A salt-alkali tolerant endophytic Bacillus subtilis strain and its application in saline-alkali land improvement
By isolating and culturing salt-alkali-tolerant Bacillus subtilis NXO3 from Suaeda salsa, an agricultural microbial agent was prepared, which solved the problem of plant growth stagnation in saline soil improvement, achieved high seedling rate and high yield of crops in saline-alkali land, and had significant salt-alkali tolerance and biocontrol effects.
Patent Information
- Application Number
- CN202411764011.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-12-03
AI Technical Summary
Saline soil poses a severe challenge to agricultural production and the ecological environment. Existing microbial agents have limited effects in improving saline-alkali land and are unable to effectively promote plant growth and improve their salt tolerance.
The salt- and alkali-tolerant Bacillus subtilis NXO3 was isolated from the strictly surface-sterilized Suaeda salsa. An agricultural microbial agent containing diatomaceous earth, compost, humic acid, unripe mineral powder, biochar and bentonite was prepared through a specific culture method. The agent was used in potted and field experiments to verify its crop growth-promoting function in saline-alkali environments.
It significantly improves the emergence rate and yield of crops in saline-alkali land, has significant salt-alkali tolerance and plant growth promotion effects, has a biocontrol effect on a variety of plant diseases, and improves the soil quality of saline-alkali land.
Smart Images

Figure CN119709492B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biological bacteria, and particularly relates to a salt-alkali tolerant endophytic Bacillus subtilis and application thereof in improving saline-alkali land. Background Art
[0002] Saline soil refers to a type of soil with excessively high concentrations of soluble salts in the soil solution, hindering crop growth. The widespread distribution of saline soil in China poses a severe challenge to local agricultural production and the ecological environment.
[0003] In recent years, with the deepening of microbiological research, people have discovered that microorganisms play an indispensable role in the improvement of saline-alkali land. Sun Mingzhen screened multifunctional microorganisms from saline-alkali soils in the Yellow River Delta region, which can enhance soil enzyme activity, promote the formation of soil macroaggregates, further inhibit soil capillary salt return, and promote salt leaching. AbdelFattah et al. used arbuscular mycorrhizal fungi to improve the growth and tolerance of wheat in saline soils. Under saline conditions, inoculation of mycorrhizal fungi can increase the growth of wheat plants, alkaline phosphatase and soluble protein content. The N, P, K, and Mg contents in mycorrhizal plants increased, while the Na content decreased, which helps to reduce salt damage to plant growth. Wheat plants show a high dependence on mycorrhizal fungi in saline soils. Barua et al. isolated nitrogen-fixing bacteria from coastal saline-alkali soil and applied them to large fields to observe their effects on rice production. They found that nitrogen-fixing bacteria combined with organic fertilizers significantly increased crop nitrogen absorption, plant height, leaf number, and rice yield. Yan Huijun et al. applied microbial fertilizers to vegetables grown in saline-alkali soils. The results showed that the application of microbial fertilizers had a certain effect on saline-alkali soil microbial biomass, soil volume quality, and soil salinity. Compared with no fertilizer, chemical fertilizer, and substrate treatments, the total number of soil bacteria in the microbial fertilizer treatment increased significantly, the soil volume quality decreased, and the salt content of the topsoil was significantly reduced. Song Yuzhen et al. applied microbial fertilizers to afforestation in soda saline-alkali soils of the Songnen Plain. The results showed that trees and shrubs treated with active microbial fertilizers significantly outperformed the control trees in terms of survival rate, preservation rate, biomass, and other aspects. The pH value decreased slightly, but not significantly.
[0004] Therefore, exploring strategies to promote plant growth and enhance salt tolerance is crucial for improving saline soils. Microbial agents play a crucial role in this process. They can decompose salt and alkalinity in the soil, improving its physical and chemical properties and thus enhancing soil fertility and aeration. These effects can increase available nitrogen content in the soil, reduce soil electrical conductivity, regulate the structure of soil microbial communities, and thus influence the microbially mediated nitrogen cycle in the soil, ultimately promoting plant growth and increasing its tolerance to saline soils. By fully leveraging the potential of microbial agents, we can effectively improve the quality of saline soils, increase crop yields, and promote sustainable agricultural development. Summary of the Invention
[0005] To address the above-mentioned technical problems, the present invention isolated a salt-alkali-tolerant strain, NXO3, from a strictly surface-sterilized Suaeda salsa plant through a selective culture method. Its salt-alkali tolerance, antibacterial, and growth-promoting properties were tested in indoor experiments. Its crop growth-promoting function in saline-alkali environments was further verified through potted and field experiments, in order to provide a solution for saline-alkali land improvement. Specifically, the present invention provides a Bacillus subtilis NXO3 strain that has significant salt-alkali tolerance, plant growth promotion, and biocontrol effects against plant diseases, which can improve the emergence rate and yield of crops in saline-alkali land.
