InDel marker for identifying chinese cherry and european sweet cherry germplasm and application thereof

Abstract

The present application relates to cherry molecular marker assisted germplasm identification and breeding technical field, specifically to a kind of InDel marker for identifying Chinese cherry and European sweet cherry germplasm and its application, suitable for identifying cherry resources of Chinese cherry and European sweet cherry two species and interspecific hybrid thereof.The present application designs specific PCR primer using InDel sequence information of cherry genome Cp2_35932912 site, extracts Chinese cherry and European sweet cherry genomic DNA, carries out PCR amplification and polyacrylamide gel electrophoresis, reads electrophoresis band, identifies Chinese cherry, European sweet cherry and interspecific hybrid thereof according to band position and number, develops InDel molecular marker, which can be used for Chinese cherry and European sweet cherry germplasm identification, and also can be used for early identification of interspecific hybridization offspring hybrid authenticity, and the result is accurate and reliable.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of cherry molecular marker assisted germplasm identification and breeding, in particular to an InDel marker suitable for identifying Chinese cherry and European sweet cherry germplasm and application thereof. BACKGROUND

[0002] Chinese cherry (Cerasus pseudocerasus (Lindl.) G. Don) and European sweet cherry (Cerasus avium (L.) Moench.) are two major fruit cherry species currently cultivated in China. Both cherry species have abundant resources. Due to differences in growth environment and developmental stage, they often show many similarities in phenotype, which causes certain difficulties in identifying Chinese cherry and European sweet cherry resources. In particular, in terms of germplasm characteristics, Chinese cherry is native to China, has wide adaptability, strong stress resistance, is widely cultivated in southern and northern China, has tender and juicy fruits, and rich flavor, but the fruits are small and soft, and not resistant to storage and transportation; while European sweet cherry requires a certain amount of cold to complete flower bud differentiation and normal flowering and fruit setting, the fruits are large and hard, resistant to storage and transportation, and mainly developed in northern China. Therefore, fully utilizing the characteristics of the two cherry species, hybridizing to breed new cherry varieties with excellent comprehensive traits has important development and utilization prospects, and developing simple, fast and reliable molecular marker technology for germplasm identification and molecular assisted selection of breeding materials can realize efficient utilization. However, Chinese cherry is tetraploid, and its genome structure is relatively complex; while European sweet cherry is diploid, and its genome has a high proportion of repetitive sequences, which greatly affects the development of stable and efficient molecular markers from Chinese cherry and European sweet cherry genomes. Insertion-deletion (InDel) is one of the most abundant structural variation types in plant genomes, is a co-dominant marker, has high polymorphism, good repeatability and universality, and is often used in crop germplasm identification, map construction, genetic diversity analysis and other researches. Therefore, for the identification of tetraploid Chinese cherry and diploid European sweet cherry with high repetitive sequences, it is of particular importance to develop efficient, stable and highly accurate InDel molecular markers based on whole genome for identifying Chinese cherry and European sweet cherry species and early identifying the authenticity of interspecific hybrid progeny. SUMMARY

[0003] The technical problem to be solved by the present application is to overcome the low accuracy of structural variation detection in species with complex genomes in the prior art, and to provide a specific InDel marker for identifying Chinese cherry and European sweet cherry germplasm and application thereof.

[0004] A specific primer for amplifying InDel marker of Chinese cherry and European sweet cherry germplasm, comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0005] An InDel marker for identifying Chinese cherry and European sweet cherry germplasm, which is amplified by using the specific primer and taking genomic DNA as a template, wherein the amplification product of the Chinese cherry is 191bp, and the amplification product of the European sweet cherry is 173bp.

[0006] The 113th-130th positions of the amplification product of the Chinese cherry are 5'-TGCTATTGCCAAATGAAG-3', and the 113th position of the amplification product of the European sweet cherry is deleted 5'-TGCTATTGCCAAATGAAG-3' for 18 bases.

[0007] The sequence of the amplification product of the Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', and the length is 191bp;

[0008] The sequence of the amplification product of the European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGATTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', and the length is 173bp.

