A strain of Dioscorea brussels yeast K221011F1 and its application

Abstract

This invention relates to the fields of fruit and vegetable preservation and food fermentation technology, specifically to a food-derived Dekkera bruxellensis strain K221011F1 and its applications. The Dekkera bruxellensis strain, classified as Dekkera bruxellensis K221011F1 with CCTCC No.: M 2024251, exhibits a broad antibacterial spectrum and strong antagonistic activity, effectively inhibiting the growth of pathogenic fungi in fruits and vegetables, thus enabling its application in agricultural biological control. Furthermore, Dekkera bruxellensis can also be used in food fermentation processes to increase the content of active substances in food, making it a high-performance strain with promising development and application prospects.

Description

Technical Field

[0001] This invention relates to the fields of fruit and vegetable preservation and food fermentation technology, specifically to a Brussels yeast strain K221011F1 derived from food and its applications. Background Technology

[0002] Fruits and vegetables have a high water content, making them susceptible to microbial infection and rotting after harvest, leading to quality deterioration, short shelf life, and a typical loss rate of around 25%. Small berries, in particular, with their thin skins and ripening outdoors in hot and humid seasons, are even more vulnerable to environmental and microbial stress, resulting in significant losses. Fungi such as *Alternaria* spp., *Botrytis* spp., *Penicillium* spp., *Colletotrichum* spp., *Pestalotiopsis* spp., and *Fusarium* spp. are the main types of rot-causing pathogens in the post-harvest stage of fruits and vegetables. Controlling fruit and vegetable diseases through biological control has always been a hot research topic.

[0003] Furthermore, yeast fermentation is widely used in food processing to improve the flavor and nutritional composition of food. Microbial fermentation of plant products can increase the dissolution and extracellular release of their functional substances. Therefore, the field has been dedicated to developing and screening new, non-toxic, safe strains with good antibacterial and fermentation effects. Summary of the Invention

[0004] This invention isolates a strain of Dioscorea brussels yeast K221011F1 from food, which has excellent effects on conventional preservation of fruits and vegetables, rot control, improvement of functional substance content, and increase of stress resistance. At the same time, it also shows good fermentation ability in food fermentation, improves flavor, and increases the content of functional substances. Moreover, K221011F1 is safe and non-toxic.

[0005] To achieve the objectives of this invention, the following technical solution is provided:

[0006] The first aspect of this invention provides a strain of Dekkera bruxellensis K221011F1, which was deposited on January 29, 2024, at the China Center for Type Culture Collection (CCTCC), located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC No: M 2024251.

[0007] In a second aspect, the present invention provides a microbial inoculant comprising the Brussels yeast K221011F1 and / or its metabolites as described in the first aspect.

[0008] In the above technical solution, the microbial agent is further described as a liquid or solid preparation.

[0009] In a third aspect, the present invention provides a composition comprising *Dacron Bruxelles* K221011F1 as described in the first aspect, or comprising a microbial agent as described in the second aspect.

[0010] In the above technical solution, the composition is further described as a food or pharmaceutical composition, comprising Dioscorea brussels yeast K221011F1 as described in the first aspect, or comprising a microbial agent as described in the second aspect, and a food or pharmaceutically acceptable carrier.

[0011] The fourth aspect of the present invention provides the following applications of the Brussels yeast K221011F1 described in the first aspect, the microbial agent described in the second aspect, and the composition of the third aspect:

[0012] (1) Application in the prevention and control of fruit and vegetable rot.

[0013] Furthermore, it inhibits fungi of the genera *Alternaria*, *Botrytis*, *Penicillium*, *Pestalotiopsis*, *Fusarium*, and *Colletotrichum*.

[0014] Furthermore, it inhibits Alternaria tenuissima, Alternaria dumosa, Botrytis fabiopsis, Botrytis cinerea, Penicillium rubens, Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum, and Colletotrichum nymphaeae.

[0015] Furthermore, its application in the preparation of drugs for preventing and treating fruit and vegetable rot.

[0016] Furthermore, its application in the prevention and control of blueberry and tomato fruit rot.

[0017] Furthermore, the Brussels yeast K221011F1 cells themselves, their metabolites, and the volatile substances they produce all have an inhibitory effect on the aforementioned pathogens.

[0018] Furthermore, *Dacronis brusselsii* K221011F1 possesses the ability to secrete extracellular proteases and β-1,3-glucanase (GLU), which can inhibit the aforementioned pathogens.

[0019] (2) Application in the preservation of fruits and vegetables.

[0020] Furthermore, its application in the preparation of fruit and vegetable preservatives.

[0021] Furthermore, its application in the preservation of hardy kiwifruit, blueberries, and tomatoes.

[0022] (3) Application in enhancing the content of functional substances in fruits and vegetables: Used before and after harvest to enhance the functional substances in fruits, including flavonoids and anthocyanins.

[0023] (4) Application in improving the stress resistance of harvested fruits and vegetables: using it to treat fruits and vegetables increases the activity of antioxidant enzymes CAT, SOD, APX, POD, and disease resistance-related enzymes PAL and GLU, thereby enhancing their antioxidant and disease resistance properties.

[0024] (5) Application in the preparation of fermented foods: fermentation is carried out under relatively mild conditions, which helps to retain the activity of functional substances to the maximum extent.

[0025] Furthermore, its application in the fermentation of red yeast rice wine.

[0026] Furthermore, its application in increasing the total flavonoid content in fermented tangerine peel.

[0027] The beneficial effects of this invention are:

[0028] The *Dacronis brusselsii* K221011F1 strain screened from food in this invention exhibits antibacterial effects against *Alternaria tenuissima* and *Alternaria dumosa*, *Botrytis fabiopsis* and *Botrytis cinerea*, *Penicillium rubens* and *Penicillium chermesinum*, *Pestalotiopsis clavispora*, *Fusarium oxysporum*, and *Colletotrichum nymphaeae*, especially at a concentration of 1×10⁻⁶. 7CFU / mL showed the best inhibitory effect on the growth of Alternaria and Botrytis. *Dacron* Brussels yeast K221011F1 significantly reduced the incidence of Alternaria fruit rot in blueberries and gray mold in tomatoes, and significantly improved the preservation effect of hardy kiwifruit, while remaining safe and non-toxic. Furthermore, when used in the fermentation of red yeast rice wine, *Dacron* Brussels yeast K221011F1 can reduce the total acidity of the wine, improving its taste; and when used in the fermentation of aged tangerine peel, it increases the content of total flavonoids, an active substance. Attached Figure Description

[0029] Figure 1 In vitro screening: Plate confrontation test screening diagram; A: CK; B: K221011F1;

[0030] Figure 2 In vivo secondary screening: Effect of treatment with strain K221011F1 on the disease incidence of inoculated blueberry fruits on day 5; A: CK; B: Postharvest soaking with K221011F1;

[0031] Figure 3 Colony morphology of K221011F1 after 3 days of culture at 28°C in solid medium;

[0032] Figure 4 Colony morphology of K221011F1 after 3 days of incubation in liquid medium at 28°C;

[0033] Figure 5 Phylogenetic tree based on 26S rDNA gene;

[0034] Figure 6 ISSR amplification detection results of K221011F1 with different primer pairs; M: DL2000 Plus DNA Marker;

[0035] Figure 7 Inhibitory effects of K221011F1 on Alternaria alternata, Botrytis cinerea, and Fusarium moniliforme; A. Alternaria alternata 712E1; B. Alternaria alternata 632C1; C. Botrytis cinerea 928G1; D. Botrytis cinerea 929D1; E. Fusarium moniliforme 719A2;

