0026] The CRISPR-Cas12a fluorescence detection system is as follows: crRNA with a final concentration of 33 nM, LbaCas12a with a final concentration of 33 nM, 3 uL Nebbuffer 2.1, and a fluorescence quenching probe with a final concentration of 50 nM, 2 uL of the RPA amplification product obtained in step 2) is added, and DEPC water is added to 30 uL; the fluorescence intensity is detected after reacting at 37 ° C for 60 minutes.

[0027] The CRISPR-Cas12a test strip detection system is as follows: crRNA with a final concentration of 33nM, LbaCas12a with a final concentration of 33nM, 3uL Neb buffer 2.1, and a final concentration of 100nM CRISPR-LFA ssDNA reporter, 2uL of the RPA amplification product obtained in step 2), and DEPC water is added to 30uL; after reacting at 37°C for 60 minutes, insert the CRISPR single system detection test strip to read the result.

[0028] The advantages and beneficial effects of the present invention over the prior art include:

[0029] The present invention provides a primer, a kit and a detection method for detecting ALDH2 gene mutation, including specific RPA primers for the lung cancer mutant gene ALDH2 gene and specific crRNA designed for the c.1510G>C mutation point of the ALDH2*2 gene. For the first time, it was found that after adding a small amount of mismatched bases in the crRNA design specific for the c.1510G>C mutation point of the ALDH2*2 gene, the wild type and mutant type of ALDH2 can be efficiently distinguished in combination with the CRISPR-Cas12a system. The detection method provided by the present invention first performs isothermal nucleic acid amplification on the sample to be detected by the aforementioned specific RPA primers, and then, in the CRISPR-Cas12a fluorescence detection system containing the aforementioned specific crRNA, the RPA amplification product is recognized, bound and cut into the target double-stranded DNA to activate the non-specific nuclease function, and then the ssDNA fluorescent probe in the cleavage system is arbitrarily cut to obtain the cleavage product, and finally the judgment is made by the fluorescence color development of the cleavage product, or the test strip result is read in the CRISPR-Cas12a test strip detection system containing the aforementioned specific crRNA, thereby realizing the detection of the c.1510G>C point mutation of the ALDH2*2 gene, and providing technical support for judging whether the sample has an ALDH2 gene mutation site. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Schematic diagram of the crRNA screening results for distinguishing wild-type and mutant ALDH2 in Example 1 of the present invention;

[0031] Among them, the X-axis represents the fluorescence intensity, and the vertical axis represents the crRNA group; when there is no crRNA, both the wild-type sequence and the mutant sequence have no obvious fluorescence;

[0032] Figure 2 : Schematic diagram of the optimal RPA primer screening for crRNA in Example 2 of the present invention and the results;

[0033] Figure 3: Schematic diagram of sample verification and results of the detection method in Example 3 of the present invention, wherein + / - indicates that the first-generation sequencing results contain / do not contain ALDH2 mutation points, but are inconsistent with the fluorescence detection results, i.e., false positive or false negative; the color indicates the detection fluorescence value of the present invention;

[0034] Figure 4 : Physical picture of the test strip output of the test results in the embodiment of the present invention;

[0035] Figure 5 : Schematic diagram of the principle of distinguishing wild-type and mutant sequences in the present invention, wherein the upper figure shows that the normal mutant crRNA can match the sequence without mutation point (left), and completely matches the sequence with mutation point (right); the lower figure shows that the mutant crRNA with a mismatch point only matches the sequence with mutation point (right), and cannot match the sequence without mutation point (left). DETAILED DESCRIPTION

[0036] Example 1. Screening of ALDH2 mutant gene crRNA

[0037] 1.1 Reference sequence synthesis and amplification

[0038] The wild-type ALDH2 gene reference sequence comes from the NCBI website, NC_000012.12:111803796-111804368; the mutant is at c.1510, where the base guanine G is replaced by cytosine C. The backbone of the reference sequence plasmid is PUC19, and the recombinant plasmid is synthesized by Shanghai Shenggong Company and introduced into TOP10 Escherichia coli. The ALDH2 plasmid TOP10 strain was inoculated on an ampicillin LB agar plate and cultured overnight at 37°C incubator for 20 hours. Pick a single clone colony and inoculate it into 100μg / mL ampicillin LB liquid culture medium for amplification culture. After 10-14 hours, collect the bacteria and extract the plasmid according to the instructions of the plasmid extraction kit (Kangwei, CW209S).

