Reagent combination, kit and method for detecting drug-resistant mutation sites of mycoplasma pneumoniae and 23S rRNA (ribosomal Ribonucleic Acid) genes of mycoplasma pneumoniae

Abstract

The invention discloses a reagent combination, a kit and a method for detecting mycoplasma pneumoniae and 23S rRNA (ribosomal Ribonucleic Acid) gene drug-resistant mutation sites of the mycoplasma pneumoniae, and belongs to the technical field of microbiological detection. Wherein the 23S rRNA gene drug-resistant mutation site is a C2617G mutation site, and the reagent combination comprises a first primer combination and a first probe which are used for detecting the mycoplasma pneumoniae P1 protein gene, and a second primer combination and a second probe which are used for detecting the drug-resistant mutation site; the kit comprises a positive quality control product, a negative quality control product and / or a wild type quality control product, and is used for ensuring the accuracy of a detection result. When the reagent combination, the kit and the method are used for detection, high accuracy and sensitivity are achieved.

Description

Technical Field

[0001] The present application relates to the technical field of microbial detection, and in particular to a kit and method for detecting Mycoplasma pneumoniae and its 23S rRNA gene mutation sites. Background Art

[0002] Mycoplasma pneumoniae ( Mycoplasma pneumoniae , MP) is one of the 16 mycoplasmas isolated from human respiratory and urogenital specimens. It belongs to the Soft-Coated Fungus and is one of the smallest single-cell organisms known to be able to live independently. Mycoplasma pneumoniae can infect the upper and lower respiratory tracts and can be prevalent in individuals of all ages worldwide. Children are the most susceptible population. The main symptoms of infection include headache, sore throat, fever, cough and other common respiratory symptoms. It can be transmitted through droplets and often spread within families or communities. The incubation period is 2 to 4 weeks. Mycoplasma pneumoniae is one of the main pathogens causing community-acquired respiratory infections in children and adults, and is the main pathogen of community-acquired pneumonia (CAP) in childhood. Epidemiological studies have shown that infection with Mycoplasma pneumoniae is sporadic throughout the year, but its incidence is higher in late autumn or winter, with an epidemic peak every 3-7 years. Therefore, Mycoplasma pneumoniae is a respiratory pathogen that deserves close attention.

[0003] Due to the lack of a cell wall, Mycoplasma pneumoniae is naturally resistant to antibiotics that act on the cell wall, such as β-lactam antibiotics and other antibiotics that inhibit cell wall synthesis. Macrolides, tetracyclines, and fluoroquinolones have better performance in the clinical treatment of Mycoplasma pneumoniae infections, but tetracyclines and fluoroquinolones may affect the development of children and are not recommended for children. Therefore, macrolides, such as erythromycin (14-membered ring) and azithromycin (15-membered ring), are the first choice for the clinical treatment of Mycoplasma pneumoniae pneumonia in children. They inhibit bacterial growth by binding to 23SrRNA to inhibit protein synthesis. Due to their high oral bioavailability and once-daily dosage form, macrolide antibiotics are widely used in outpatient settings. However, in the past 10 years, macrolide-resistant Mycoplasma pneumoniae (Macrolide-Resistant Mycoplasma pneumoniae , MRMP) have emerged worldwide.

[0004] Macrolide antibiotics act on the 50S ribosomal subunit to inhibit protein synthesis, which is related to the central loop of domain V of 23S rRNA. The nucleotides in the central loop are essential components of the macrolide antibiotic binding site. 23S rRNA mutations lead to changes in ribosome conformation, thereby changing the macrolide antibiotic binding site, which may be the cause of its resistance. The 23S rRNA mutation sites that have been discovered include 2063, 2064, 2617, 2067, etc. Among them, the most common A2063G mutation shows resistance to 14-ring macrolides, A2064G shows resistance to 14-ring and 16-ring macrolides, C2617G shows resistance to 14-membered and 15-membered macrolides, and A2067G shows resistance to yosamycin. Given that A2063G is the most common mutation type, a large number of studies and technologies have been conducted to detect the A2063G mutation in Mycoplasma pneumoniae. At the same time, erythromycin and azithromycin, commonly used drugs for the treatment of Mycoplasma pneumoniae in children, are 14-membered and 15-membered macrolide antibiotics, respectively.

[0005] At present, the commonly used clinical methods for detecting Mycoplasma pneumoniae infection include MP pathogen culture, MP antigen direct detection, MP serum antibody detection, MP nucleic acid detection, etc. Different detection methods have their own advantages and limitations.

[0006] MP pathogen culture: MP grows slowly, has strict requirements on the culture environment, has a long culture cycle, and has low sensitivity. It can be used for strain identification, typing, and drug sensitivity testing, but the culture cycle is longer: (1) Direct detection of MP antigen: high specificity but low sensitivity, which can easily lead to false negative results.