[0036] Figure 8 Inhibitory effects of K221011F1 on Penicillium, Pseudomonas, and Anthrax; A. Penicillium 722I1; B. Penicillium 929D2; C. Pseudomonas 710B1; D. Pseudomonas 710B2; E. Anthrax 728H;

[0037] Figure 9Inhibitory effects of K221011F1 cells and their metabolites on Alternaria alterniflora; A. Normal Alternaria alterniflora growth state; B. Antibacterial effect of K221011F1 blend solution; C. Antibacterial effect of K221011F1 live cell solution; D. Antibacterial effect of K221011F1 secretion solution;

[0038] Figure 10 The inhibitory effect of the volatile antibacterial substance of K221011F1 on Alternaria alterniflora; A. Normal growth state of Alternaria alterniflora; B. Inhibitory effect of K221011F1 on Alternaria alterniflora;

[0039] Figure 11 The production of extracellular hydrolases by K221011F1: A. Chitinase (CHI); B. β-1,3-glucanase (GLU); C. Protease;

[0040] Figure 12 Effect of treatment with strain K221011F1 on the incidence of disease in blueberry fruits inoculated with Alternaria alternata on day 5; A. CK; B. Preharvest spraying with K221011F1;

[0041] Figure 13 Effect of treatment with strain K221011F1 on the incidence of disease in tomato fruits inoculated with Botrytis cinerea on day 5; A. CK; B. Postharvest soaking with K221011F1;

[0042] Figure 14 Preservation effect of strain K221011F1 treatment on hardy kiwifruit from 0-5 days; A: CK; B: Postharvest soaking with K221011F1;

[0043] Figure 15 Effect of K221011F1 treatment on flavonoids in blueberry fruit (P<0.05);

[0044] Figure 16 Effect of K221011F1 treatment on anthocyanins in blueberry fruit (P<0.05);

[0045] Figure 17 Effects of K221011F1 treatment on blueberry fruit viability (P<0.05); A. CAT; B. SOD; C. POD; D. APX;

[0046] Figure 18 Effect of K221011F1 treatment on blueberry fruit viability (P<0.05); A. PAL; B. GLU;

[0047] Figure 19 The form of red yeast rice wine after fermentation; A. Control group (no yeast); B. Treatment group (added with Brussels yeast K221011F1);

[0048] Figure 20 Comparison of different cold-brewed tangerine peel solutions: A. Unfermented tangerine peel; B. Fermented tangerine peel using Brussels yeast K221011F1. Detailed Implementation

[0049] The present invention will be further described below with reference to specific embodiments, but this does not limit the present invention in any way.

[0050] Example 1: Screening and identification of Dioscorea brussels yeast K221011F1

[0051] 1. Filtering:

[0052] The strain was isolated from fermented food, purified to obtain a library of test strains, and the strain of the invention was obtained through in vitro primary screening and in vivo secondary screening.

[0053] (1) In vitro screening: The plate confrontation method was used. The test strain and the target pathogen (Alternaria tenuissima) were placed simultaneously on a plate to observe whether the test strain inhibited the growth of the target bacteria. A straight line was drawn in the middle of the PDA plate with the test strain, and the bacterial discs of the target pathogen were placed on either side of the line. The inoculated PDA plates were then incubated at 25°C to observe the antibacterial effect. Figure 1 .

[0054] (2) In vivo re-screening: Blueberries were soaked in a 2% (v / v) sodium hypochlorite solution for 3 minutes, rinsed with clean water, and air-dried for 30 minutes. The fruits were then divided into two groups, with each group of blueberries subjected to 1×10⁻⁶ mol / L in vitro screening. 7 Blueberries were soaked in K221011F1 solution (cfu / mL) and sterile water (CK control) for 15-30 min, with each treatment repeated three times. After 3 h, the blueberries were dispensed into sterilized and dried 96-well ice cube trays, and then 10 μL of the target pathogen (A. tenuissima) spore suspension (1×10⁻⁶) was inoculated at the stem end of the blueberries. 5 The inoculum (cfu / mL) was carefully placed in a transparent plastic bag after inoculation and stored in a constant temperature incubator at 20℃ and 85-90% RH. The disease incidence of blueberries was observed and recorded at 0, 1, 2, 3, 4, and 5 days after inoculation.

[0055] Measurement method: The incidence rate of blueberry fruit was calculated using the following formula:

[0056]

[0057] Where X represents the incidence rate of blueberry fruit, N0 represents the number of diseased blueberry fruits, and N represents the total number of blueberry fruits observed and measured.

[0058] A preliminary screening was conducted using a plate confrontation test to investigate the inhibition of pathogenic fungal hyphal growth. Figure 1 The antagonistic strain K221011F1 was obtained. In vivo secondary screening was conducted, and blueberries treated with K221011F1 postharvest were soaked to observe disease incidence and analyze the effectiveness of K221011F1. With increasing storage days, the disease incidence of blueberries gradually increased, but the disease incidence in the K221011F1 treatment group was significantly lower than that in the control group. On day 5, the disease incidence in the K221011F1 postharvest treatment group was 31.5% lower than that in the control group (Table 1). Based on in vitro primary screening and in vivo secondary screening, strain K221011F1 can effectively inhibit the growth of Alternaria alternata (Alternaria). Figure 2 ).

[0059] Table 1. Morbidity rate of strain K221011F1 after in vivo rescreening.

[0060]

[0061] 2. Morphological observation

[0062] (1) Solid culture characteristics: The candidate strains to be identified were inoculated into NYDA medium by streaking and cultured at 28℃ for 3 days. The size, color, edge shape and other characteristics of the colonies were observed.

[0063] K221011F1 was streaked on NYDA solid medium and incubated at 28°C for 3 days. Colonies were round, with a mucous-like texture, a moist and smooth surface, relatively neat edges, and were opaque and milky white. They were easily picked up. Figure 3 ).

[0064] (2) Liquid culture characteristics: A loop of the candidate strain to be identified was introduced into NYDB medium and cultured at 28°C for 3 days. The degree of turbidity and the presence or absence of floating film, ring or island were observed.

[0065] In NYDB liquid medium, after incubation at 28°C for 3 days, a floating film appeared, the bacterial solution became turbid, and most of the bacterial cells settled at the bottom. Figure 4 ).

[0066] 3. Physiological and biochemical characteristics

[0067] (1) Sugar fermentation experiment: The sugars to be tested included sucrose, glucose, maltose, trehalose, raffinose, D-lactose, and D-galactose. The above sugars were prepared into stock solutions with a mass concentration of 0.2 g / mL for later use. Bean sprout juice was used as the basic culture medium for sugar fermentation. 7.2 mL of basic culture medium was added to each test tube, followed by 0.8 mL of the stock solution of the sugar to be tested. After mixing, the mixture was placed in Durham tubes and sterilized at 121℃ for 20 min. 100 μL of yeast antagonist bacterial solution was added to each test tube, gently mixed, and incubated at 28℃. Observations were made daily. The basic culture medium without any added sugars served as a control. Each experiment was repeated three times.

[0068] The K221011F1 strain can ferment sucrose and glucose, but it cannot ferment maltose, trehalose, raffinose, D-lactose, and D-galactose (Table 2).