[0039] 1.2 crRNA sequence design

[0040] The Cas protein selected in this experiment is 12a. According to its PAM (TTTN) characteristics, 7 crRNAs were selected for the detection of the ALDH2*2 gene c.1510G>C mutation point-specific gene (Table 1). Cas12a detection has a certain fault tolerance, that is, when there are a small number of mismatched bases in crRNA, the enzymatic activity of Cas12a can still be stimulated. Based on this, we added a small number of mismatched bases to the design of some crRNAs to distinguish between the ALDH2 wild type and the ALDH2*2 gene c.1510G>C mutant type, namely crRNA-mm1, crRNA-mm2, crRNA-mm3, crRNA-ww1, and crRNA-ww2 described in the table below. The reaction principle is as follows Figure 5 As shown, it can be seen from the upper figure that the normal mutant crRNA can match the sequence without mutation point and completely match the sequence with mutation point; it can be seen from the lower figure that the mutant crRNA with a mismatch point only matches the sequence with mutation point and cannot match the sequence without mutation point.

[0041] The crRNA used in this experiment was synthesized by General Biotechnology Co., Ltd.

[0042] Table 1: crRNA sequences

[0043] Primer name sequence crRNA-mu (SEQ ID NO: 4) UAAUUUCUACUAAGUGUAGAUACUUUAGUGUAUGCCUGCAGCCCG crRNA-wt (SEQ ID NO: 5) UAAUUUCUACUAAGGUAGUACUUCAGUGUAUGCCUGCAGCCCG crRNA-mm1 (SEQ ID NO: 6) UAAUUUCUACUAAGUGUAGAUACUUUAGUGUCUGCCUGCAGCCCG crRNA-mm2 (SEQ ID NO: 7) UAAUUUCUACUAAGUGUAGAUACCUUAGUGUAUGCCUGCAGCCCG crRNA-mm3 (SEQ ID NO: 8) UAAUUUCUACUAAGUGUAGAUACUUUAUUGUAUGCCUGCAGCCCG crRNA-wwl (SEQ ID NO: 9) UAAUUUCUACUAAGUGUAGAUACUUCAGUGGCAUGCCUGCAGCCCG crRNA-ww2 (SEQ ID NO: 10) UAAUUUCUACUAAGUGUAGAUACUUCAUUGUAUGCCUGCAGCCCG

[0044] 1.3 CRISPR Cas12a detection

[0045] The CRISPRCas12a reaction system is as follows: the final concentration is 33nM LbaCas12a (NEBiolabs), 3uL Nebbuffer 2.1 (NEBiolabs), the final concentration is 33nM crRNA, the final concentration is 50nM F-Q fluorescence quenching probe (FAM-TTATT-Quencher), the final concentration is 8nM reference plasmid, DEPC water is supplemented to a final volume of 30uL, and the reaction is carried out in a transparent tube at 37°C for 60 minutes, and the fluorescence intensity is detected by a fluorescent quantitative PCR instrument (Tianlong Gentier 96R). A total of 16 groups are set up, each with 3 replicate wells of the same configuration, and each group is composed of different reference plasmid and crRNA sequence combinations (the selection of crRNA and reference plasmid in each group is shown in Table 2), among which the Neg group contains only reference plasmids and no crRNA.

[0046] Table 2: Experimental group design (numbers refer to groups)

[0047]

[0048] The reaction results are as follows Figure 1As shown, the X-axis represents the fluorescence intensity, the vertical axis represents the crRNA group, the left side is the detection result of the wild-type sequence, and the right side is the detection result of the mutant sequence, and the sequence concentration is 100ng / uL. Among them, crRNA-WT is a guide RNA that completely matches the wild-type sequence. The results show that it can produce high-intensity fluorescence with the wild-type sequence and obvious fluorescence with the mutant sequence (>750); crRNA-ww1 and ww2 are guide RNAs with one mismatch with the wild-type sequence and two mismatches with the mutant sequence. The results show that there is no significant fluorescence with the wild-type and mutant sequences (<750); crRNA-MU is a guide RNA that completely matches the mutant sequence. The results show that it can produce high-intensity fluorescence with the mutant sequence and obvious fluorescence with the wild-type sequence (>800 ); crRNA-mm1, mm2, and mm3 are guide RNAs with one mismatch with the mutant sequence and two mismatches with the wild type. The results showed that mm2 produced obvious fluorescence with the mutant and fluorescence with the wild type, and mm3 had significant fluorescence with both the wild type and mutant sequences (<750); mm1 produced obvious fluorescence with the mutant (mean 3756.7) and insignificant fluorescence with the wild type (mean 681.3), which can be used to distinguish between the wild type and ALDH2*2 mutations; when there was no crRNA, neither the wild type sequence nor the mutant sequence had obvious fluorescence.