[0006] The first object of the present invention is to provide a salt- and alkali-tolerant Bacillus subtilis NXO3, whose deposit number is CGMCC No.32127.
[0007] The second object of the present invention is to provide a primer set for identifying the above-mentioned Bacillus subtilis NXO3, the nucleotide sequences of the primer set are shown as SEQ ID No.1 to SEQ ID No.2.
[0008] 16SF (SEQ ID No. 1): AGAGTTTGATCCTGGCTCAG;
[0009] 16SR (SEQ ID No. 2): TACGGTTACCTTGTTACGACTT.
[0010] The third object of the present invention is to provide a method for culturing the above-mentioned Bacillus subtilis NXO3, comprising inoculating the Bacillus subtilis NXO3 into a seed liquid culture medium and shaking and culturing for 12 hours to obtain a seed liquid;
[0011] Inoculate the seed solution into the fermentation medium at a 3% inoculum volume and shake culture for 72 hours to obtain a fermentation liquid;
[0012] The seed liquid culture medium includes the following components in concentrations: glucose 18.0-22.0 g / L, yeast extract powder 3.7-7.0 g / L, L-glutamic acid monosodium salt 7.8-12.6 g / L, K2HPO4 1.4-2.8 g / L, and MgSO4 0.20-0.31 g / L;
[0013] The fermentation medium comprises the following components in concentrations: 20.0-40.0 g / L of glucose, 6.2-9.8 g / L of yeast extract powder, 21.8-39.9 g / L of L-glutamic acid monosodium salt, 1.2-3.0 g / L of K2HPO4 and 0.20-0.31 g / L of MgSO4.
[0014] Preferably, the shaking culture conditions for culturing the seed solution are 37°C and 200 rpm;
[0015] The shaking culture conditions during fermentation were 37°C and 180 rpm.
[0016] The fourth object of the present invention is to provide an agricultural microbial agent, comprising bacterial sludge obtained by centrifuging the fermentation liquid obtained by the above-mentioned culture method and a carrier.
[0017] Preferably, the carrier comprises diatomaceous earth, decomposed material, humic acid, unripened mineral powder, biochar and bentonite.
[0018] Preferably, the mass ratio of the bacterial mud to diatomaceous earth is 1:100;
[0019] Among the components of the agricultural microbial agent, the mass percentage of decomposed material is 20-30%, the mass percentage of humic acid is 15-20%, the mass percentage of unripe mineral powder is 25-30%, the mass percentage of biochar is 5-10%, and the mass percentage of bentonite is 10-15%.
[0020] Preferably, the concentration of Bacillus subtilis NXO3 in the agricultural microbial agent is 300 million / g.
[0021] The fifth object of the present invention is to provide the use of the above-mentioned Bacillus subtilis NXO3 or the fermentation liquid obtained by the above-mentioned culture method or the above-mentioned agricultural microbial agent in at least one of the following: (1) phosphate solubilization;
[0022] (2) Nitrogen fixation;
[0023] (3)Production of IAA;
[0024] (4) Promote seed germination;
[0025] (5) Increased crop yields;
[0026] (6) Salt and alkali resistance;
[0027] (7) Antibacterial.
[0028] Preferably, the antibacterial activity includes inhibiting Fusarium neosporum, Colletotrichum anthracis, Fusarium graminearum, Fusarium oxysporum and Microbisporus.