[0069] Table 2. Carbohydrate fermentation status of K220111F1

[0070]

[0071] (2) Carbon source assimilation experiment: The carbon sources to be tested included D-lactose, D-galactose, trehalose, raffinose, citric acid, succinic acid, cellobiose, xylose, erythritol, inositol, and soluble starch. The assimilation of different carbon sources by yeast was detected using the liquid culture medium test tube method: 10 mL of carbon source liquid culture medium was added to each test tube, and 0.05 g of different carbon sources and a concentration of 1×10⁻⁶ were added to each test tube respectively. 7 A 100 μL suspension of yeast antagonistic bacteria (cfu / mL) was used as a positive control (with added glucose) and a carbon-free culture medium as a negative control. The cultures were incubated at 26°C, and observations were made daily with gentle shaking of the test tubes. Observations continued for approximately one week. Turbidity of the liquid indicates that the yeast can assimilate and utilize the carbon source. Each experiment was repeated in triplicate.

[0072] The K221011F1 strain can utilize glucose, D-galactose, D-xylose, inositol, and soluble starch, but cannot utilize any of the other tested carbon sources (Table 3).

[0073] Table 3. Carbon source assimilation effect of K221011F1

[0074]

[0075] (3) Nitrogen source assimilation experiment: The nitrogen sources to be tested are ammonium sulfate, urea and potassium nitrite. The specific test method is similar to that of the carbon source assimilation experiment, except that the added carbon source is replaced with a nitrogen source.

[0076] K221011F1 can utilize ammonium sulfate and urea, but other tested nitrogen sources cannot (Table 4).

[0077] Table 4. Nitrogen source assimilation by K221011F1

[0078]

[0079] 4. Molecular biological identification

[0080] The ITS sequence and 26S rDNA sequence were used for identification of this strain.

[0081] Remove the antagonistic bacteria from the -80℃ incubator and activate them. Take 1-2 loops of the activated antagonistic bacteria into PD medium and incubate overnight at 28℃ with shaking at 180 rpm. Take 1 mL of fresh bacterial culture and extract DNA according to the genomic DNA extraction kit (Wanlei Biotechnology Co., Ltd.).

[0082] ITS sequence primers: ITS sequences were amplified using ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') primers.

[0083] The PCR amplification reaction system for ITS is as follows: each 25 μL reaction system includes 2 μL template DNA, 1 μL each of the fungal universal primers ITS1 and ITS4, 8.5 μL dd H2O, and 12.5 μL 2×Taq Master Mix DNA polymerase.

[0084] The PCR reaction program for primers ITS1 and ITS4 was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 36 cycles; and finally, 72℃ extension for 10 min, followed by storage at 4℃.

[0085] 26S rDNA sequence primers: The 26S rDNA sequence was amplified using NL1 (5'-GCATATCAATAAGCGGAGGAAAA-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3') primers.

[0086] The PCR amplification reaction system for 26S rDNA is as follows: each 25μL reaction system includes 2μL template DNA, 1μL each of yeast universal primers NL1 and NL4, 8.5μL dd H2O, and 12.5μL 2×Taq Master Mix DNA polymerase.

[0087] The PCR reaction program for primers NL1 and NL4 was as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 53℃ annealing for 1 min, 72℃ extension for 1 min, for a total of 36 cycles; and finally, 72℃ extension for 7 min, followed by storage at 4℃.

[0088] Sequencing: After the reaction was completed, DL2000Plus was selected as the DNA Marker, with a sample volume of 5 μL. Electrophoresis was performed on a 1% (w / v) agarose gel for about 20 min (120V). Ethidium bromide staining was used, and DNA was detected under UV light. After a single band was observed, the sample was sent for sequencing. The sequencing work was completed by Shanghai Sangon Biotech Co., Ltd.

[0089] Identification method: The ITS sequence of strain K221011F1 was compared with the NCBI database (https: / / www.ncbi.nlm.nih.gov) to identify it down to the genus level. The 26S rDNA sequence of strain K221011F1 was compared with known reference strains to construct a phylogenetic tree for effective species refinement and genetic multi-tree analysis, and for species-level identification. Figure 5 ).

[0090] The 26S rDNA sequence of K221011F1 is shown in SEQ ID NO: 1:

[0091] CGCGGAAGGGGTATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGG

[0092] GCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGA

[0093] ACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCC

[0094] GAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATAT

[0095] TAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGA

[0096] GTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCG

[0097] GCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGCCAGCATCGGTTCTGGGAGCCATAT

[0098] ACGGGGTTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGGCATCTTGTGGC

[0099] TAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCCA

[0100] CCCGTCTTGAACACGGACCCCACGGTGACGGAACGCTTCTTTACGCATTTCACAGGTACAGCGA

[0101] CCGTCTTGAAACACGGACC

[0102] Strain K221011F1 is *Dekkera bruxellensis*, the asexual form of which is *Brettanomyces bruxellensis*. Named *Dekkera bruxellensis* K221011F1, it was deposited on January 29, 2024, at the China Center for Type Culture Collection (CCTCC, address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan, Hubei Province), with accession number CCTCC No: M 2024251.

[0103] Example 2: ISSR fingerprint of Dioscorea brussels yeast K221011F1

[0104] ISSR (Inter-Simple Sequence Repeat) fingerprinting is a molecular marker technique. In this embodiment, it is used to perform fingerprint analysis on bacterial communities in genetic research, using simple repeat sequences to identify and distinguish the genetic characteristics of different bacterial communities.

[0105] The ISSR fingerprinting procedure for Dioscorea brusselsus K221011F1 of the present invention is as follows: Primers refer to the sequences (UBC801~UBC900) provided by Columbia University. Using K221011F1 DNA as a template, nine primers that can amplify clear bands and have polymorphic bands are selected for ISSR analysis.

[0106] PCR reaction system (total volume 25μL): DNA 1.5μL, primers 1.5μL, dd H2O 9.5μL, 2×Taq MasterMix DNA polymerase 12.5μL.

[0107] Amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 52℃ annealing for 45 s, 72℃ extension for 90 s, 30 cycles, final extension at 72℃ for 10 min, stored at 4℃. PCR amplification products were electrophoresed with 1.0% agarose gel at 100V, stained with ethidium bromide, and observed and photographed on a gel imaging system. Figure 6 ).

[0108] ISSR is a highly suitable method for distinguishing intraspecific diversity in microorganisms. This invention uses ISSR to perform ISSR genetic mapping on the inventive strain for differentiation from other strains of the same species.

[0109] Results: Seven ISSR primers (808, 827, 836, 857, 873, 881, and 888) were used to perform genetic mapping of this strain. The specific mapping is shown below. Figure 6 As shown.

[0110] Primer 808 amplified 6 distinct bands: 4 in the 250–750 bp range, 1 in the 750–1000 bp range, and 1 in the 1000–2000 bp range. Primer 827 showed 5 distinct bands, concentrated in the 1000–2000 bp range. Primer 836 showed 7 distinct bands: 2 in the 250–500 bp range, 2 in the 500–1000 bp range, and 3 in the 1000–2000 bp range. Within the range of 0–2000 bp, primer 857 showed 3 clear bands, concentrated in the range of 500–1000 bp; primer 873 amplified more bands, with a total of 8 clear bands, 4 distributed in the range of 750–1000 bp and 4 distributed in the range of 1000–2000 bp; the amplification pattern of primer 881 showed one particularly clear band in the range of 1000–2000 bp; and the amplification pattern of primer 888 showed one clear band at 750 bp.