[0007] (2) MP serum antibody test: The test is simple and the results are available quickly, which is suitable for rapid screening. However, the sampling method is invasive and has poor sensitivity.

[0008] (3) MP nucleic acid detection: It has the characteristics of high sensitivity and specificity, but different nucleic acid detection methods also have their own advantages and disadvantages.

[0009] ① Sequencing technology: multiple detection targets and good specificity, but complicated operation, long detection cycle and high cost; ② Ordinary PCR technology: low cost, wide application, simple operation, but easy to contaminate and unable to distinguish single nucleotide polymorphisms; ③ Fluorescence quantitative PCR technology: It has the characteristics of simple operation, fast speed, low cost, high sensitivity and good specificity. It is widely used in clinical practice, but well-designed primers are required for single nucleotide polymorphism detection. Summary of the invention

[0010] In order to solve at least one of the above technical problems, this application introduces the Amplification-refractory Mutation System (ARMS) based on fluorescent quantitative PCR technology to detect the C2617G mutation site of Mycoplasma pneumoniae resistant to 14-membered ring and 15-membered ring macrolides. In order to achieve this purpose, the technical solution adopted in this application is as follows: The first aspect of the present application provides a reagent combination for detecting Mycoplasma pneumoniae and its 23S rRNA gene drug-resistant mutation site, wherein the 23S rRNA gene drug-resistant mutation site is a C2617G mutation site, and the reagent combination includes a first primer combination and a first probe for detecting the Mycoplasma pneumoniae P1 protein gene, and a second primer combination and a second probe for detecting the drug-resistant mutation site, wherein: The sequences of the first primer combination are shown as SEQ ID No. 1 and SEQ ID No. 3, respectively, and the sequence of the first probe is shown as SEQ ID No. 2; The sequences of the second primer combination are shown in SEQ ID No. 4 and SEQ ID No. 6, respectively, and the probe sequence is shown in SEQ ID No. 5. The first probe is labeled with a first fluorescent group at its 5' end and a first quencher group at its 3' end, and the second probe is labeled with a second fluorescent group at its 5' end and a second quencher group at its 3' end, wherein the first fluorescent group is different from the second fluorescent group, and the first quencher group and the second quencher group are the same or different.

[0011] Preferably, the first fluorescent group and the second fluorescent group are selected from FAM, CY3, CY-5, ROX, VIC and HEX, respectively, for example, ROX and VIC, or ROX and HEX, respectively.

[0012] Given that the A2063G mutation is the most common mutation type, a large number of studies and technologies have been conducted on the detection of the A2063G mutation in Mycoplasma pneumoniae. At the same time, erythromycin and azithromycin, commonly used Mycoplasma pneumoniae treatment drugs for children, are 14-membered and 15-membered macrolide antibiotics, respectively. Therefore, this application detects the C2617G mutation site of Mycoplasma pneumoniae that exhibits resistance to 14-membered and 15-membered macrolides, which has a very high universality.

[0013] The upstream primer in the second primer combination of the present application is designed based on the principle of amplification-refractory mutation system (ARMS). ARMS utilizes the lack of 3'-5' exonuclease activity of DNA polymerase, and the 3'-terminal base of the PCR primer must be complementary to its template DNA to achieve amplification. The unpaired nucleoside blockade at the 3' end of the primer affects the extension efficiency of the DNA polymerase, so that alleles with a base difference with the ARMS primer cannot be amplified, thereby distinguishing single nucleotide differences in the template. However, the degree of this blockade depends on the type of mismatched bases, such as C / T, A / A, T / T (purine / purine, pyrimidine / pyrimidine) mismatches have a greater impact on the catalytic efficiency of the polymerase than G / T, T / G, A / C, C / A (purine / pyrimidine) mismatches. Therefore, when a pair of mismatched bases at the 3' end are not sufficient to block the amplification reaction, other mismatched bases must be added near the end to enhance the blocking effect. For example, in order to maximize the specificity of primer binding to target DNA, the penultimate or third nucleotide at the 3' end of the primer is often designed as a mismatched base, which is called an enhanced AMRS primer.

[0014] In some embodiments of the present application, a third primer combination and a third probe for detecting the β-actin gene are further included, the sequences of the third primer combination are shown in SEQ ID No. 7 and SEQ ID No. 9, respectively, the sequence of the third probe is shown in SEQ ID No. 8, the 5' end of the third probe is labeled with a third fluorescent group, and the 3' end is labeled with a third quencher group, the third fluorescent group is different from both the first fluorescent group and the second fluorescent group, and the third quencher group is the same as or different from the first quencher group or the second quencher group.