[0029] Beneficial effects: The present invention obtains a salt- and alkali-tolerant endophytic Bacillus strain NXO3 from the stems and leaves of Suaeda salsa. It has been identified as Bacillus subtilis and has the ability to solubilize phosphate, fix nitrogen, produce indoleacetic acid (IAA) and polyglutamic acid, and has significant inhibitory effects on a variety of plant pathogens such as Fusarium oxysporum, Colletotrichum, Fusarium graminearum, Fusarium oxysporum, and Microbisporus. Among them, the inhibition rate against Colletotrichum is as high as 69.52%. Under the alkaline stress conditions of 0.24% sodium bicarbonate solution, the germination rate of wheat seeds treated with 20% NXO3 fermentation liquid for 72 hours reached 86.67%, and the germination index of cucumber seeds was 158.86%, both significantly higher than the control group (wheat seed germination rate 66.67%, cucumber seed germination index 117.19%). Through formula optimization, an agricultural microbial inoculant containing 300 million / g NXO3 was prepared. Potted experiments in 0.3% saline soil showed that wheat seedling emergence rates reached 92% when treated with an agricultural microbial inoculant containing 300 million NXO₃ per gram, significantly higher than those in the control group containing inoculant carrier particles. In a mildly saline-alkali coastal soil experimental field in Changli County (salt content 0.1-0.3%, pH 7.15-7.31), application of 50 kg / mu of the agricultural microbial inoculant (300 million NXO₃) resulted in a peanut seedling emergence rate of 83.15% and a yield of 158.76 kg / mu, compared to 75.53% and 139.36 kg / mu, respectively, in the control group. Both the seedling emergence rate and yield of the treated group were significantly higher than those in the control group. In a test field in Huanghua, Cangzhou, on mildly to moderately saline-alkali soil (salt content 0.1-0.5%), when 80 kg / mu of an agricultural microbial inoculant (300 million / g NXO3) was applied, peanut yield per mu reached 385.71 kg / mu. The blank control group (inoculant carrier granules) achieved a peanut yield of 308.90 kg / mu, and the conventional control group achieved a peanut yield of 354.88 kg / mu. The peanut yield per mu in the treated group was significantly higher than that in the control group. These results confirm that Bacillus subtilis NXO3 exhibits significant salt-alkali tolerance, plant growth promotion, and biocontrol effects against plant diseases, potentially improving crop emergence and yield in saline-alkali soils.
[0030] Biological deposit information
[0031] Bacillus subtilis NXO3 is deposited in the General Microbiology Center of the China Culture Collection Administration, and the specific deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 1 Beichen West Road, Chaoyang District, Beijing; the deposit date is September 30, 2024, and the deposit number is CGMCC No. 32127. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 The morphology and function of NXO3, A: single colony of NXO3; B: Gram staining of NXO3; C: nitrogen fixation function of NXO3; D: IAA production ability of NXO3; E: phosphate solubilization function of NXO3;
[0033] Figure 2 The antagonistic effect of NXO3 strain on Fusarium neosporum;
[0034] Figure 3 The inhibitory effects of NXO3 on the pathogenic microorganisms in Table 2-1 are shown in order. In the figure, F: Anthracis sp.; K: Colletotrichumincanum.; G: F.graminearum; L: F.oxysporum; H: Didymella americana; M: Alternaria tenuissima; I: F.solani; N: Lasiodiplodia theobromae; J: F.equiseti;
[0035] Figure 4 Phylogenetic tree based on 16SrDNA for strain NXO3;
[0036] Figure 5 Heat map of ANI / AAI analysis for strain NXO3;
[0037] Figure 6 is the circular genome map of strain NXO3;
[0038] Figure 7 The effect of different concentrations of fermentation liquid on the germination rate of wheat, ck in the figure: sodium bicarbonate solution extracted fertilizer; treatment 1: 80% fermentation liquid extracted fertilizer;
[0039] Figure 8 is the cucumber seed germination index;
[0040] Figure 9 is the emergence rate of wheat potted under saline-alkali conditions. DETAILED DESCRIPTION
[0041] In the present invention, especially in the examples, the materials and methods used are common materials and methods in the art unless otherwise specified:
[0042] Test materials: Salt marshes collected from the Red Beach Wetland in Panjin City, Liaoning Province.