[0111] Example 3: Inhibitory effect of Dioscorea brussels yeast K221011F1 on common decay-causing fungi in fruits and vegetables

[0112] This example determined the in vitro antibacterial effect of K221011F1 against common decay-causing fungi of fruits and vegetables. The pathogens used were previously isolated and identified Alternaria tenuissima and Alternaria dumosa, Botrytis fabiopsis and Botrytis cinerea, Penicillium rubens and Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum, and Colletotrichum nymphaeae.

[0113] 1. Operating Instructions:

[0114] (1) Preparation of bacterial suspension: Brussels yeast K221011F1, taken from a -80℃ freezer, was diluted with sterile water and spread. 100 μL of the diluted solution was spread onto PDA agar plates. After complete absorption, the plates were incubated at 28℃. Single yeast colonies were picked and streaked twice for purification, then incubated at 28℃. Afterward, sterile water was scraped onto a hemocytometer, counted under a microscope, and diluted to 1×10⁻⁶. 7 Prepared at cfu / mL.

[0115] (2) Control treatment: Take 200 μL of 1×10 7 A CFU / mL K221011F1 bacterial suspension was evenly spread on PDA medium, while the control group was spread with an equal amount of sterile water.

[0116] (3) Pathogen treatment: After 2 hours of incubation, pathogens grown on PDA plates for 7 days were collected, and holes were punched at the edge of the colonies to obtain bacterial discs with a diameter of 6 mm. The bacterial discs were placed in the center of a plate coated with K221011F1 bacterial suspension. The plates were incubated at 25℃ for 5 days. The diameter of the pathogen colonies was measured to evaluate the inhibitory effect of K221011F1 on the pathogens. Each treatment was repeated 3 times.

[0117] (4) Calculation of inhibition rate: Inhibition rate / % = (diameter of control colony - diameter of treated colony) / (diameter of control group - diameter of mycelium cake) × 100.

[0118] Plate inhibition test results of strain K221011F1 ( Figure 7 and Figure 8 The K221011F1 strain exhibited good inhibitory effects against postharvest pathogens of blueberries, including *Alternaria alternata*, *Botrytis cinerea*, *Penicillium*, *Fusarium*, *Anthracis*, and *Pseudomonas*, effectively inhibiting their mycelial growth. On day 5, the control group showed normal growth, while the K221011F1 treatment group showed less mycelial growth. Among these, strain K221011F1 showed the best inhibitory effect on *Alternaria alternata* and *Botrytis cinerea*, with inhibition rates reaching 97.59%, 94.62%, 94.98%, and 97.87%, respectively. The inhibition rates against *Fusarium* and *Pseudomonas* reached 96.00%, 94.84%, and 90.71%, respectively, and the inhibition rates against *Penicillium* and *Anthracis* reached 93.79%, 90.54%, and 87.84%, respectively (see Table 5). These results indicate that strain K221011F1 has a broad antibacterial spectrum.

[0119] Table 5 shows the antibacterial rate of K221011F1 against different pathogens.

[0120]

[0121]

[0122] Example 4: Inhibitory mechanism of *Dacronus brusselsii* K221011F1 against putrefactive fungi

[0123] (1) Inhibitory effect of Dioscorea brussels yeast K221011F1 cells and its metabolites

[0124] After activating and culturing *Dacronobacter brusselsii* K221011F1 in NYDB liquid medium for 36 h, the following three treatment solutions (a), (b), and (c) were obtained: (a) Blend (live cells + secretions): The cultured K221011F1 suspension was prepared into a 1×10⁻⁶ solution using NYDB medium. 7 (a) Bacterial suspension with cfu / mL; (b) Viable cell suspension: After centrifuging the cultured K221011F1 bacterial suspension at 8000g for 10min, discard the supernatant (to remove secretions) and wash with sterile distilled water until free of culture medium, then prepare 1×10 7 (c) CFU / mL bacterial suspension; (c) Secretion solution: After centrifuging the cultured K221011F1 bacterial suspension at 8000g for 10 min, filter and collect the supernatant (retain the secretion). Spread 100 μL of the optimal concentration of K221011F1a, b, and c treatment solutions onto PDA plates respectively. After 10 min, place a 6 mm Alternaria tenuissima 712E1 bacterial cake in the center of the plate. Incubate the plates at 28℃ for 5 days, observe and measure the Alternaria tenuissima colony diameter, and repeat each treatment 3 times.

[0125] Inhibition rate calculation: Inhibition rate / % = (colony diameter of target bacteria control group - colony diameter of target bacteria treatment group) / (colony diameter of target bacteria control group - diameter of bacterial cake) × 100%.

[0126] Both the K221011F1 bacterial strain itself and its metabolites exerted inhibitory effects. When plates were coated with a mixture of K221011F1 strain, viable cell slurry, and secretion solution, the hyphal diameter of *Alternaria tenuissima* was significantly lower than that of the control group. When treatment solutions a and b were inoculated onto plates, the colony diameters of *A. tenuissima* were 7.80 mm and 9.68 mm, respectively, both significantly lower than the control group (65.37 mm), with inhibition rates reaching 96.97% and 93.80%, respectively. The results indicate that the main inhibitory effect was exerted by the cells and their metabolites. The K221011F1 strain mixture showed the best antibacterial effect, followed by the viable cell slurry. Figure 9 This indicates that strain K221011F1 produces strong antibacterial substances during cultivation, meaning that its metabolites may produce antibiotics, with both the bacterial cells themselves and the metabolites exerting an inhibitory effect.

[0127] (2) Antibacterial effect of volatile substances produced by Dioscorea brussels yeast K221011F1

[0128] Take 100 μL 1×10 7 A CFU / mL K221011F1 bacterial suspension was evenly spread on NYDA plates and incubated at 28°C for 2 days until the bacterial strain emerged. Then, a 6 mm bacterial pellet of pathogen was placed in the center of a PDA plate. The two plates were then inverted together and sealed to prevent leakage of volatile substances. Using NYDA plates without candidate bacterial suspension as a control, the plates were incubated at 28°C. After 5 days, the diameter of Alternaria colonies was observed and measured. Each treatment was repeated 3 times. The inhibition rate was calculated and analyzed according to the following formula.

[0129] Inhibition rate / % = (control colony diameter - treated colony diameter) / (control group diameter - mycelial cake diameter) × 100.

[0130] Strain K221011F1 can release volatile antibacterial substances and significantly inhibit the growth of Alternaria mycelia. Figure 10 The diameter of Alternaria hyphae in the treatment group was significantly smaller than that in the control group. The treatment group containing strain K221011F1 significantly inhibited the spread of Alternaria hyphae and also significantly affected hyphal growth. The hyphae were sparse and the colonies were thinner than those in the control group, further indicating that the strain released volatile substances and had a significant antibacterial effect.

[0131] (3) The ability of Dioscorea brussels yeast K221011F1 to secrete extracellular hydrolytic enzymes

[0132] Chitin is a polysaccharide mainly found in insect exoskeletons and fungal cell walls. Chitinases hydrolyze the β-1,4-glycosidic bonds of chitin, breaking it down into smaller sugar molecules; β-1,3-glucanases can disrupt the cell walls of pathogens, weakening their structural stability; and proteases can break down key proteins in pathogens, including enzymes and toxins, thereby further inhibiting pathogen activity. The disease resistance of *Dacronobacter brusselsii* K221011F1 was analyzed by testing its ability to secrete extracellular hydrolytic enzymes.