[0009] The specific primer or the InDel marker is used for identifying Chinese cherry and European sweet cherry germplasm.

[0010] The application uses specific primers to amplify InDel markers from genomic DNA as a template; wherein the amplification product of Chinese cherry is 191bp, the amplification product of European sweet cherry is 173bp, the amplification product of a hybrid variety of Chinese cherry and European sweet cherry has two fragments, 191bp and 173bp respectively, and the specific primers are:

[0011] The nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT,

[0012] The nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0013] The genomic DNA is derived from leaves.

[0014] The application obtains an InDel marker for identifying Chinese cherry and European sweet cherry germplasm, primer No. Cp2_35932912, which comprises a forward primer and a reverse primer, and the nucleotide sequence of the InDel marker forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0015] The application also provides application of the InDel primer Cp2_35932912 in the identification of Chinese cherry and European sweet cherry germplasm, which comprises the following steps:

[0016] (1) Extraction of genomic DNA: extract the genomic DNA of the sample to be tested;

[0017] (2) Development of molecular markers: align the whole genome resequencing data of the sample in the application to the Luoyang ancient cherry reference genome of Chinese cherry (uploaded to CNGB database, Accession Number: CNP0006741), and screen the InDel primer in claim 1 from the primers developed from specific sites in the whole genome through variation detection and site filtering for subsequent tests and analysis;

[0018] (3) PCR amplification: use the InDel primer in claim 1 to perform PCR amplification on the genomic DNA obtained in step (1);

[0019] (4) Polyacrylamide gel electrophoresis and silver staining: perform electrophoresis on the PCR product obtained in step (3) on an 8% denatured polyacrylamide gel, and then perform staining and color development, and take a photo on a gel imaging system;

[0020] (5) Data statistics and band type analysis: In Quantity One software, the specific band size (bp) was calculated with Trans2K Plus DNA Marker as a reference, and data statistics was performed. According to the specific band size, the sample was determined to be Chinese cherry or European sweet cherry. Finally, the PCR products of representative individuals were subjected to Sanger sequencing (Shenguo), and the obtained sequences were aligned to further verify the accuracy of the variation detection, PCR amplification and electrophoresis results. Since 'Landee 2' and 'Cot' are heterozygous at this site, five independent PCR amplifications and Sanger sequencing were performed on these two samples to determine the base type of the complex variation site.

[0021] The specific steps of the application of Chinese cherry and European sweet cherry germplasm identification in the application are as follows:

[0022] (1) Extraction of genomic DNA: The genomic DNA of all samples was extracted by using a genomic DNA extraction kit (TIANamp Genomic DNA Kit), and the integrity of the DNA was verified by electrophoresis analysis using 1% concentration agarose gel. The purity and concentration of the genomic DNA of each sample were detected by a nucleic acid protein quantitative analyzer (Thermo Scientific NanoDrop spectrophotometer);

[0023] (2) Development of molecular markers: The whole genome resequencing data of 184 Chinese cherries and 95 European sweet cherries were aligned to the reference genome of Chinese cherry Luoyang ancient cherry (uploaded to CNGB database, Accession Number: CNP0006741), and GATK and Sentieon were used for variation detection to obtain the original gvcf file. The InDel file was extracted to screen out the InDel sites specific to Chinese cherry and European sweet cherry at the species level. It was found that the 35932912 site of the second linkage group existed 18bp (5'-TGCTATTGCCAAATGAAG-3') deletion (Deletion) in all European sweet cherry samples. The primer was designed in Primer 3 for this site, and the above InDel primer was used for subsequent experiments and analysis;

[0024] The target sequence of the Chinese cherry is predicted based on the whole genome resequencing variation detection result of the target region: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAA CCAACATCCCT-3', a total of 191 bp;

[0025] The whole genome resequencing variation detection result shows that in the target sequence region, in addition to the target deletion variation at the 113th position, at the 148th position of the Chinese cherry amplification sequence, i.e. the 130th position of the European sweet cherry amplification sequence, there is a G to A base substitution relative to the Chinese cherry, so the expected amplification target sequence of the European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173 bp.