[0043] Test pathogens: Fusarium neocosmosporiellum, Anthracis sp., Colletotrichum incanum, F. graminearum, F. oxysporum, Didymella americana, Alternaria tenuissima, F. solani, Lasiodiplodia theobromae) and Fusarium equiseti (F.equiseti) were provided by the Microbiology Laboratory of Hebei Science and Technology Normal University, and all strains have been published in the literature (He Wanwan, Hu Pengju, Feng Lina, et al. Discovery of new symptoms of peanut fruit rot and analysis of the occurrence factors [J]. Journal of Peanut Science, 2023, 52(03): 28-34+55. DOI: 10.14001 / j.issn.1002-4093.2023.03.004.; Xu Limei, He Dan, Wang Gang, et al. Antagonistic bacteria of Fusarium graminearum Bacillus Isolation and identification of Fusarium oxysporum from tomato in Shandong Province[J]. Journal of Shandong Agricultural Sciences, 2019, 51(12): 78-81. DOI: 10.14083 / j.issn.1001-4942.2019.12.016. Lei Zaojuan, Wu Yaming, Liu Zihuan, et al. Isolation and identification of Alternaria tenuifolia from Huanghua winter jujube[J]. Journal of Chinese Plant Protection Guide, 2020, 36(01): 125-134. DOI: 10.16409 / j.cnki.2095-039x.2020.01.008. Journal of Biotechnology, 2020, 40(04): 17-20.; Yang Dongya, Qi Ruixue, Li Zhaoxuan, et al. Screening, identification and growth-promoting effect of antagonistic Bacillus against Fusarium solani of cucumber[J]. Biotechnology Bulletin, 2023, 39(02): 211-220. DOI: 10.13560 / j.cnki.biotech.bull.1985.2022-0522.; Zhao Xueyi, Chai Junfa, Zhang Xuanyi, et al. Identification of Fusarium equisetifolia and determination of its pathogenicity to Myzus persicae[J]. Chinese Journal of Biological Control, 2023, 39(01): 69-76. DOI: 10.16409 / j.cnki.2095-039x.2022.07.002.
[0044] The test bacterial agent carrier particles were provided by Hebei Jingan Fertilizer Technology Co., Ltd.
[0045] PDA medium: 200.0 g peeled potatoes, 20.0 g glucose, 20.0 g agar, 1000.0 mL distilled water, natural pH;
[0046] Salt-alkali tolerance LB screening medium: yeast extract powder 5.0 g, peptone 10.0 g, NaCl 30.0 g, agar 20.0 g, distilled water 1000.0 mL, pH 9.0;
[0047] Potassium-solubilizing bacteria isolation medium: Na2HPO4 2.0 g, FeCl3 5.0 mg, sucrose 5.0 g, MgSO4·7H2O 5.0 mg, feldspar powder 10.0 g, CaCO3 1.0 g, agar 2.0 g, distilled water 1000.0 mL, pH 7.3;
[0048] Inorganic phosphorus-dissolving bacterial isolation medium: (NH4)2SO40.50 g, MgSO40.30 g, glucose 10.0 g, NaCl0.30 g, FeSO40.018 g, Ca3(PO4)210.0 g, MnSO40.123 g, agar 20.0 g, distilled water 1000.0 mL, pH 7.2;
[0049] Seed culture medium: glucose 20.0 g / L, yeast extract powder 5.0 g / L, L-glutamic acid monosodium salt 10.0 g / L, K2HPO4 2.0 g / L, MgSO4 0.25 g / L;
[0050] Liquid fermentation medium: glucose 30.0 g / L, yeast extract powder 8.0 g / L, L-glutamic acid monosodium salt 30.0 g / L, K2HPO4 2 g / L, MgSO4 0.25 g / L.
[0051] The primers designed for 16S rDNA in the embodiment of the present invention are 16SF and 16SR, with an annealing temperature of 55° C., and were commissioned to be synthesized by Shanghai Sangon Co., Ltd.
[0052] 16SF (SEQ ID No. 1): AGAGTTTGATCCTGGCTCAG;
[0053] 16SR (SEQ ID No. 2): TACGGTTACCTTGTTACGACTT.
[0054] To further illustrate the present invention, a salt-alkali tolerant endophytic Bacillus subtilis strain provided by the present invention and its application in saline-alkali land improvement are described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.
[0055] Example 1
[0056] 1.1 Screening of endophytic strains of Suaeda salsa
[0057] Endophytic bacteria from Suaeda salsa were isolated according to the method of Pei Shulan et al. (Pei Shulan, Liu Dong, Liu Huiqin, et al. Screening, identification and antibacterial activity determination of endophytic bacteria from wild jujube [J]. Acta Phytophylacica Sinica, 2018, 45(04).). The isolated strains were purified by plate streak method and a 20% glycerol suspension was prepared and stored in a -20°C refrigerator for later use.