[0133] For chitinase (CHI) production detection: Take 10 μL of the optimal concentration of K221011F1 bacterial suspension and spot it in the center of the chitinase detection medium. After culturing for 1-7 days, observe the formation of the clear zone. The presence of a clear zone indicates the production of chitinase; otherwise, it does not.

[0134] For the detection of β-1,3-glucanase (GLU): Take 10 μL of the optimal concentration of K221011F1 bacterial suspension and spot it in the center of the laminarin solid medium. After incubation for 72 h, stain with 1 g / L Congo red at room temperature for 90 min. Pour off the unadsorbed Congo red dye and decolorize the plate with 1 mol / L NaCl for 15 min. Observe the formation of the yellow hydrolysis zone. The presence of a yellow hydrolysis zone indicates the production of β-1,3-glucanase; otherwise, it does not.

[0135] For the detection of protease production: Take 10 μL of the optimal concentration of K221011F1 bacterial suspension and spot it in the protease detection medium. After incubation at 25℃ for 1-7 days, observe the formation of clear zones. The presence of clear zones indicates the production of protease; otherwise, no clear zones are observed.

[0136] The results showed that strain K221011F1 possessed the ability to secrete β-1,3-glucanase (GLU) and protease through plate assays using different extracellular hydrolases, but it could not secrete extracellular chitinase (CHI). Figure 11 Therefore, it can be inferred that K22011F1 inhibits the growth of target bacterial hyphae by hydrolyzing the cell wall of the target bacteria through the protease and β-1,3-glucanase (GLU) it produces.

[0137] Example 5: Effect of Brussels yeast K221011F1 on the preservation of fruits and vegetables

[0138] (1) Blueberries were treated with Brussels yeast K221011F1 to evaluate its preservative effect on blueberries.

[0139] Pre-harvest spraying: use 1×10 7 CFU / mL K221011F1 and sterile water (CK control) were sprayed onto the surface of blueberry fruits 12 hours before harvest. After harvesting, blueberries were packaged into sterilized and dried 96-well ice cube trays, and 10 μL of Alternaria tenuissima spore suspension (1×10⁻⁶) was inoculated at the stem end of each blueberry. 5 After inoculation (cfu / mL), carefully cover the inoculated blueberries with a transparent plastic bag and store them in a constant temperature incubator at 20°C and 85–90% RH. Observe and record the disease incidence of blueberries after inoculation.

[0140] With increasing storage days, the incidence of disease in blueberries gradually increased. However, the incidence rate in the K221011F1 treatment group was significantly lower than that in the control group, with a statistically significant difference (P<0.05). Specifically, the control group showed disease on day 2, while the treatment group showed disease on day 3. By day 5, the K221011F1 pre-harvest treatment group showed a 23.43% reduction in disease incidence compared to the control group, and the severity of disease in the treated group was also lower than that in the control group (Table 6). Figure 12In conclusion, pre-harvest spraying of strain K221011F1 can significantly and effectively control the occurrence of chain rot disease in blueberries during the storage period.

[0141] Table 6. Disease incidence of inoculated blueberry fruits after treatment with strain K221011F1

[0142]

[0143] (2) Tomatoes were treated with Brussels yeast K221011F1 to evaluate its preservative effect on tomatoes.

[0144] Tomato fruits were soaked in a 2% (v / v) sodium hypochlorite solution for 3 minutes, rinsed with clean water, and air-dried for 30 minutes. The fruits were then divided into two groups, with each group of tomatoes immersed in a 1×10⁻⁶ solution. 7 Soak the tomato in CFU / mL K221011F1 solution or sterile water (CK control) for 15-30 min, with each treatment repeated three times. After 3 h, dispense the tomato into sterilized and dried 96-well ice cube trays, and inoculate the stem end of the tomato with 10 μL of Botrytis cinerea spore suspension (1×10⁻⁶). 5 The inoculated tomato was carefully covered with a transparent plastic bag and stored at 20°C in an incubator with an RH of 85–90%. The disease incidence of tomatoes after inoculation was observed and recorded.

[0145] The results showed that *Brucella brucellosa* K221011F1 could effectively control tomato gray mold caused by *B. cinerea* infection. Figure 13 The occurrence and development of gray mold in tomatoes. When stored at room temperature for 5 days, almost all of the control group developed the disease, but the incidence rate of the K221011F1 postharvest soaking treatment group was significantly lower than that of the control group, which was 71.87% lower (Table 7), indicating that postharvest soaking of Brucella K221011F1 can control the occurrence of gray mold in tomatoes.

[0146] Table 7. Disease incidence of inoculated tomato fruits after treatment with strain K221011F1

[0147]

[0148] (3) Treat hardy kiwifruit with Brussels yeast K221011F1 and evaluate its preservation effect on hardy kiwifruit.

[0149] The hardy kiwifruit was soaked in a 2% (v / v) sodium hypochlorite solution for 3 minutes, rinsed with clean water, and air-dried for 30 minutes. The fruit was then divided into two groups. Each group of hardy kiwifruit was soaked in K221011F1 bacterial suspension and sterile water (CK control) for 15-30 minutes, respectively, with each treatment repeated three times. After 3 hours, the fruit was transferred to sterilized and air-dried trays for 30 minutes, with each treatment repeated three times.

[0150] To assess the preservation effect of K221011F1, a natural disease development method without inoculation was used to treat kiwifruit. Results showed that with increasing storage time, the diameter of lesions in the control group increased, while no obvious lesions appeared in the kiwifruit treated with *Dacillus brucellosis* K221011F1. Figure 14 The diameter of the lesions, as an indicator of the severity of the disease, indicates that treatment with *Dacron brucellosis* K221011F1 can effectively preserve the freshness of hardy kiwifruit.

[0151] Example 6: Effect of Brussels yeast K221011F1 on increasing the content of functional substances in fruits and vegetables

[0152] Flavonoids, anthocyanins, and other plant secondary metabolites contained in fruit and vegetable tissues are important functional substances with antioxidant and anti-aging effects on the human body. This example determined the flavonoid and anthocyanin content of pre- and post-harvest blueberries from Example 5. Treatment of blueberries with strain K221011F1 increased both flavonoid and anthocyanin content.

[0153] (1) Effect of K221011F1 treatment on the enhancement of flavonoids in blueberries

[0154] Flavonoid determination method: Accurately weigh 3.0g of blueberry pulp tissue and add it to 5.0mL of pre-cooled 1% HCl-methanol solution. Grind the mixture into a homogenate under ice bath conditions. Transfer the homogenate to a 50mL centrifuge tube and repeatedly rinse the mortar with 1% HCl-methanol solution. Transfer the rinsing solution to the centrifuge tube and bring the volume to 20mL. Shake and mix well at 4℃ and extract in the dark for 20min. Centrifuge at 12000×g at 4℃ and collect the supernatant. The flavonoid content is determined by absorbance values ​​at 325nm, i.e., OD. 325 / g.

[0155] The results showed that the flavonoid content in both the pre- and post-harvest treatment groups of strain K221011F1 was higher than that in the control group. Figure 15 Among them, the flavonoid content of strain K221011F1 was highest on day 4 after inoculation in both pre-harvest and post-harvest treatments. From day 1 to day 5 after inoculation, the flavonoid content of the pre-harvest treatment group was higher than that of the post-harvest treatment group.

[0156] (2) Effect of K221011F1 treatment on increasing anthocyanins in blueberries

[0157] Anthocyanin determination method: The pulp tissue was treated in the same way as for flavonoid determination. Anthocyanin content (U) was determined by the difference in absorbance values ​​at wavelengths of 530 nm and 600 nm, i.e., U = (OD) / (U / 600 nm). 530 -OD 600 ) / g.