[0049] It can be seen that crRNA-mm1 has a higher recognition effect on ALDH2 mutant sequences, while the fluorescence detection result for ALDH2 wild-type sequences is low. At the same time, other crRNA sequences do not have a significant distinguishing effect on ALDH2 wild-type and ALDH2*2 gene c.1510G>C mutant, so the present invention selects crRNA-mm1 as a feasible crRNA sequence for the experiment of identifying ALDH2 mutant genes.

[0050] Example 2. Screening of optimal RPA primers for crRNA

[0051] RPA primer design According to the design principle, three upstream primers and three downstream primers were selected on the NC_000012.12:111803796-111804368 sequence, and two of them were matched to form 9 experimental groups of RPA reaction systems (see Table 4 for details). The most suitable RPA primers were selected by performing CRISPRCas12a detection on the RPA reaction products and comparing the fluorescence intensity.

[0052] In this embodiment, the RPA amplification system is as follows: Rehydration buffer dissolves Lyophilized powder, add 2.4uL 10mM RPA upstream primer, 2.4uL 10mM RPA downstream primer; the RPA upstream primer and RPA downstream primer are shown in Table 3, mix well, add reference sequence plasmid to a final concentration of 0.5nM; add 2.5ul MgOAc solution, add DEPC water to 50uL, heat in a 37℃ metal bath to start amplification for 10 minutes, and obtain the amplification product;

[0053] Table 3: RPA sequences

[0054] Primer name sequence RPA-1F (SEQ ID NO: 11) CCTGGGAGTGTAACCCATAACCCCCAAGAGTG RPA-2F (SEQ ID NO: 12) CCAGTCACCCTTTGGTGGCTACAAGATGTCG RPA-3F (SEQ ID NO: 13) CTCGTTTCAAATTACAGGGTCAACTGCTATG RPA-1R (SEQ ID NO: 14) CAGCAGACCCTCAAGCCCCAACAGGCCCTGAGC RPA-2R (SEQ ID NO: 15) CCAACAGACCCCAATCCCCCAGCAGGCTCC RPA-3R (SEQ ID NO: 16) TGGGAAATTAGTAGGAAACACTGATGGCCTC

[0055] The CRISPRCas12a experimental system is as follows: crRNA-mm1 with a final concentration of 33nM, LbaCas12a with a final concentration of 33nM (NEBiolabs), 3uL Nebbuffer 2.1 (NEBiolabs), and a final concentration of 50nM FQ fluorescence quenching probe, and 2uL of the RPA amplification product obtained in the previous step was added, and DEPC water was supplemented to 30uL. After reacting in a transparent tube at 37°C for 60 minutes, the fluorescence intensity was detected using a fluorescent quantitative PCR instrument (CFX96, BioRad). A total of 9 experimental groups and 1 blank control group were set as described above, for a total of 10 groups (as shown in Table 4), each group was set with 3 replicate wells (same setting to meet statistical requirements), each group was amplified by different RPA primers, and the Neg group was a primer-free RPA product.

[0056] Table 4 Grouping of upstream and downstream primers corresponding to RPA amplification products in each group (where numbers represent groups)

[0057]

[0058] RPA screening results are as follows Figure 2 As shown, all RPA primers had significant amplification effects, among which group 8 (RPA-3F / RPA-2R) had the best effect and was selected for subsequent amplification experiments.

[0059] Example 3. Detection method sample verification

[0060] The sample testing process is as follows: oral epithelial cell collection, DNA extraction, RPA amplification, and CRISPRCas12a detection. The control detection method is first-generation sequencing.

[0061] 3.1 DNA extraction of test samples

[0062] Oral epithelial cells of the subjects were obtained by oral swab, and DNA was extracted from the samples according to the instructions of the oral epithelial cell DNA extraction kit (B58268, Sangon Biotechnology Co., Ltd.).