[0015] Preferably, the third fluorescent group is also selected from FAM, CY3, CY-5, ROX, VIC and HEX, but is different from the first fluorescent group and the second fluorescent group. For example, the first fluorescent group, the second fluorescent group and the third fluorescent group are VIC, ROX and CY-5, respectively, or HEX, ROX and CY-5, respectively.

[0016] The β-actin gene is used as the internal standard gene to ensure the accuracy of the whole detection process. Of course, those skilled in the art can also use other genes as internal standard genes.

[0017] The second aspect of the present application provides a kit for detecting Mycoplasma pneumoniae and its 23S rRNA gene drug-resistant mutation site, comprising any reagent combination described in the first aspect of the present application. For example, comprising the first primer combination and the first probe, the second primer combination and the second probe, preferably, further comprising the third primer combination and the third probe.

[0018] In some embodiments of the present application, the kit further includes a positive quality control, a negative quality control and / or a wild-type quality control, wherein the positive quality control includes the nucleotide sequence plasmid of all primer combination amplicons; the difference between the wild-type quality control and the positive quality control is that for the nucleotide sequence plasmid of the second primer combination amplicon, the bases at the corresponding positions of the drug-resistant mutation site are different; the negative quality control is a buffer solution that does not contain any primer combination amplicon.

[0019] In the present application, the validity of the test results can be guaranteed by setting negative quality control products, positive quality control products and wild-type quality control products.

[0020] In some preferred embodiments of the present application, the positive quality control product includes a plasmid containing the sequence shown in SEQ ID No. 10, and the wild-type quality control product includes a plasmid containing the sequence shown in SEQ ID No. 11.

[0021] In some embodiments of the present application, the kit further comprises a PCR buffer, wherein the PCR buffer comprises a buffer, dNTPs, metal ions, and a DNA polymerase.

[0022] Since the ARMS amplification reaction conditions are complex, changing some factors will affect the amplification results, so it is necessary to verify and confirm the optimal dislocation sites, PCR buffer composition, primer types and other conditions of different reaction systems to obtain the optimal PCR reaction system. Furthermore, the PCR buffer also includes UDG enzyme, BSA and / or glycerol. Glycerol and BSA are used to improve the efficiency and specificity of the PCR reaction, and UDG enzyme is used to reduce the risk of false positive reactions caused by PCR products.

[0023] The third aspect of the present application provides a method for detecting Mycoplasma pneumoniae and its 23S rRNA gene drug-resistant mutation site, comprising the following steps: S1, obtaining a nucleic acid sample of a biological sample to be tested; S2, using the first primer combination and the first probe and the second primer combination and the second probe as described in claim 1 to perform fluorescent quantitative PCR amplification detection on the nucleic acid sample obtained in step S1; S3, according to the Ct value of the test result, use the following table to determine whether Mycoplasma pneumoniae exists in the biological sample to be tested, and if so, whether the Mycoplasma pneumoniae has a drug-resistant mutation:

[0024] Wherein, Ct1 represents the Ct value obtained by detecting the first primer combination, Ct2 represents the Ct value obtained by detecting the second primer combination, and ΔCt=Ct2-Ct1.

[0025] In some embodiments of the present application, step S2 also includes using the third primer combination and the third probe described in claim 2 to perform fluorescent quantitative PCR amplification detection on the nucleic acid sample obtained in step S1. If the Ct value obtained by amplification by the third primer combination is not greater than 35, the judgment described in step S3 is performed.

[0026] In some embodiments of the present application, the program of the fluorescent quantitative PCR amplification is: 50°C 2min; 95°C 2min; 91°C 15sec, 64°C 1min, 35-42 cycles.

[0027] In the present application, the method is a method not for diagnostic or therapeutic purposes.

[0028] Compared with the prior art, this application has the following beneficial effects: The primer combination for detecting Mycoplasma pneumoniae and its 23S rRNA gene C2617G mutation site involved in the reagent combination and kit of the present application is based on the principle of mutation amplification blocking system (ARMS), that is, the ARMS method is used to specifically identify the 2617 mutation site in the drug-resistant strain of Mycoplasma pneumoniae. The primer combination of the reagent combination or the kit targets the detection site of the conserved domain of the Mycoplasma pneumoniae genome, ensuring that the determination of the C2617G mutation site is performed on the basis of Mycoplasma pneumoniae.

[0029] This application uses multiplex fluorescence PCR technology based on ARMS technology to detect Mycoplasma pneumoniae. The detection cycle is much shorter than the "gold standard" pathogen culture and NGS and Sanger whole genome sequencing methods for judging MP infection, which is at least 4-7 days or even 21 days or longer for pathogen culture and more than 24 and 10-12 hours for NGS and Sanger whole genome sequencing methods, respectively.