[0158] The results showed that the anthocyanin content in both the pre- and post-harvest treatment groups of strain K221011F1 and the control group generally exhibited a trend of first increasing, then decreasing, and then increasing again. Furthermore, the anthocyanin content in both the pre- and post-harvest treatment groups of strain K221011F1 was significantly higher than that in the control group. The highest anthocyanin content was observed in both pre- and post-harvest treatments of strain K221011F1 on day 2 after inoculation. On days 1 and 2 after inoculation, the anthocyanin content in the pre-harvest treatment group was higher than that in the post-harvest treatment group. On days 3 and 4, the anthocyanin content in the pre-harvest treatment group was similar to that in the post-harvest treatment group. Figure 16 ).

[0159] Example 7: Effect of Brussels yeast K221011F1 on improving fruit stress resistance

[0160] SOD, CAT, POD, and APX are key enzymes in the antioxidant system of fruits and vegetables that scavenge ROS. PAL is closely related to the plant's resistance to abiotic stress and disease resistance. GLU is an important disease-related protein in plants to resist pathogen infection. This example measured the antioxidant enzymes and disease-related enzymes in blueberries to reflect the effect of K221011F1 on improving fruit stress resistance.

[0161] (1) Dermalogica Brussels K221011F1 enhances the antioxidant capacity of fruit.

[0162] Determination of CAT activity: Accurately weigh 3g of blueberry fruit sample into 5mL of 0.1mol / L solution. -1 Sodium phosphate buffer (pH 7.5, containing 5 mmol / L) -1 Grind the mixture in DTT and 5% PVP in an ice bath until homogenized, centrifuge at 4°C and 12000×g for 30 min, and collect the supernatant. Take 0.1 mL of the supernatant and 2.9 mL of 20 mmol / L... -1 The H2O2 solution was used to form the enzyme-catalyzed reaction system. Distilled water was used as a blank reference to zero the system. The absorbance value at 240 nm was recorded after 15 seconds of reaction and used as the initial value. The absorbance was measured every 15 seconds for a total of 10 times. The change in absorbance value at 240 nm per gram of fresh weight of CAT enzyme-catalyzed reaction system per minute was reduced by 0.01 to form one CAT activity unit.

[0163] Determination of SOD activity: Accurately weigh 3g of blueberry fruit sample into 5mL of 0.1mol / L solution. -1 Sodium phosphate buffer (pH 7.8, containing 5 mmol / L) -1 Grind DTT and 5% PVP in an ice bath until homogenized, centrifuge at 4°C and 12000×g for 30 min, collect the supernatant, take 0.1 mL of the supernatant and add 1.7 mL of 50 mmol L to each supernatant. -1 Sodium phosphate buffer at pH 7.8, 0.3 mL 130 mmol / L -1 Methionine solution, 0.3 mL 750 μmol / L -1 Nitroblue tetrazolium solution, 0.3 mL 100 μmol / L -1 EDTA-2Na solution, 0.3 mL 20 μmol / L -1 Riboflavin solution. Two control tubes were prepared in addition to the sample tube, with sodium phosphate buffer used instead of enzyme solution in the control tubes. After mixing the reaction solutions, one control tube was placed in the dark, while the others were placed under a 4000 lx fluorescent lamp for 15 min. After the reaction was complete, the tubes were placed in the dark to terminate the reaction. Using the dark control tube as a blank reference for zeroing, the absorbance of the remaining tubes was measured at 560 nm. The amount of enzyme required to inhibit 50% of the photochemical reduction of nitroblue tetrazolium was defined as one unit of SOD activity.

[0164] Determination of POD activity: Accurately weigh 3g of blueberry fruit sample into 5mL of 0.1mol / L solution. -1 The mixture was homogenized in an ice bath in a pH 5.5 acetate-sodium acetate buffer (containing 1 mmol PEG, 4% PVP, and 1% Triton X-100), and centrifuged at 12000×g for 30 min at 4°C. The supernatant was collected. 0.5 mL of the supernatant and 3.0 mL of 25 mmol L⁻¹ were then added to the homogenate. -1 Guaiacin solution and 0.2 mL 0.5 mol L -1 The enzyme-catalyzed reaction system was composed of H2O2 solution. Distilled water was used as a blank reference to zero the system. The absorbance value at 470 nm was recorded after 15 seconds of reaction and used as the initial value. The absorbance was measured every 30 seconds for a total of 10 times. One unit of POD activity was defined as the change in absorbance value of the POD enzyme-catalyzed reaction system at 470 nm per gram of fresh weight per minute.

[0165] APX activity determination: Accurately weigh 3g of blueberry fruit sample into 5mL of 0.1mol / L solution. -1 pH 7.5 potassium phosphate buffer (containing 0.1 mmol L⁻¹ EDTA, 2% PVPP and 1 mmol L⁻¹ EDTA) -1Grind the mixture in an ice bath until homogenized, then centrifuge at 12000×g for 30 min at 4°C, and collect the supernatant. Take 0.1 mL of the supernatant and 2.6 mL of 50 mmol / L... -1 pH 7.5 potassium phosphate buffer (containing 0.1 mmol / L) -1 EDTA and 0.5 mmol L -1 Ascorbic acid) and 0.3 mL 2 mmol L -1 The enzyme-catalyzed reaction system was composed of H2O2 solution. Distilled water was used as a blank reference to zero the system. The absorbance value at 290 nm was recorded after 15 seconds of reaction and used as the initial value. The absorbance was measured every 30 seconds for a total of 10 measurements. One APX activity unit was defined as the absorbance value per gram of fresh weight per minute that decreased by 0.01.

[0166] Catalase, abbreviated as CAT, is an extremely important antioxidant enzyme in plants. It plays a role in scavenging H2O2 within plant cells, thus maintaining cell membrane stability. Figure 17 A indicates that the CAT activity of strain K221011F1 in the pre-harvest and post-harvest treatment groups showed a trend of first increasing and then decreasing, and the CAT activity was higher than that of the control group during the storage period after inoculation.

[0167] SOD, or superoxide dismutase, scavenges superoxide free radicals and works synergistically with enzymes such as CAT and POD to reduce the damage of free radicals to organisms. During the entire storage period of 0–5 days after inoculation, the SOD activity of the pre- and post-harvest treatment groups of strain K221011F1 showed a trend of first decreasing, then increasing, and then decreasing again, but overall it was higher than that of the control group. Figure 17 B).

[0168] POD is an oxidoreductase that plays a crucial role in plants. It scavenge reactive oxygen species, thereby delaying fruit senescence and enhancing the plant's defense capabilities against fruit damage. Throughout the entire storage period after inoculation, the pre- and post-harvest treatment groups of strain K221011F1 showed significantly higher levels of POD compared to the control group. Figure 17 C) Furthermore, on days 2 and 3 after inoculation, there were significant differences between the pre- and post-harvest treatment groups of strain K221011F1 and the control group (P<0.05). This indicates that pre- and post-harvest treatment of strain K221011F1 can maintain and induce POD activity in blueberry fruits, thereby enhancing the disease resistance of blueberry fruits.