[0026] (3) PCR amplification: the genomic DNA obtained in step (1) is subjected to PCR amplification using the InDel primers in claim 1. The PCR amplification system (20 μL) is as follows: DNA template 1 μL, forward and reverse primers each 1 μL, ddH2O 7 μL, Taq mix (vazyme) 10 μL; the amplification program is as follows: 94°C pre-denaturation for 4 min, 94°C denaturation for 50 s, 56°C annealing for 1 min, 72°C extension for 110 s, a total of 34 cycles, finally 72°C extension for 8 min, 12°C forever;

[0027] (4) polyacrylamide gel electrophoresis and silver staining: the PCR product obtained in step (3) is subjected to electrophoresis on an 8% denatured polyacrylamide gel at a voltage of 1000 v, a current of 50 mA and a power of 50 W for 3 h, then the polyacrylamide gel after electrophoresis is subjected to silver staining in a 0.1% AgNO3 solution for 10 min, the gel surface is washed with distilled water until it is light ivory, and then it is placed in a NaOH and formaldehyde color developing solution for color development for 6 min, and finally it is photographed on a gel imaging system for recordation;

[0028] (5) Data statistics and band type analysis: In the Quantity One software, taking Trans2K Plus DNAMarker as a reference, the specific band size (bp) was calculated, and data statistics were performed. The samples producing 191 bp electrophoresis bands were determined as Chinese cherry, the samples producing 173 bp bands were determined as European sweet cherry, and the samples with both 191 bp and 173 bp electrophoresis bands were determined as hybrids of Chinese cherry and European sweet cherry. At the same time, the PCR products of 4 Chinese cherry, 4 European sweet cherry and 2 European sweet cherry x Chinese cherry hybrid offspring were selected for Sanger sequencing (Shengong), and the sequencing nucleotide sequences were analyzed by alignment to further verify the accuracy of the variation detection, PCR amplification and electrophoresis results. Since 'Landin No. 2' and 'Court' are heterozygous at this site, five independent PCR amplifications and Sanger sequencing of these two samples are performed for the determination of the base type of the complex variation site.

[0029] The nucleotide sequence of the forward primer for PCR amplification in step (2) is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0030] The present application has the following advantages and beneficial effects:

[0031] (1) The present application obtains an InDel marker which can efficiently and stably identify Chinese cherry and European sweet cherry germplasm at the species level. Through PCR amplification, only one pair of primers successfully realizes the rapid identification of 68 Chinese cherry intraspecific hybrid F1 offspring, Chinese cherry cultivated germplasm and Chinese cherry wild germplasm, and 30 European sweet cherry cultivated germplasm and European sweet cherry wild germplasm, with an accuracy of 100%, simple operation method, high accuracy, low cost and good repeatability. It is the simplest, fastest and most accurate method for identifying Chinese cherry and European sweet cherry germplasm at the species level.

[0032] (2) The marker primer Cp2_35932912 amplified in the present application is a nucleotide sequence relatively specific to Chinese cherry and European sweet cherry at the species level, which accurately identifies the triploid hybrid offspring of the two, and provides an efficient germplasm identification molecular marker for molecular assisted breeding between Chinese cherry and European sweet cherry. This has important significance for the exploration and utilization of germplasm resources of perennial woody fruit trees with different ploidy levels and highly heterozygous genomes. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 The present application is a case implementation flowchart.

[0034] Figure 2The PCR amplification product polyacrylamide gel electrophoresis results of the InDel marker Cp2_35932912 in 100 samples of the application. Among them, Marker is Trans2K Plus DNA Marker (TransGen Biotech), samples 1-24 are F1 offspring of intra-species hybridization of Chinese cherry, 25-66 are Chinese cherry cultivated germplasm, 67 and 68 are Chinese cherry wild germplasm, 69-97 are European sweet cherry cultivated germplasm, 98 is European sweet cherry wild germplasm ('Mazard'), and 99 and 100 are triploid hybrids 'Landin 2' and 'Court' produced by hybridization of European sweet cherry (diploid) and Chinese cherry (tetraploid).