[0058] 1.2 Preliminary verification of phosphorus solubility and nitrogen fixation capabilities
[0059] The strain was activated by the plate streak method, and bacterial cakes with a diameter of 0.75 cm were inverted on nitrogen-free culture medium, organic phosphorus-degrading bacteria separation medium, and inorganic phosphorus-degrading bacteria separation medium, and cultured at 30°C to observe the growth status and the formation of transparent circles.
[0060] 1.3 Determination of colony characteristics and cell morphology
[0061] Purified strains were incubated inverted at 37°C for 24 hours. Colony characteristics, such as margins, viscosity, shape, and color, were observed according to the Bacterial Identification manual. Characteristics such as bacterial size and spore production were observed microscopically using Gram staining.
[0062] like Figure 1 As shown, a salt-tolerant bacterium, named NXO3, was isolated from the stems and leaves of a strictly surface-sterilized salt alkali canopy. It possesses the abilities to solubilize phosphate, fix nitrogen, produce IAA (indoleacetic acid), and produce polyglutamic acid. After incubation on salt- and alkali-tolerant LB screening medium at 37°C for 24 hours, the resulting colonies were round, wavy, opaque, milky white, with a rough surface and irregular edges. The strain was Gram-positive, rod-shaped, and spore-forming, measuring 0.7-1.1 μm by 2.0-7.0 μm.
[0063] 1.4 Determination of active metabolites
[0064] The Salkowski colorimetric method (Xing Danrun. Isolation and identification of biocontrol bacteria for peanut fruit rot and field control using microbial fertilizers [D]. Hebei Science & Technology Normal University, 2023) was used to determine the strain's ability to secrete IAA. The ethanol precipitation method (Fang Junnan, Lei Juan, Xu Lishan, et al. Research progress in microbial fermentation production of γ-polyglutamic acid [J]. Journal of Applied and Environmental Biology, 2018) was used to determine polyglutamic acid production: three volumes of 95% ethanol were added to the fermentation supernatant, the polyglutamic acid was dried in an oven at 40°C to a constant weight, and the weight was weighed on a high-precision electronic analytical balance. The polyglutamic acid mass concentration was calculated using the formula C = m / V.
[0065] 1.5 Identification of antibacterial effect
[0066] Using Fusarium neosporum, Fusarium oxysporum, Fusarium equisetifolia, Fusarium graminearum, Fusarium solani, Colletotrichum incanum, Alternaria tenuissima, Diplodia theobromin, Microbispora microspora, and Colletotrichum incanum as indicator bacteria, the antibacterial activity of functional strains was assessed using the plate standoff method. Each strain was cultured in triplicate at 28°C for 7 days. The inhibitory effect of the biocontrol agents on the pathogens was observed. When the control colonies filled the entire culture dish, the diameter of the inhibition zone was measured using the cross-hatch method, and the inhibition rate was calculated.
[0067] Inhibition rate (%) = (average diameter of colonies in the control group - average diameter of colonies in the test group) / average diameter of colonies in the control group × 100
[0068] From Table 1 and Figures 2-3 It can be seen that the average inhibition rate of strain NXO3 against colletotrichum incanum, Fusarium graminearum, Fusarium oxysporum, and Microbisporus is 60.00%-70.00%, among which the average inhibition rate against anthracnose is as high as 69.52%, and the average inhibition rate against Alternaria tenuis, Fusarium solani, Diplodia theobromin, and Fusarium equisetum is 50.00%-60.00%, indicating that it has significant inhibitory effects on the test pathogens and has a broad-spectrum antibacterial effect.
[0069] Table 1 Antibacterial activity of NXO3 against other pathogenic microorganisms
[0070]
[0071] 1.6 Physiological and biochemical identification
[0072] The physiological and biochemical functions of the functional strains were verified using HBI Bacillus biochemical identification strips (HBIG14, Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd.) according to the instructions.
[0073] The results of the HBI identification card are shown in Table 2. The functional strains were negative for VP and propionate, while the others were positive. They could not be identified as Bacillus subtilis, Bacillus amyloliquefaciens, or Bacillus velezinsis, and further identification was required.
[0074] Table 2 Physiological and biochemical characteristics of strain NXO3
[0075]
[0076] Note: “+” represents positive, and “-” represents negative.
[0077] 1.7 Mass spectrometry
[0078] Functional strains were identified by mass spectrometry using the formic acid method (Xingtai Center for Disease Control and Prevention).