[0030] The method of the present application combines the amplification step and the judgment step together, shortening the detection time to 3-4 hours. Compared with NGS and Sanger whole genome sequencing methods, the cost and operation complexity are greatly reduced, and the result data analysis is also much simpler; at the same time, the requirements for technical skills are relatively low, the training requirements for personnel are also relatively low, and the interpretation of the results is universal.

[0031] Direct detection of MP antigens is sensitive and prone to false negative results, with a sensitivity of only 60%-70% of that of the PCR method. Detection using the reagent combination, kit and method of the present application has high accuracy and sensitivity.

[0032] It should be understood that the content described in this section is not intended to identify the key or important features of the embodiments of the present application, nor is it intended to limit the scope of the present application. Other features of the present application will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] By reading the detailed description below with reference to the accompanying drawings, the above and other purposes, features and advantages of the exemplary embodiments of the present application will become easily understood. In the accompanying drawings, several embodiments of the present application are shown in an exemplary and non-limiting manner, wherein: Figure 1 The amplification efficiency and detection limit amplification curves of the three sets of primer probe combinations designed for the P1 protein gene in Example 1 of the present application are shown. A: amplification efficiency of primer probe combination 1 of the P1 protein gene, B: detection limit of primer probe combination 1 of the P1 protein gene; C: amplification efficiency of primer probe combination 2 of the P1 protein gene, D: detection limit of primer probe combination 2 of the P1 protein gene; E: amplification efficiency of primer probe combination 3 of the P1 protein gene, F: detection limit of primer probe combination 3 of the P1 protein gene.

[0034] Figure 2 The amplification efficiency and different concentration sample detection curves of the three sets of primer probe combinations designed for the human β-actin gene in Example 1 of the present application are shown. A: Amplification efficiency of human β-actin gene primer probe combination 1, B: Detection curves of samples of different concentrations of human β-actin gene primer probe combination 1; C: Amplification efficiency of human β-actin gene primer probe combination 2, D: Detection curves of samples of different concentrations of human β-actin gene primer probe combination 2; E: Amplification efficiency of human β-actin gene primer probe combination 3, F: Detection curves of samples of different concentrations of human β-actin gene primer probe combination 3.

[0035] Figure 3 The amplification curves of the primer-probe combination 12 designed for the C2617G mutation site of the Mycoplasma pneumoniae 23S rRNA gene in Example 1 of the present application for the wild template and the mutant template are shown, A: wild template; B: mutant template.

[0036] Figure 4The results of amplification efficiency, tolerance, detection limit and UDG enzyme anti-pollution test using buffer 1 and buffer 2 respectively in Example 2 of the present application are shown, A: amplification efficiency of buffer 1, B: amplification efficiency of buffer 2; C: tolerance of buffer 1, D: tolerance of buffer 2; E: detection limit of buffer 1, F: detection limit of buffer 2; G: UDG enzyme anti-pollution effect of buffer 1, H: UDG enzyme anti-pollution effect of buffer 2.

[0037] Figure 5 The amplification curves of the C2617G mutation site and Mycoplasma pneumoniae detection for samples with different copy numbers in Example 5 of the present application are shown, A: C2617G mutation site detection amplification curve of 400 copies / mL sample; B: Mycoplasma pneumoniae detection amplification curve of 400 copies / mL sample; C: C2617G mutation site detection amplification curve of 200 copies / mL sample; D: Mycoplasma pneumoniae detection amplification curve of 200 copies / mL sample; E: C2617G mutation site detection amplification curve of 100 copies / mL sample; F: Mycoplasma pneumoniae detection amplification curve of 100 copies / mL sample. DETAILED DESCRIPTION

[0038] Unless otherwise indicated, implied from the context, or customary in the prior art, all parts and percentages in this application are based on weight, and the tests and characterization methods used are all synchronized with the filing date of this application. Where applicable, the contents of any patent, patent application or disclosure involved in this application are fully incorporated herein by reference, and their equivalent patent families are also introduced as references, especially the definitions of relevant terms in the art disclosed in these documents. If the definition of a specific term disclosed in the prior art is inconsistent with any definition provided in this application, the definition of the term provided in this application shall prevail.

[0039] Numerical ranges in this application are approximate values, so unless otherwise specified, they may include values ​​outside the range. Numerical ranges include all values ​​from the lower limit to the upper limit increased by 1 unit, provided that there is an interval of at least 2 units between any lower value and any higher value. For a range containing a value less than 1 or containing a fraction greater than 1 (e.g., 1.1, 1.5, etc.), 1 unit is appropriately regarded as 0.0001, 0.001, 0.01 or 0.1. For a range containing a single digit less than 10 (e.g., 1 to 5), 1 unit is generally regarded as 0.1. These are only specific examples of what is intended to be expressed, and all possible combinations of the values ​​between the lowest and highest values ​​listed are considered to be clearly recorded in this application.