[0035] Figure 3 Sanger sequencing peak map and PCR amplification sequence of the application. To verify the stability and accuracy of the variation detection, PCR amplification and polyacrylamide gel electrophoresis results, the PCR products of 10 representative individuals (4 Chinese cherries, 4 European sweet cherries and 2 European sweet cherry x Chinese cherry hybrids 'Landin 2' and 'Court') were selected for Sanger sequencing (Sheng Wu). The Sanger sequencing results showed that the PCR amplification sequence of the primer had no sequence variation among different germplasms of the same species, so only the sequencing peak maps of 3 representative individuals of Chinese cherry, European sweet cherry and European sweet cherry x Chinese cherry ('Hongfei', 'Meizao' and 'Court') are presented here. With the forward and reverse primer sequences of Cp2_35932912 as the starting sequence and the stop sequence, the sequencing results were read and spliced according to the Sanger sequencing peak map, and the low-quality sequencing fragments at the beginning and end of the forward and reverse sequencing files were removed in the Chromas software (gray mask in the figure), while the corresponding resequencing results were combined to verify and correct the first and last sequencing fragments. 'Court' is a hybrid of European sweet cherry and Chinese cherry, when there is an insertion-deletion type variation and the variation site is a heterozygous genotype, there are two lengths of fragments in the PCR amplification product, so in the sequencing peak map, from the start of the variation, the sequencing results will have obvious hetero peaks. And 'Court' is a triploid hybrid, from the start of the variation, when the height of the hetero peak is nearly half or more of the height of the main peak, it is judged as a secondary peak, when there is no obvious hetero peak, the secondary peak base is consistent with the main peak base, when the hetero peak amplitude is small, the base type of the site is determined according to five sequencing results.

[0036] Figure 4Figure 10 shows the alignment results of 10 representative Sanger sequencing sequences of the application. The spliced sequences of 10 Sanger sequencing samples were aligned with the expected amplified target sequence, and the results showed that the PCR product sequence of the sample of the application was the expected amplified target sequence, the deletion sequence was the same as the whole genome resequencing variation detection result, and the genotype of different germplasms was consistent with the gel electrophoresis result. In the figure, the numbers in the brackets of the germplasm name correspond to the individual numbers in Table 1 and Figure 2 DETAILED DESCRIPTION

[0037] In order to make the objectives, technical solutions and advantages of the present application clearer, further detailed description of the present application will be given below in combination with examples and drawings, and the schematic embodiments of the present application and their descriptions are only used to explain the present application, and do not limit the present application.

[0038] The present application provides an InDel marker primer for identifying Chinese cherry and European sweet cherry germplasm, which comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0039] The molecular marker for identifying Chinese cherry and European sweet cherry germplasm and the application thereof are exemplified by using the following Chinese cherry, European sweet cherry germplasm and their intergeneric hybrid offspring.

[0040] 1. Materials and methods

[0041] 1.1 Test materials

[0042] In this embodiment, 100 materials were selected for the amplification of Chinese cherry and European sweet cherry specific InDel markers, among which 54 samples were included in the whole genome resequencing samples for variation detection, and 46 materials were non-resequencing samples (Table 1), as follows:

[0043] (1) In this embodiment, 24 Chinese cherry intraspecific hybrid F1 offspring from 3 different hybrid combinations, 44 Chinese cherry cultivated germplasms from 26 counties and cities in 8 provinces (municipalities) of China and Chinese cherry wild germplasms, and 30 European sweet cherry cultivated germplasms and European sweet cherry wild germplasms were used. These samples represent the main geographical distribution of Chinese cherry and cover the main phenotypes and genotypes of Chinese cherry and European sweet cherry, as shown in Table 1, wherein 1-24 are Chinese cherry intraspecific hybrid F1 offspring, 25-66 are Chinese cherry local germplasms, 67 and 68 are Chinese cherry wild germplasms, 69-97 are European sweet cherry cultivated germplasms, and 98 is European sweet cherry wild germplasm 'Mazard'.