[0079] 1.8 Molecular biological identification of functional strains
[0080] Genomic DNA was extracted using the boiling method, and 16S rDNA was amplified using universal primers 16SF and 16SR. The product was sent to Shanghai Bioengineering Technology Service Co., Ltd. for sequencing. Sequencing results were assembled using DNAMAN 6.0 and then compared using BLASTn. Whole-genome sequencing of the functional strain was performed at Shanghai Meiji Biopharmaceutical Technology Co., Ltd., and ANI / AAI analysis was performed using cloud-based tools to determine its taxonomic status.
[0081] After splicing and vector removal analysis using DNAMAN 7.0 software, BLAST comparison analysis was performed in NCBI. The results are as follows Figure 4 The strain NXO3 has a sequence similarity of 99.86% with Bacillus subtilis (NR_027552.1, NR_113265.1) and a sequence similarity of 99.86% with Bacillus velezinis (M7634546.1). However, it cannot be identified as Bacillus subtilis or Bacillus velezinis and needs further identification.
[0082] ANI / AAI analysis is mainly used to evaluate the relationship between species at the whole genome level. Generally, the ANI / AAI value between species is above 95%. Figure 5 It can be seen that the ANI / AAI values of the functional strain NXO3 and the whole genome of Bacillus subtilis are all above 95%, while the ANI / AAI values of the functional strain NXO3 and other bacterial genera are all below 90%, so the functional strain NXO3 is identified as Bacillus subtilis.
[0083] 1.9 Prediction and analysis of stress-resistant, growth-promoting and salt-alkali-tolerant genes in strain NXO3
[0084] The total genome size of strain NXO3 is 4431,343 bp, with a GC content of 43.47%. A total of 4610 genes (e.g. Figure 6 ), including the tryptophan-dependent IAA biosynthesis pathway and the betaine biosynthesis pathway, encoded by the gene clusters trpABCDE and betBI, which are involved in the biosynthesis of tryptophan, IAA, and betaine stress-resistant and growth-promoting metabolites (Table 3). In addition, a Na+ / H+ antiporter and a K+-Cl+ co-transporter related to salt tolerance were found, encoded by the genes ktrB and nhaC.
[0085] Table 3 NXO3 related genes that improve plant growth and enhance salt and alkali tolerance
[0086]
[0087]
[0088] 1.10 Preparation of Bacillus subtilis NXO3 agricultural microbial inoculant
[0089] Transfer the activated bacteria to the seed culture medium and incubate at 37°C, 200 rpm, and shaking for 12 hours. This will serve as the seed culture. Inoculate the seed culture into the fermentation medium at a 3% inoculum rate and incubate at 37°C, 180 rpm, and shaking for 72 hours. Collect the fermentation broth and bacterial sludge after centrifugation.
[0090] The bacterial sludge of the functional strain and diatomaceous earth are mixed in a ratio of 1:100, and then dried and adhered to the surface of the microbial agent carrier particles (composted material (20% to 30%); humic acid (15% to 20%); unripe mineral powder (25% to 30%); biochar (5% to 10%); bentonite (10% to 15%)) at a concentration of 300 million / g to prepare an agricultural microbial agent with an effective live bacteria count of 300 million / g.
[0091] 1.11 Determination of seed germination in Bacillus subtilis NXO3 fermentation broth under saline-alkali conditions
[0092] 10.00 g of fresh sample (microbial agent carrier particles) was weighed and placed in a 250 mL conical flask. After converting the water content of the sample, 3 g / L sodium bicarbonate solution was added according to a solid-liquid ratio (mass / volume) of 1:10 to collect the extract. The treatment group mixed the extract and fermentation broth in a ratio of 4:1, and the control group mixed the extract and water in a ratio of 4:1.
[0093] Place one or two pieces of filter paper in a culture dish, place 10 plump, uniform-sized wheat seeds, add 10 mL of the mixed liquid, and culture in a dark incubator at (25±2)°C for 24 / 48 / 72 h. Measure the seed germination rate and seed root length.
[0094] Seed germination index, expressed in %, is calculated according to the formula
[0095] Note: A1—The percentage of germinated seeds in the extract of the microbial carrier granules as a percentage of the total number of seeds placed, expressed in percentages; A2—The average root length of all seeds placed in the extract of the microbial carrier granules, expressed in millimeters; B1—The percentage of germinated seeds in the water-cultured seeds as a percentage of the total number of seeds placed, expressed in percentages; B2—The average root length of all seeds placed in the water-cultured seeds, expressed in millimeters.