[0040] The terms "comprising", "including", "having" and their derivatives do not exclude the presence of any other components, steps or processes, and are irrelevant to whether these other components, steps or processes are disclosed in this application. To eliminate any doubt, unless explicitly stated, all compositions using the terms "comprising", "including", or "having" in this application may include any additional additives, adjuvants or compounds. On the contrary, except for those necessary for operating performance, the term "essentially consisting of..." excludes any other components, steps or processes from the scope of any description of the term below. The term "consisting of..." does not include any components, steps or processes that are not specifically described or listed. Unless explicitly stated, the term "or" refers to the listed individual members or any combination thereof.

[0041] In order to make the technical problems, technical solutions and beneficial effects solved by the present application more clearly understood, the present application is further described in detail below in conjunction with embodiments.

[0042] The following examples are used to demonstrate the preferred embodiments of the present application. It will be understood by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present application, and therefore can be considered as preferred embodiments of the present application. However, it should be understood by those skilled in the art based on this specification that many modifications can be made to the specific embodiments disclosed herein, and still the same or similar results can be obtained without departing from the spirit or scope of the present application.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0044] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many technical equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

[0045] The experimental methods in the following examples are conventional methods unless otherwise specified. The instruments and equipment used in the following examples are conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0046] Example 1 Primer probe screening 1. Screening of primer-probe combinations for P1 protein gene First, the P1 protein coding gene sequence of Mycoplasma pneumoniae was searched in the NCBI database, and the conserved region of the gene sequence was found through sequence comparison to design primers and probes for Mycoplasma pneumoniae detection.

[0047] A total of three sets of primer-probe combinations targeting the P1 protein encoding gene were designed, as shown in Table 1.

[0048] Table 1 Primer-probe combinations for P1 protein coding gene

[0049] The amplification efficiency (4 gradients: 2 × 10 7 copies / mL, 2×10 6 copies / mL, 2×10 5 copies / mL and 2×10 4 copies / mL) and sensitivity (10 replicates) were tested. The test results are shown in Figure 1 And as shown in Table 2.

[0050] Table 1 Detection results of primer-probe combination for P1 protein gene (Ct value)

[0051] Among them, NoCt means that no Ct value was detected.

[0052] Depend on Figure 1 As shown in Table 2, combination 1 has good amplification efficiency and uniform Ct value differences between 10-fold dilution gradients, while the detection limit is 100% and the CV is minimal.

[0053] 2. Screening of primer and probe combinations for human β-actin internal standard gene In order to ensure the accuracy of the entire process from sampling to detection, the human β-actin gene was used as the internal standard gene. For the internal standard gene, 3 pairs of primer probe combinations were also designed, as shown in Table 3.

[0054] Table 3 Primer and probe combinations for human β-actin encoding gene

[0055] The amplification efficiency (2 gradients: 2 × 10 6 copies / mL and 2×10 4 copies / mL) and 6 clinical samples were tested. The test results are shown in Figure 2 And as shown in Table 4.

[0056] Table 4 Detection results of primer-probe combination for human β-actin gene (Ct value)

[0057] Depend on Figure 2As shown in Table 4, the difference in Ct values ​​between the 100-fold dilution gradients of the amplification efficiency of the primer-probe combination 3 of the human β-actin gene is closest to the theoretical value of 6.6, and the overall Ct value of the 6 samples is the smallest among the three combinations, while presenting a typical S-shaped curve. Therefore, for the human β-actin gene, the corresponding primer-probe combination 3 was screened and obtained.

[0058] 3. Screening of primer combinations for mutation detection at the C2617G site of the 23S rRNA gene The mutation detection primers for the C2617G mutation site of the 23S rRNA gene of Mycoplasma pneumoniae were designed according to the ARMS method. The primers were designed from both the forward and reverse directions of the sequence. The penultimate or third nucleotide of the 3' end of the mutation detection primer was added as a mismatch base, and no mismatch was added. Three different sequence lengths were covered, and finally 42 mutation detection primers to be screened were obtained. Then, the conserved gene sequence near C2617G was searched by sequence alignment, and conservative primers and probes were designed to adapt to the forward and reverse mutation detection primers, respectively, to obtain 42 primer-probe combinations, as shown in Table 5.

[0059] Table 5 Primer-probe combinations for the C2617G site of the 23S rRNA gene

[0060] The 42 primer-probe combinations in Table 5 were used to perform tolerance (wild template) and sensitivity (mutant template) tests, and the results are shown in Table 6.