[0063] 3.2 RPA amplification reaction

[0064] The RPA amplification system of this experiment is as follows: Rehydration buffer dissolves Lyophilized powder, add 2.4uL 10mM RPA-3F upstream primer, 2.4uL 10mM RPA-2R downstream primer and mix thoroughly; add 2uL of the sample to be tested; add MgOAc solution, add DEPC water to 50uL. Heat in a 37℃ metal bath to start amplification for 10 minutes to obtain the amplification product;

[0065] 3.3 CRISPR Cas12a detection

[0066] The CRISPRCas12a experimental system is as follows: crRNA-mm1 at a final concentration of 33nM, LbaCas12a at a final concentration of 33nM (NEBiolabs), 3uL Nebbuffer2.1 (NEBiolabs), and a final concentration of 50nM FQ fluorescent quenching probe. Add 2uL of the RPA amplification product from the previous step and add DEPC water to 30uL. After reacting in a transparent tube at 37°C for 60 minutes, the fluorescence intensity was detected using a fluorescent quantitative PCR instrument (CFX96, BioRad).

[0067] 3.4 Sample first generation sequencing

[0068] The true result of the sample ALDH2 gene sequence was obtained by first-generation sequencing. Specifically, the DNA obtained in step 3.1 was subjected to PCR amplification, the PCR primers were [F (SEQ ID NO: 17) -GGTCCTGGGAGTGTAACCCA; R (SEQ ID NO: 18) -CAGGCCTTGGCGTATAACGA], the kit was the Vazyme C112 PCR amplification kit, the reaction system was configured according to the kit instructions, the reaction procedure was 95 degrees for 3 minutes of pre-denaturation, three-stage cycle: 95 degrees for 15 seconds, 56 degrees for 15 seconds, 72 degrees for 15 seconds, a total of 25 cycles, and 72 degrees for 5 minutes of extension. The PCR product was entrusted to Shanghai Sangon Biotechnology Co., Ltd. for first-generation sequencing. The obtained results were compared with the detection results of the present invention, such as Figure 3 As shown, + / - indicates that the first-generation sequencing results contain / do not contain ALDH2 mutation points, while the results of this method do not match the sequencing; the color indicates the detection fluorescence value of the present invention. Compared with the first-generation sequencing results, the accuracy of the present invention is 98.15%.

[0069] 3.5 Test strips for CRISPR test result output

[0070] In order to facilitate the rapid output of test results, we use colloidal gold test strips for result presentation. The experimental process is: oral epithelial cell collection, DNA extraction, RPA amplification, and CRISPRCas12a test strip method. The first three processes are as described above. The CRISPRCas12a test strip method system includes:

[0071] crRNA-mm1 with a final concentration of 33nM, LbaCas12a with a final concentration of 33nM (NEBiolabs), 3uL Nebbuffer2.1 (NEBiolabs), 2uL of the RPA amplification product obtained in the previous step, and DEPC water added to 30uL. After reacting in a transparent tube at 37°C for 60 minutes, insert the CRISPR single system test strip FAM / FITC test strip, which comes from the CRISPR-LFA ssDNA reporter (#31201) of Tolo Harbour Company. Interpret the results according to the test strip instructions. Figure 4 The results of ALDH2 mutant and ALDH2 wild-type detection. Both quality control lines have bands, while the detection line only shows bands for the mutant type.

[0072] Experimental results of Examples 1-3:

[0073] 1. As Figure 1 As shown, the crRNA-WT that completely matches the wild strain can bind to both the wild strain sequence and the mutant strain sequence at the same time, stimulating enzymatic activity, and cannot distinguish between the two. The crRNA-MT that completely matches the mutant strain can bind to both the mutant strain sequence and the wild strain sequence at the same time, and cannot distinguish between the two. In the crRNA design of the present application, a small amount of mismatched bases are added to distinguish between the wild type and mutant types of ALDH2; the results showed that crRNA-Mm1 reacted significantly with the mutant strain and had no obvious reaction with the wild strain. This crRNA can clearly distinguish between the wild strain and the mutant strain. Therefore, it was used for subsequent detection;

[0074] 2. If Figure 2 As shown, RPA-7 produced a higher fluorescence value and was used for subsequent detection;

[0075] 3. Such as Figure 3 As shown, among the 162 tested samples, 58 of the 60 mutant samples were tested as mutation-positive, and 2 were mutation-negative (false negative), with a sensitivity of 96.67%; among the 102 wild-type samples, 101 were mutation-negative, and 1 was mutation-positive (false positive), with a specificity of 99.01% and a detection accuracy of 98.15%;

[0076] 4. Such as Figure 4 As shown, the test strip can be used to output the sample test results. The wild type has one indicator line, and the mutant type has two indicator lines.