[0096] The results are as follows Figure 7 As shown, under the stress of 2.4 g / L sodium bicarbonate solution, the germination rates of wheat seeds in 20% fermentation liquid in three time periods were 60.00%, 83.33% and 86.67%, respectively, while those in the control treatment were 20%, 53.3% and 66.7%, respectively. The treatment groups were significantly higher than the control (p < 0.05).
[0097] The results are as follows Figure 8 As shown, under the stress of 2.4 g / L sodium bicarbonate solution, the germination index of cucumber seeds cultured in 20% fermentation liquid for 48 hours was 158.86%, while the germination index of control cucumber seeds was 117.19%, which was significantly higher in the treatment group than in the control group (p < 0.05).
[0098] 1.12 Potted verification of wheat emergence rate under saline-alkali conditions
[0099] 0.3% saline-alkali soil was prepared by adding 25.4g NaCl, 30.8g Na2SO4, 18.25g NaHCO3, and 11.59g Na2CO3 to 1kg of ordinary loam and mixing them evenly. Potted experiments were conducted in the cultivation room of Hebei Changshengguo Fertilizer Research Institute Co., Ltd. Treatment groups were mixed with saline-alkali soil at fertilizer rates of 80kg / mu, 120kg / mu, and 160kg / mu, respectively. A blank control was used, using 0.3% saline-alkali soil without agricultural microbial agents or carrier particles. Each pot was filled with approximately 1kg of soil. After adjusting the soil moisture, wheat seeds were sown at a rate of 25 seeds per pot. The seeds were incubated at room temperature for 14 days, and the emergence rate was calculated. Each treatment was replicated three times.
[0100] The results are as follows Figure 9 As shown, the wheat germination rates of the control group at fertilizer rates of 80kg / mu, 120kg / mu and 160kg / mu were 0%, 0% and 8% respectively, while the wheat germination rates of the treatment groups were 92%, 40% and 32% respectively, which were significantly higher than those of the control treatment.
[0101] 1.13 Effects of agricultural microbial agents on improving peanut cultivation in slightly saline-alkali land in Changli Coast
[0102] The experimental site was Liangfeng Marine Ecological Technology Development Co., Ltd. in Qinhuangdao City, Hebei Province. The peanut variety was Jihua 572. The soil was slightly saline-alkali sandy with a salinity of 0.1-0.3% and a pH of 7.15-7.31. A randomized block method was used for the plot experiment, with each plot measuring 16 m2. 2 On May 17th, peanuts were planted on flat land without plastic film mulch. Seeds were treated with 10% clothianidin and 10% chlorpyrifos. The treatment group was broadcasted with 50 kg / mu of Bacillus subtilis NXO3, a microbial inoculant containing 300 million g / g, followed by rotary tillage. A control group was also provided with 50 kg / mu of inoculant carrier granules. Each treatment was replicated three times. Manual weeding was performed, and no three sprayings were applied. Moisture content was primarily dependent on rainfall.
[0103] Agricultural microbial agents include: compost; humic acid; mature mineral powder; biochar; Bacillus subtilis (effective live bacteria count ≥ 300 million / g).
[0104] As can be seen from Table 4, the peanut emergence rate and yield of the peanuts treated with the agricultural microbial agent containing Bacillus subtilis NXO3 were 83.15% and 158.76 kg / mu, while those of the control treatment were 75.53% and 139.36 kg / mu respectively. The peanut emergence rate and yield of the treated group were significantly higher than those of the control group (p < 0.05), and the yield increase rate was 13.92%, which indicates that the agricultural microbial agent containing Bacillus subtilis NXO3 has an improving effect on mild saline-alkali soil.