[0061] Table 6 Detection results of primer-probe combination at C2617G site of 23S rRNA gene

[0062] As shown in Table 6, when using combination 12 for detection, there is no amplification for the wild template, and for the mutant template, the Ct value is at the top among the 42 combinations. In general, combination 12 performs best among the 42 combinations.

[0063] The amplification curves of the 12 pairs of wild templates and mutant templates are shown in Figure 3 , indicating that combination 12 can clearly distinguish between wild-type templates and mutant templates.

[0064] Through the screening of this example, primer-probe combinations of three channels were finally obtained, and the specific primer-probe sequence information is shown in Table 7.

[0065] Table 7 Primer probe combinations obtained using

[0066] Example 2 Screening of PCR Detection Buffer The PCR reaction is carried out under the action of DNA polymerase. The primers on the DNA template use dNTPs (including dNUP) as raw materials and synthesize a new chain complementary to the template DNA chain according to the principles of AT and CG base pairing and semi-conservative replication. The whole process consists of three basic reaction steps: denaturation-annealing-extension.

[0067] Each component and its concentration in the PCR reaction system plays a vital role in the normal progress of the PCR reaction, including DNA polymerase, Mg 2+ , K + , dNTPs, Tris-HCl, etc. + It can promote primer annealing, but too high a concentration will inhibit the activity of TaqDNA polymerase. 2+ It has a significant impact on the specificity and yield of PCR amplification. At the same time, the entire PCR reaction needs to be carried out under appropriate pH conditions. The reaction system can be adjusted to appropriate pH conditions by Tris-HCl. In addition, glycerol and BSA are added to the PCR detection buffer to improve the efficiency and specificity of the PCR reaction.

[0068] A total of two component combinations are designed for the PCR detection buffer, as shown in Table 8.

[0069] Table 8 PCR detection buffer composition

[0070] The primer-probe combination screened in Example 1 was used to perform amplification efficiencies (mutant template, 4 gradients: 10 7 copies / mL, 10 6 copies / mL, 10 5 copies / mL and 10 4 copies / mL), tolerance (wild template, 4 gradients: 10 9 copies / mL, 10 8 copies / mL, 10 7 copies / mL and 10 6 copies / mL), detection limit (mutant template, 10 repeats) and UDG enzyme anti-contamination test (PCR product), the results are as follows Figure 4 and as shown in Table 9.

[0071] Table 9 Test results of different PCR detection buffers

[0072] Depend on Figure 4As shown in Table 9, the detection using buffer 1 has good amplification efficiency and uniform Ct value differences between 10-fold dilution gradients, stronger tolerance to wild templates and better detection limits; at the same time, both buffers completely remove PCR products. In general, buffer 1 performs better, and buffer 1 is used for subsequent detection.

[0073] Example 3 Preparation of a kit for detecting Mycoplasma pneumoniae and its 23S rRNA gene C2617G mutation site 1. Preparation of primer and probe working solution (1) Centrifuge the centrifuge tube containing the primer probe dry powder obtained by screening in Example 1 at 4000-12000 rpm for 60 seconds.

[0074] (2) Use 1×TE Buffer as the primer probe dilution buffer and dissolve the primer probe to a final concentration of 20 μM. Close the lid and vortex for 60 s. During the vortexing, invert up and down 6 times with an interval of about 15 s. Centrifuge at 4000-12000 rpm for 60 s.

[0075] (3) Prepare each primer and probe working solution according to Table 10. Prepare a mixed solution for each group. Vortex and shake for 60 seconds with the lid closed. During the shaking, turn it upside down 6 times with an interval of about 15 seconds. Centrifuge at 4000-12000 rpm for 60 seconds.

[0076] Table 10 Preparation of primer and probe working solution

[0077] 2. Preparation of PCR Assay Buffer Prepare PCR buffer according to Table 11: Table 11 PCR buffer preparation table

[0078] 3. Preparation of positive control, wild-type control and negative control The kit is equipped with positive quality control, wild-type quality control and negative quality control to monitor the effectiveness of the entire process from extraction to detection. The negative quality control is 1×TE, while the positive quality control is a nucleotide sequence plasmid containing all primer amplicons. The wild-type quality control and the positive quality control differ by only one base at position 2617, that is, the positive quality control has base G at position 2617, while the wild-type quality control has base C at position 2617.