[0169] APX is an important component of the ascorbic acid-glutathione cycle in plants, and increased APX activity enhances plant disease resistance. From day 1 post-inoculation, the APX activity in both pre- and post-harvest treatments of strain K221011F1 was higher than that in the control group. Specifically, from day 1 to day 3 post-inoculation, the APX activity in both pre- and post-harvest treatments of strain K221011F1 was significantly different from that in the control group (P<0.05). Figure 17 D indicates that both pre-harvest and post-harvest treatments of strain K221011F1 maintained and induced APX activity in blueberry fruits, thereby slowing down fruit senescence and preventing fruit rot.

[0170] (2) Dermalogica Brussels K221011F1 enhanced the disease resistance of the fruit.

[0171] The activities of PAL and CHI, disease-related proteins in blueberry fruit, were determined using the MM-37046O2 kit (enzyme immunoassay, Jiangsu, China).

[0172] PAL (phosphorus alcohol) is closely related to plant resistance to abiotic stress and disease, playing an important role in normal plant development and defense against pathogens. In both the control group and the pre- and post-harvest treatment groups using strain K221011F1, the PAL activity in blueberry fruits maintained a trend of first decreasing and then increasing. The PAL activity in the pre- and post-harvest treatment groups using strain K221011F1 was higher than that in the control group, and the PAL activity in the post-harvest treatment group was higher than that in the pre-harvest treatment group on days 1, 3, 4, and 5. Figure 18 A). This indicates that postharvest treatment with strain K221011F1 can induce an increase in PAL activity and improve the disease resistance of blueberries.

[0173] GLU is an important disease-related protein in plants to defend against pathogen infection. The trend of GLU activity in blueberry fruits treated with pre-harvest and post-harvest treatments of strain K221011F1 was initially upward and then downward. Specifically, the GLU activity in the pre-harvest treatment group of strain K221011F1 was significantly different from the control group only on day 3 (P<0.05), but the GLU activity in the post-harvest treatment group of strain K221011F1 was significantly higher than that in the control group throughout the storage period and was higher than that in the pre-harvest treatment group. Figure 18 B). This indicates that postharvest treatment of strain K221011F1 induced an increase in GLU activity, thereby enhancing the disease resistance of blueberries.

[0174] Example 8: Application effect of Brussels yeast K221011F1 in red yeast rice wine fermentation products

[0175] Red yeast rice wine possesses significant pharmacological activities, including regulating blood lipids, combating fatigue, maintaining cardiovascular health, and providing antioxidant effects. This example will investigate the effects of adding Dioscorea Brussels yeast K221011F1 to red yeast rice wine fermentation products by examining the physicochemical indicators of the wine samples, including alcohol content, reducing sugar, total acid, pH, and pigment content.

[0176] Grouping: The control group consisted of yellow yeast rice wine and red yeast rice wine fermented with the red yeast strain isolated in the laboratory in the early stage; the treatment group consisted of red yeast rice wine fermented with enhanced fermentation by adding Brussels yeast K221011F1.

[0177] 1. Red yeast rice wine brewing process

[0178] (1) Washing rice: Weigh 20g of high-quality indica rice (accurate to 0.01g) and place it in a 250mL Erlenmeyer flask. Rinse with clean water until the water is no longer cloudy.

[0179] (2) Soaking: Add 40mL of water to the triangular flask containing the rice and soak for 24h-48h to allow the rice to fully absorb water until there is no white center in the rice grains;

[0180] (3) Steaming: Wash and drain the rice and sterilize it at 115℃ for 20 minutes. The cooked rice grains should be thoroughly cooked but not mushy, and cooked but not sticky.

[0181] (4) Cooling: Shake the Erlenmeyer flask to keep the rice grains loose, place it in the clean bench to cool to room temperature, and if necessary use a sterile glass rod to loosen the clumps of rice.

[0182] (5) Inoculation and cultivation: After the rice has cooled to room temperature in the clean bench, add a 1:2 ratio of room temperature sterile rice water.

[0183] Distilled water, 10% red yeast rice, 0.72% mesophilic saccharifying enzyme, and 0.2% yeast culture were sealed and placed in a 30℃ constant temperature biochemical incubator for 7 days. The liquid was shaken approximately every 24 hours.

[0184] (6) Filtration and decoction: The fermented wine is squeezed and filtered through four layers of gauze, and then heated in a constant temperature water bath at 80℃.

[0185] In a bath, heat the liquor for about 15 minutes. After it has settled completely, transfer it to a sterile storage bottle, seal it, and store it at a low temperature.

[0186] 2. Testing of Physicochemical Indicators of Wine Samples

[0187] The alcohol content and total acid content of the wine samples were tested according to GB / T 13662-2018 "Huangjiu" (yellow wine); reducing sugars were determined by the 3,5-dinitrosalicylic acid (DNS) colorimetric method.

[0188] Analysis of Physicochemical Indicators of Red Yeast Rice Wine:

[0189] After fermentation, the reducing sugar content in the treatment group was slightly lower than that in the control group. This is because the *Dacronella brusselsii* K221011F1 utilizes some of the reducing sugar for growth metabolism. The alcohol content of the red yeast rice wine in the treatment group was 0.17% vol higher than that in the control group, as *Dacronella brusselsii* produces a small amount of alcohol during its growth. There were no significant differences in reducing sugar and alcohol content between the two groups (P>0.05), indicating that the addition of *Dacronella brusselsii* K221011F1 had no significant effect on the fermentation efficiency and alcohol yield of red yeast rice wine.

[0190] Total acidity and pH value are two key indicators for evaluating the sensory quality of alcoholic beverages, significantly affecting the perceived structure and balance. The total acidity in the treatment group was 0.63% lower than that in the control group. During the later stages of fermentation, some of the acid in the wine reacted with alcohols produced during fermentation, causing the pH value to rise. This indicates that mixed fermentation with Brussels yeast K221011F1 is beneficial for reducing the total acidity in the wine, resulting in a better taste for the red yeast rice wine. Figure 19 The form of red yeast rice wine after fermentation.

[0191] Table 8 Comparison of physicochemical indicators of the two groups of red yeast rice wine after fermentation

[0192]

[0193] Example 9: Effect of Brussels yeast K221011F1 on increasing the total flavonoid content in brewed tangerine peel liquid.

[0194] Dried tangerine peel (Chenpi) possesses multiple medicinal and culinary benefits, exhibiting effects such as relieving asthma and cough, antioxidation, and anti-tumor properties. Consumers typically obtain its flavonoid active substances by brewing it. This invention ferments dried tangerine peel using the strain of this invention, and compares the fermented and unfermented peels in brewing to observe the effect of fermentation on the content of functional substances in the brewed solution.

[0195] Method for fermenting dried tangerine peel: Weigh 5g of dried tangerine peel and place it in a fermentation tank. Rinse it 3-4 times with clean water, then drain it and sterilize it at 115℃ for 20 minutes. After cooling to room temperature, add 15% K221011F1 bacterial suspension to the fermentation tank, seal it, and incubate it in a 30℃ constant temperature incubator for 7 days, shaking it once every 12 hours. Then dry it at 50℃ for 4 hours to obtain fermented dried tangerine peel.

[0196] Take 1.5g of fermented tangerine peel and 1.5g of unfermented tangerine peel, add 13.5mL of room temperature purified water and brew. After brewing for 10 minutes, compare the color of the brewing liquid and its total flavonoid content.