[0044] ​(2) This example also includes two triploid hybrid offspring obtained from interspecific hybridization between European sweet cherry and Chinese cherry, as shown in Table 1, No. 99 and No. 100 are European sweet cherry × Chinese cherry ‘Landing No. 2’ and ‘Court’.

[0045] Table 1 Material detected and identified in this application

[0046]

[0047]

[0048] Note: The PCR products of all the above 100 accessions were detected by polyacrylamide gel electrophoresis, among which, 1 “ ” indicates the accession not involved in the whole genome sequence Indel analysis; “ 2 ” indicates the accession whose PCR product was subjected to Sanger sequencing for further alignment analysis of nucleotide sequence, further testing the accuracy of variation detection, PCR amplification and electrophoresis results.

[0049] 1.2 Test method

[0050] 1.2.1 Extraction of genomic DNA

[0051] Genomic DNA of Chinese cherry, European sweet cherry and their hybrid offspring was extracted using a genomic DNA extraction kit (TIANamp Genomic DNA Kit):

[0052] (1) Weigh 2 g of dry silica gel leaf sample into a mortar, add liquid nitrogen and grind thoroughly, then add 400 μL of LP1 buffer and 6 μL of RNase A (10 mg / ml), vortex for 1 min in a vortex shaker, and stand at room temperature for 10 min, then add 130 μL of buffer LP2, mix well, vortex for 1 min in a vortex shaker, centrifuge at 12,000 rpm for 5 min, and transfer the supernatant to a new centrifuge tube.

[0053] (2) Add 1.5 times the volume of buffer LP3, mix well by vortexing for 15 s, and add the resulting solution and flocculent precipitate to the adsorption column CB3, centrifuge at 12,000 r for 30 s, remove the waste liquid, place the adsorption column CB3 in a collection tube, and add 600 μL of PW rinse liquid, centrifuge at 12,000 r for 30 s, and discard the waste liquid, then place the adsorption column CB3 in a collection tube.

[0054] (3) Repeat step (2) once. After the adsorption column CB3 is dried at room temperature with residual rinse solution, it is placed in a new centrifuge tube, 100 μL TE elution buffer is added to the middle part of the adsorption membrane, and it is placed at room temperature for 5 min, centrifuged at 12,000 r for 2 min, and the solution is collected into the centrifuge tube to obtain the genomic DNA of the sample.

[0055] 1.2.2 Development of molecular markers

[0056] With the genome of Chinese cherry Prunus lannesiana as the reference genome, the whole genome resequencing data of Chinese cherry and European sweet cherry were aligned to the reference genome in BWA, and the variant file was obtained by performing variant detection in GATK and Sentieon, from which the InDel sites were extracted, and through a local script, the species-specific sites of Chinese cherry and European sweet cherry were detected. It was found that at the 35932912 site of linkage group 2, there was a 18 bp (5'-TGCTATTGCCAAATGAAG-3') deletion in all European sweet cherry samples relative to Chinese cherry. The primer was designed in Primer 3 for this site, and the InDel primer Cp2_35932912 in claim 1 was obtained for subsequent experiments and analysis.

[0057] In combination with the whole genome resequencing variant detection result of the target region, the expected amplification target sequence of Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTTCTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTGCCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 191 bp;

[0058] The whole genome resequencing variation detection result shows that in the amplification target sequence region, in addition to the target deletion variation existing at the 113th position, at the 148th position of the Chinese cherry amplification sequence, i.e. the 130th position of the European sweet cherry amplification sequence, relative to the Chinese cherry, the European sweet cherry also has a G to A base substitution, so the expected amplification target sequence of the European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173bp.

[0059] 1.2.3 PCR amplification

[0060] The present application adopts a 20 muL InDel-PCR reaction system: 10 muL 2xTaq mix (vazyme); 1 muL DNA template; 7 muL ddH2O; 1 muL forward primer; 1 muL reverse primer.