[0079] The specific sequence is as follows: Positive control sequence (SEQ ID No. 10): GCAGATCACCTTTAACCCCTTTGGCGGCTTTGGTTTGAGTGGGGCTGCACCCCAACAGTGAAACGAGGTCAAAAACAAGGTCCCCGTCGAGGTGGCGCAAGACCCCTCCAATCCTTATCGGTTTGCCGTTTTACTCGTGCCAACGTTCAAACCGTCGTGAGACAGGTTGGTCGCTATCTATTGTGCCCGTAGG AAGATTGAAGAGTGTTGCTTCTAGTACGAGAGGACCGAAGCGAGGACACCTCTTATGCTCCAGTTGTAGCGCCAGCTGCACCTAACACTGGCTCGTGTGACAAGGCCATGAGGCTGGTGTAAAGCGGCCTTGGAGTGTGTATTAAGTAGGCGCACAGTAGGTCTGAACAGACTCCCCATCCCAAGACCCCAGCA Wild-type control sequence (SEQ ID No. 11): GCAGATCACCTTTAACCCCTTTGGCGGCTTTGGTTTGAGTGGGGCTGCACCCCAACAGTGAAACGAGGTCAAAAACAAGGTCCCCGTCGAGGTGGCGCAAGACCCCTCCAATCCTTATCGGTTTGCCGTTTTACTCGTGCCAACGTTCAAACCGTCGTGAGACAGGTTGGTCCCTATCTATTGTGCCCGTAGG AAGATTGAAGAGTGTTGCTTCTAGTACGAGAGGACCGAAGCGAGGACACCTCTTATGCTCCAGTTGTAGCGCCAGCTGCACCTAACACTGGCTCGTGTGACAAGGCCATGAGGCTGGTGTAAAGCGGCCTTGGAGTGTGTATTAAGTAGGCGCACAGTAGGTCTGAACAGACTCCCCATCCCAAGACCCCAGCA The positive control plasmid and the wild-type control plasmid were diluted with 1×TE buffer, and 7 gradients (D1~D7) were diluted. The first two high concentrations (D1 and D2) were diluted 100 times, and 10-fold gradient dilutions were taken from D3. The Ct values ​​of D2-D7 of the two plasmids were detected respectively, and the dilution gradients with Ct values ​​of 23.00~27.00 in the VIC channel were selected as positive control products and wild-type control products.

[0080] 1×TE was used as a negative control.

[0081] Example 4 Application of the kit 1. System configuration The reaction system was prepared according to Table 12: Table 12 System configuration table

[0082] 2. Reaction Procedure The collection of fluorescence signals was set to ROX (C2617G mutation), HEX / VIC (P1 protein gene) and CY5 (internal standard gene), and the data collection was set to 64°C in step 3. When using the ABI7500 instrument, set the "Quencher" column to "none" and the "passive reference" column to "none". The specific reaction procedure is as shown in Table 13: Table 13 Reaction procedure

[0083] 3. Results Analysis After the reaction is completed, the instrument automatically saves the results, analyzes the image, and adjusts the Start value, End value, and Threshold value of the Baseline (the Start value can be between 3-15, and the End value can be between 5-20).

[0084] The ROX fluorescence, HEX / VIC fluorescence and CY5 fluorescence channels of the negative control should be negative; the Ct values ​​of the ROX fluorescence, HEX / VIC fluorescence and CY5 fluorescence of the positive control should all be ≤30.00; the HEX / VIC and CY5 fluorescence Ct values ​​of the wild-type control should be ≤30.00, and the ROX fluorescence channel should be negative. When all three conditions are met, the results are analyzed.

[0085] The details are as follows: (1) In general, the Ct value of the internal standard is ≤35.00; however, if the internal standard is not amplified due to the high concentration of the target gene in the HEX / VIC and ROX channels, the result can be determined directly or the sample can be diluted tenfold and re-measured.

[0086] (2) For the samples to be tested, when the Ct value of the P1 protein gene (HEX / VIC channel) is greater than 35.00, the Ct value of the C2617G mutation (ROX channel) and its amplification curve have no guiding significance and cannot be used to determine the C2617G mutation.

[0087] (3) For samples to be tested, when the Ct value of the P1 protein gene (HEX / VIC channel) is ≤35.00 and a typical S-shaped amplification curve is presented, the C2617G drug resistance mutation is determined. The specific determination rules are shown in Table 14 below: Table 14 Result judgment table

[0088] Note: *ΔCt value = Ct value of ROX channel - Ct value of HEX / VIC channel.

[0089] Example 5: Verification of kit accuracy and sensitivity 1. Accuracy Verification The first generation sequencing technology was used to detect 39 clinical samples that were confirmed to be positive for Mycoplasma pneumoniae. The kit prepared in Example 3 was used to detect the 39 clinical samples using the method of Example 4. The results are shown in Table 15.

[0090] Table 15 Test results of 39 clinical samples

[0091] According to the results in Table 15, combined with the determination method of Example 14, it can be seen that all 39 clinical samples are Mycoplasma pneumoniae positive samples, which is completely consistent with the sequencing results, and the accuracy reaches 100%.