[0197] Total flavonoids determination method: Take 1 mL of the brewing liquid from fermented and unfermented tangerine peel, add 5 mL of 70% ethanol, incubate in a water bath for 1 hour, centrifuge at 8000 rpm for 5 minutes, and collect the supernatant. Measure 0.5 mL of the test solution, add 1 mL of 5% NaNO2, shake well, and let stand for 6 minutes. Add 1 mL of 10% Al(NO3)3, shake well, and let stand for 6 minutes. Finally, add 5 mL of 4% NaOH, dilute to volume with 70% ethanol, shake well, and let stand for 15 minutes. Measure the absorbance at a wavelength of 510 nm and calculate the total flavonoid content, in mg / mL.

[0198] Figure 20 The image shows the cold-soaked form of the tangerine peel after fermentation; the treated group had a darker color than the control group. The main bioactive substances in tangerine peel are flavonoids; therefore, this study measured the total flavonoid content in yeast-fermented tangerine peel. The total flavonoid content in unfermented tangerine peel was 3.038 mg / mL, while the total flavonoid content in fermented tangerine peel was 4.925 mg / mL, representing a 62.11% increase compared to unfermented tangerine peel. This indicates that fermenting tangerine peel with this strain can dissolve more total flavonoids in water, resulting in a darker color.

[0199] Example 10: Mouse toxicity test of Dioscorea brussels yeast K221011F1

[0200] Test method:

[0201] The experiment was conducted in accordance with the national food safety standard (GB15193.3-2014) and the limits (GB15193.3-2014). Twenty-four ICR (CD-1) mice, half male and half female, were selected and acclimatized for one week before being used in the experiment. During this period, the mice had free access to food and water, and the ambient temperature was maintained at 20℃–26℃, with a relative humidity of 40%–60%, following a 12h / 12h diurnal cycle. The control group mice were orally administered physiological saline at a dose of 0.2 mL / mouse; the experimental group mice were administered the corresponding bacterial solution via gavage at a dose of 0.2 mL / mouse. Gavage was performed once, and observation continued for 7 days. After the start of the experiment, the mice were fed and their bedding was changed daily. Weight changes were recorded one day before gavage and on day 7 after gavage. The mice's health status, mental state, excretion, respiration, and any signs of poisoning or death were observed daily.

[0202] Mice in each group were weighed and had blood collected from their eyeballs. After euthanasia, the heart, liver, spleen, lungs, and kidneys of each group of mice were harvested. Blood was wiped off the surface of each organ with filter paper, and the organs were weighed and their condition recorded. The organ index was calculated using the following formula: Organ Index = Organ weight (g) / Body weight (g) × 100%

[0203] In addition, routine blood tests and liver function tests (ALT and AST tests) were performed.

[0204] result:

[0205] (1) The mouse condition during the observation period is as follows:

[0206] During the observation period, no adverse reactions occurred in rats given strain K221011F1 by gavage, and no mice died within 7 days. Compared with the control group, the mice in the treatment group had normal health status, mental state, excretion status, and respiratory status within 7 days.

[0207] (2) Results of organ indices in mice:

[0208] Further one-way ANOVA was performed on the indices of each organ, and no significant differences were found compared with the control group. These results indicate that strain K221011F1 is not toxic to the heart, liver, spleen, lungs, kidneys, or pancreas of mice. Specific results are shown in Table 9.

[0209] Table 9 Results of the mouse organ index test

[0210]

[0211] Note: Data in the table are mean ± standard deviation (n = 3). P > 0.05, indicating no significant difference in organ indices among the treatment groups compared to the control group.

[0212] (3) Results of complete blood count in mice:

[0213] The results of the complete blood count in mice are shown in Table 10. All values ​​were within the normal range, indicating that the bacterial solution had no significant effect on the number of immune cells in the mouse blood, no infection occurred, and no inflammatory response was induced.

[0214] Table 10 Results of routine blood tests in mice

[0215]

[0216] Note: Data in the table are mean ± standard deviation (n = 3). P > 0.05, indicating no significant difference in organ indices among the treatment groups compared to the control group.

[0217] The normal range for white blood cell count in mouse blood is 0.8–6.8 × 10⁻⁶. 9 / L, the normal reference range for lymphocyte count is 0.7–5.7 × 10⁹ / L. 9 The normal reference range for monocyte count is 0–0.3 × 10⁹ / L. 9 / L, the normal reference range for neutrophil count is 0.1–1.8 × 10⁹ / L. 9 / L

[0218] (4) Results of ALT and AST measurements:

[0219] Alanine aminotransferase (ALT), also known as alanine-glutamyl transferase, is present in various tissues and cells throughout the body, especially in liver cells. Aspartate aminotransferase (AST), also known as aspartate aminotransferase, is mainly distributed in tissues such as the myocardium, liver, and kidneys. Under normal circumstances, the concentrations of ALT and AST in the blood are very low. However, when liver cells are damaged due to inflammation, poisoning, or necrosis, the permeability of the cell membrane increases, allowing ALT and AST to be released through the damaged liver cells, resulting in a rapid increase in ALT and AST activity. Therefore, ALT and AST are the most sensitive biomarkers for liver function testing. Studies have shown that ALT activity in normal mouse serum ranges from 10 to 100 U / L, while AST activity ranges from 20 to 150 U / L.

[0220] In this experiment, the serum ALT activity in the control group was 36.874±5.163 U / L, and the serum AST activity was 62.705±8.785 U / L. The serum ALT activity in the treatment group was 38.894±3.981 U / L, and the serum AST activity was 67.265±9.896 U / L, consistent with those of normal mice. These results indicate that strain K221011F1 has no toxic effect on liver function in mice.

[0221] The results in summary indicate that the acute oral toxicity of candidate strain K221011F1 is "non-toxic," and it has no toxic effects on the condition, organs, blood routine, or liver function of mice. This further demonstrates that strain K221011F1 is safe and non-toxic, providing a theoretical basis for its application and promoting its future use.

Claims

1. A Dekkera bruxellensis K221011F1, with a preservation number of CCTCC No:M 2024251.

2. A microbial inoculant, characterized in that, The Dekkera bruxellensis K221011F1 or the Dekkera bruxellensis K221011F1 and metabolites thereof of claim 1.

3. The microbial inoculant of claim 2, wherein, The microbial preparation is a liquid or solid preparation.

4. A composition characterized in that, The composition comprises the Dekkera bruxellensis K221011F1 of claim 1, or the microbial preparation of claim 2 or 3.

5. The composition of claim 4, wherein, The composition is a food or pharmaceutical composition.

6. The use of Dekkera bruxellensis K221011F1 according to claim 1 for the control of fruit and vegetable rot, characterized in that, The pathogenic bacteria of the fruit and vegetable rot disease are Alternaria tenuissima, Alternaria dumosa, Botrytis fabiopsis, Botrytis cinerea, Penicillium rubens, Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum or Colletotrichum nymphaeae. 7.Use of the Dekkera bruxellensis K221011F1 of claim 1 in the preparation of a fruit and vegetable preservative.

8. The use of Dekkera bruxellensis K221011F1 according to claim 1 for increasing the content of functional substances in postharvest fruits and vegetables, characterized in that, The functional substance comprises flavonoids and anthocyanins.

9. Use of Dekkera bruxellensis K221011F1 according to claim 1 for enhancing stress resistance in postharvest fruits and vegetables, characterized in that, The CAT activity, SOD activity, POD activity, APX activity, PAL activity or GLU activity is improved. 10.Use of the Dekkera bruxellensis K221011F1 of claim 1 in the preparation of red rice wine. 11.Use of the Dekkera bruxellensis K221011F1 of claim 1 in the preparation of a fermented pericarpium citri reticulatae with improved total flavonoid content.

Images