[0061] The PCR reaction program is as follows: 94℃ pre-denaturation for 4min, 94℃ denaturation for 50s, 56℃ annealing for 1min, 72℃ extension for 110s, a total of 34 cycles, finally 72℃ extension for 8min, 12℃ forever.

[0062] 1.2.4 Polyacrylamide gel electrophoresis and silver staining

[0063] (1) Glass plate pretreatment: wipe the two glass plates with anhydrous ethanol, evenly apply the affinity silane on one of the glass plates, dry, and then put a pressing strip on each side and the middle of the glass plate, cover the other glass plate, fix the two glass plates with a clamp, and seal the sides and bottom of the glass plate with 1% agarose gel.

[0064] (2) Gel configuration: uniformly mix 50mL 8% polyacrylamide stock solution, 200 muL 10% ammonium persulfate and 20 muL TEMED (N,N,N,N tetramethyl ethylenediamine). Pour the gel along the groove of the glass plate, tilt the glass plate to remove air bubbles, and then insert the comb, and let it stand for 2h to dry.

[0065] (3) Pre-electrophoresis: place the gel glass plate in a vertical electrophoresis tank, remove the shark teeth with a pipette gun, wash off impurities, insert the comb in reverse to form a sample application hole, then add 1xTBE, and pre-electrophorese at a voltage of 1000V, a current of 50mA, and a power of 50W for 10min.

[0066] (4) Electrophoresis: 1 μL of PCR product was spotted using a pipette, and electrophoresis was performed at a voltage of 1000 V, a current of 50 mA, and a power of 50 W for 3 h.

[0067] (5) Staining and color development: After electrophoresis, the glass plate was pried open, the gel plate was immersed in 0.1% AgNO3 solution for silver staining for 10 min, and then the surface of the gel was washed with distilled water to remove residual staining solution. After washing, the polyacrylamide gel was placed in a color development solution (1.5% NaOH, 0.25% formaldehyde) for color development for 6 min. The bands on the gel were removed and placed in a gel imaging system for photography.

[0068] 1.2.5 Data statistics and band analysis

[0069] The size (bp) of each sample-specific target band was estimated in Quantity One software using Trans2K Plus DNA Marker (TransGen Biotech) as a reference. The sample producing a 191 bp electrophoretic band was determined to be Chinese cherry, the sample producing a 173 bp band was determined to be European sweet cherry, and the sample having both 191 bp and 173 bp electrophoretic bands was determined to be a hybrid of Chinese cherry and European sweet cherry. At the same time, the PCR products of 4 Chinese cherry, 4 European sweet cherry, and 2 European sweet cherry x Chinese cherry hybrid offspring ('Landin No. 2' and 'Koute') were selected for Sanger sequencing (Shenguo), and the sequencing nucleotide sequences were aligned and analyzed with the reference genome to further verify the stability and accuracy of the variation detection, PCR amplification, and electrophoresis results. Since 'Landin No. 2' and 'Koute' are heterozygous at this site, five independent PCR amplifications and Sanger sequencing were performed on these two samples to determine the base type of the complex variation site.

[0070] 2 Test results

[0071] According to the procedure in Figure 1 , the specific site InDel detection at the whole genome level was performed, and a 18 bp (5'-TGCTATTGCCAAATGAAG-3') deletion site at 35932912 on linkage group 2 was selected to design primer Cp2_35932912 (shown in Table 2) for PCR amplification and polyacrylamide gel electrophoresis of 100 Chinese cherry, European sweet cherry, and hybrid offspring of the two. The results are shown in Table 3 and Fig. 2. Figure 2It can be seen that 191 bp specific electrophoretic bands were detected in 68 Chinese cherry interspecific hybrids, Chinese cherry cultivars and Chinese cherry wild germplasms. 173 bp specific bands were detected in 30 European sweet cherry cultivars and European sweet cherry wild germplasms. Both 191 bp and 173 bp specific bands were detected in two triploid hybrids of European sweet cherry and Chinese cherry. In the 100 samples, the gel electrophoresis results of 46 non-sequencing samples were consistent with the results of 54 re-sequencing samples Figure 2 ), which proved the stability of the band type of the PCR amplification product of primer Cp2_35932912 in Chinese cherry, European sweet cherry and their hybrid offspring in polyacrylamide gel electrophoresis.