[0092] 2. Sensitivity Verification The detection limit of the kit was determined using plasmid templates of 400 copies / mL, 200 copies / mL, and 100 copies / mL, respectively. The test results are as follows: Figure 5 and as shown in Table 16.

[0093] Table 16 Kit sensitivity verification results

[0094] according to Figure 5 and Table 16, it was determined that the detection limit of Mycoplasma pneumoniae and its 23S rRNA gene C2617G mutation site was 200 copies / mL, and the sensitivity was very high.

[0095] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teaching content of this application, those skilled in the art can make various changes or modifications to this application, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A reagent combination for detecting Mycoplasma pneumoniae and its 23S rRNA gene drug-resistant mutation site, characterized in that: The drug-resistant mutation site of the 23S rRNA gene is a C2617G mutation site, and the reagent combination includes a first primer combination and a first probe for detecting the Mycoplasma pneumoniae P1 protein gene, and a second primer combination and a second probe for detecting the drug-resistant mutation site, wherein: The sequences of the first primer combination are shown as SEQ ID No. 1 and SEQ ID No. 3, respectively, and the sequence of the first probe is shown as SEQ ID No. 2; The sequences of the second primer combination are shown in SEQ ID No. 4 and SEQ ID No. 6, respectively, and the probe sequence is shown in SEQ ID No.

5. The first probe is labeled with a first fluorescent group at its 5' end and a first quencher group at its 3' end, and the second probe is labeled with a second fluorescent group at its 5' end and a second quencher group at its 3' end, wherein the first fluorescent group is different from the second fluorescent group, and the first quencher group and the second quencher group are the same or different.

2. The reagent combination according to claim 1, characterized in that It also includes a third primer combination and a third probe for detecting the β-actin gene, the sequences of the third primer combination are shown in SEQ ID No. 7 and SEQ ID No. 9 respectively, the sequence of the third probe is shown in SEQ ID No. 8, the 5' end of the third probe is labeled with a third fluorescent group, and the 3' end is labeled with a third quenching group, the third fluorescent group is different from the first fluorescent group and the second fluorescent group, and the third quenching group is the same as or different from the first quenching group or the second quenching group.

3. A kit for detecting Mycoplasma pneumoniae and its 23S rRNA gene drug-resistant mutation site, characterized in that: The invention comprises the reagent combination as claimed in claim 1 or 2.

4. The kit according to claim 3, characterized in that It also includes positive quality control products, negative quality control products and / or wild-type quality control products, wherein the positive quality control product includes the nucleotide sequence plasmid of all primer combination amplicons; the difference between the wild-type quality control product and the positive quality control product is that for the nucleotide sequence plasmid of the second primer combination amplicon, the bases at the corresponding positions of the drug-resistant mutation site are different; the negative quality control product is a buffer solution that does not contain any primer combination amplicon.

5. The kit according to claim 4, characterized in that The positive quality control product includes a plasmid containing the sequence shown in SEQ ID No.10, and the wild-type quality control product includes a plasmid containing the sequence shown in SEQ ID No.

11.

6. The kit according to any one of claims 3 to 5, characterized in that Also included is a PCR buffer, which includes a buffer, dNTPs, metal ions, and a DNA polymerase.

7. The kit according to claim 6, characterized in that The PCR buffer further comprises UDG enzyme, BSA and / or glycerol.

8. A method for detecting Mycoplasma pneumoniae and its 23S rRNA gene drug-resistant mutation site, characterized in that: The following steps are involved: S1, obtaining a nucleic acid sample of a biological sample to be tested; S2, using the first primer combination and the first probe and the second primer combination and the second probe as described in claim 1 to perform fluorescent quantitative PCR amplification detection on the nucleic acid sample obtained in step S1; S3, according to the Ct value of the test result, use the following table to determine whether Mycoplasma pneumoniae exists in the biological sample to be tested, and if so, whether the Mycoplasma pneumoniae has a drug-resistant mutation: Wherein, Ct1 represents the Ct value obtained by detecting the first primer combination, Ct2 represents the Ct value obtained by detecting the second primer combination, and ΔCt=Ct2-Ct1.

9. The method according to claim 8, characterized in that Step S2 also includes using the third primer combination and the third probe described in claim 2 to perform fluorescent quantitative PCR amplification detection on the nucleic acid sample obtained in step S1. If the Ct value obtained by amplification by the third primer combination is not greater than 35, the judgment described in step S3 is performed.

10. The method according to claim 8 or 9, characterized in that The program of the fluorescent quantitative PCR amplification is: 50°C for 2 min; 95°C for 2 min; 91°C for 15 sec, 64°C for 1 min, 35-42 cycles.

Images