Claims

1. A primer for detecting ALDH2 gene mutation, characterized in that: It comprises RPA specific isothermal amplification primers for ALDH2 gene; the RPA upstream primer sequence of the primer is shown as SEQ ID NO: 13, and the RPA downstream primer sequence of the primer is shown as SEQ ID NO:

15.

2. Use of the primers according to claim 1 in detecting ALDH2 gene mutation.

3. An ALDH2 gene mutation detection kit constructed by the primers according to claim 1, characterized in that: It includes the RPA specific isothermal amplification primers for the ALDH2 gene and the CRISPR-Cas12a detection system; the CRISPR-Cas12a detection system is a CRISPR-Cas12a fluorescence detection system or a CRISPR-Cas12a test paper detection system; the CRISPR-Cas12a detection system includes a specific crRNA and a Cas12a protein for the c.1510G>C mutation point of the ALDH2*2 gene; wherein the sequence of the specific crRNA is shown in SEQ ID NO: 6; the CRISPR-Cas12a detection system also includes 10×NEBuffer 2.1 and DEPC water.

4. The kit according to claim 3, characterized in that The CRISPR-Cas12a fluorescence detection system also includes a ssDNA fluorescent probe, which is a single-stranded DNA probe doubly labeled with a fluorescent group and a fluorescent quencher group; the sequence of the single-stranded DNA probe is FAM-TTATT-Quencher; and the Cas12a protein is LbCas12a protein.

5. The kit according to claim 3, characterized in that The CRISPR-Cas12a test paper detection system also includes a CRISPR-LFA ssDNA reporter with a final concentration of 100 nM; the Cas12a protein is LbCas12a protein.

6. A method for detecting ALDH2 gene mutation based on the kit according to claim 3, 4 or 5, characterized in that: The steps include: 1) obtaining the kit according to claim 3; 2) obtaining a sample to be tested, and performing isothermal amplification based on the RPA-specific isothermal amplification primers described in claim 4 to obtain an RPA amplification product; 3) using the CRISPR-Cas12a system described in claim 4 to identify, cut and activate the RPA amplification product obtained in step 2) to obtain a cleavage product; 4) The cleavage product obtained in step 3) is detected by the CRISPR-Cas12a detection system; and combined with the first-generation sequencing results of the cleavage product, the c.1510G>C point mutation of the ALDH2*2 gene is detected; The isothermal temperature in step 2) is set to any temperature within the range of 37-42°C.

7. The method according to claim 6, characterized in that The result of the CRISPR single system test strip in step 4) is read as follows: both the mutant and wild-type quality control lines have bands, and only the mutant test line shows a band; the fluorescence color development judgment is specifically as follows: a fluorescence value higher than 750 indicates that the ALDH2*2 gene c.1510G>C mutation point is carried, wherein a fluorescence value lower than 750 indicates that the ALDH2*2 gene c.1510G>C mutation point is not carried.

8. The method according to claim 6, characterized in that The RPA amplification system is as follows: 2.4uL 10mM RPA upstream primer, 2.4uL 10mM RPA downstream primer, mixed and added to the sample to be tested to a final concentration of 0.5nM; then added MgOAc solution was added with DEPC water to 50uL, and amplification was started by heating in a 37°C metal bath for 10 minutes to obtain the RPA amplification product.

9. The method according to claim 6, characterized in that The CRISPR-Cas12a fluorescence detection system is as follows: crRNA with a final concentration of 33 nM, LbaCas12a with a final concentration of 33 nM, 3 uL Nebbuffer2.1, and a fluorescence quenching probe with a final concentration of 50 nM, 2 uL of the RPA amplification product obtained in step 2) is added, and DEPC water is added to 30 uL; the fluorescence intensity is detected after reacting at 37 ° C for 60 minutes.

10. The method according to claim 6, characterized in that The CRISPR-Cas12a test paper detection system is as follows: crRNA with a final concentration of 33nM, LbaCas12a with a final concentration of 33nM, 3uL Neb buffer 2.1, 2uL of the RPA amplification product obtained in step 2), and DEPC water added to 30uL; after reacting at 37°C for 60 minutes, insert CRISPR-LFAssDNA reporter with a final concentration of 100nM to read the results.

Images