[0072] In addition, Sanger sequencing was performed on the PCR products of 10 representative individuals (including 5 re-sequencing samples and 5 non-sequencing samples) Figure 3 , Figure 4 ). Among them, all Chinese cherry amplification sequences and all European sweet cherry PCR amplification sequences were consistent with the expected amplification sequences Figure 4 ). This result shows that the Cp2_35932912 primer accurately amplifies the sequences in Chinese cherry and European sweet cherry samples, and the accuracy rate of the Cp2_35932912 primer in the identification of Chinese cherry and European sweet cherry at the species level is 100%. In addition, two European sweet cherry x Chinese cherry hybrid offspring are heterozygous at the InDel variation site, containing both the same sequence as Chinese cherry (191 bp) and the 18 bp deletion variation as European sweet cherry, indicating that the Cp2_35932912 primer can also stably and accurately identify the hybrid offspring of Chinese cherry and European sweet cherry. The optimal PCR reaction program of the primer pair is: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 50 s, 56℃ annealing for 1 min, 72℃ extension for 110 s, 34 cycles, 72℃ extension for 8 min, 12℃ forever.

[0073] Table 2 Sequence information of InDel marker primer Cp2_35932912

[0074]

[0075] In the present application, the InDel marker Cp2_35932912 is specifically amplified in all detected Chinese cherry and European sweet cherry and hybrid progeny germplasm, has good repeatability and high stability, the accuracy of identifying Chinese cherry and European sweet cherry germplasm at the species level reaches 100%, and the specific bands of the parents are detected in the hybrid progeny of the two. This shows that the InDel primer Cp2_35932912 can be used for the identification of Chinese cherry and European sweet cherry germplasm, and also for the identification of the hybrid progeny of the two. The specific embodiments described above further illustrate the purposes, technical solutions and beneficial effects of the present application. It should be understood that the above description is only a specific embodiment of the present application and is not used to limit the protection scope of the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. An InDel marker for identifying Chinese cherry and European sweet cherry germplasm, which is amplified by using specific primers and taking genomic DNA as a template, wherein the amplified product of the Chinese cherry is 191 bp, and the amplified product of the European sweet cherry is 173 bp; wherein the sequence of the amplified product of the Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTTCTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTGCCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', totally 191 bp; the sequence of the amplified product of the European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTTCTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGATTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', totally 173 bp; wherein the 113th-130th position of the amplified product of the Chinese cherry is 5'-TGCTATTGCCAAATGAAG-3', and the 113th position of the amplified product of the European sweet cherry is deleted by 5'-TGCTATTGCCAAATGAAG-3', totally 18 bases.

2. The use of the InDel marker of claim 1 in identifying Chinese cherry and European sweet cherry germplasm.

3. The use of claim 2, wherein the InDel marker is amplified by using the specific primers of claim 1 and taking genomic DNA as a template; wherein the amplified product of the Chinese cherry is 191 bp, the amplified product of the European sweet cherry is 173 bp, the amplified product of a hybrid of the Chinese cherry and the European sweet cherry has two fragments, 191 bp and 173 bp, and the specific primers are: the nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG. ​ ​ ​ ​ ​ ​ ​ ​ 4. The use according to claim 3, wherein the amplified product of Chinese cherry is 5'-TGCTATTGCCAAATGAAG-3' at position 113-130, and the amplified product of European sweet cherry is 5'-TGCTATTGCCAAATGAAG-3' deleted 18 bases from position 113.

5. The use according to claim 4, wherein the sequence of the amplified product of Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAA CCAACATCCCT-3', 191 bp in total; and the sequence of the amplified product of European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', 173 bp in total.

6. The use according to claim 3, wherein the genomic DNA is derived from leaves. ​ ​ ​

Images