[0105] Table 4 Peanut germination rate under different treatments
[0106]
[0107] 1.14 Effects of agricultural microbial agents on improving peanut cultivation in mild to moderate saline-alkali soils in Huanghua, Cangzhou
[0108] The experimental site was Huanghua saline-alkali land in Cangzhou City, Hebei Province. The peanut variety was Jihua 572. The salinity was 0.1-0.5%, which is a light to moderate saline-alkali land. The randomized block method was used for the plot experiment. Each plot was 15m2. 2 Ridge formation, film covering, and sowing were carried out on May 22nd. The treatment group received a broadcast application of 80 kg / mu of a microbial inoculant containing 300 million Bacillus subtilis NXO3 followed by rotary tillage. The conventional control group received a broadcast application of 80 kg / mu of a compound microbial fertilizer (500 million Bacillus Velezii / g) followed by rotary tillage. The blank control group received a broadcast application of 80 kg / mu of inoculant carrier granules followed by rotary tillage. Each treatment was replicated three times, and field management was standard.
[0109] Agricultural microbial agents include: compost; humic acid; mature mineral powder; biochar; Bacillus subtilis (effective live bacteria count ≥ 300 million / g).
[0110] As shown in Table 5, the peanut yield per mu of the blank control group was 305.90 kg / mu, the peanut yield per mu of the conventional control group was 354.88 kg / mu, and the peanut yield per mu treated with the agricultural microbial agent containing Bacillus subtilis NXO3 was 385.71 kg / mu. The yield increase rate was 26.09% compared with the blank control, and the yield increase rate was 8.69% compared with the conventional control. The yield of the treated group was significantly higher than that of the control group (p < 0.05) (Table 4), which indicates that the agricultural microbial agent containing Bacillus subtilis NXO3 has an improving effect on light to moderate saline-alkali soil.
[0111] Table 5 Peanut yield under different treatments
[0112]
[0113]
[0114] The present invention isolates a salt-alkali tolerant endophytic Bacillus subtilis (Bacillus subtilis) from the stems and leaves of Suaeda salsa, which has the effects of promoting crop growth and inhibiting plant pathogens. The application of agricultural microbial inoculants containing Bacillus subtilis NXO3 on mild (salt content 0.1-0.3%) and mild to moderate (salt content 0.1-0.5%) soils can significantly increase the emergence rate and yield of peanuts, providing a solution for the improvement of saline-alkali land. In terms of the application of functional strains, the present invention first uses diatomaceous earth to adsorb the fermentation bacteria of Bacillus subtilis NXO3 to prepare bacterial powder, and then prepares it into an agricultural microbial inoculant through an adhesion process with inoculant carrier particles with synergistic enhancement functions. The main components of the inoculant carrier particles include compost, humic acid, mature mineral powder and biochar. These raw materials have certain functions in the improvement of saline-alkali land, and through formula optimization, a synergistic enhancement effect is produced on the NXO3 strain.
[0115] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A salt- and alkali-tolerant strain of Bacillus subtilis NXO3, whose deposit number is CGMCC No. 32127.
2. The method for culturing Bacillus subtilis NXO3 according to claim 1, wherein The method comprises inoculating the Bacillus subtilis NXO3 into a seed liquid culture medium and performing shaking culture for 12 hours to obtain a seed liquid; Inoculate the seed solution into the fermentation medium at a 3% inoculum volume and shake culture for 72 hours to obtain a fermentation liquid; The seed liquid culture medium includes the following components in concentrations: glucose 18.0-22.0 g / L, yeast extract powder 3.7-7.0 g / L, L-glutamic acid monosodium salt 7.8-12.6 g / L, K2HPO4 1.4-2.8 g / L, and MgSO4 0.20-0.31 g / L; The fermentation medium comprises the following components in concentrations: 20.0-40.0 g / L of glucose, 6.2-9.8 g / L of yeast extract powder, 21.8-39.9 g / L of L-glutamic acid monosodium salt, 1.2-3.0 g / L of K2HPO4 and 0.20-0.31 g / L of MgSO4.
3. The culture method according to claim 2, wherein The shaking culture conditions for culturing the seed solution were 37°C and 200 rpm; The shaking culture conditions during fermentation were 37°C and 180 rpm.
4. An agricultural microbial agent, characterized in that: The invention comprises bacterial mud obtained by centrifuging the fermentation liquid obtained by the culture method according to claim 2 or 3, and a carrier; the carrier comprises diatomaceous earth, decomposed material, humic acid, unripened mineral powder, biochar and bentonite.
5. The agricultural microbial agent according to claim 4, characterized in that The mass ratio of the bacterial mud to diatomaceous earth is 1:100; Among the components of the agricultural microbial agent, the mass percentage of decomposed material is 20-30%, the mass percentage of humic acid is 15-20%, the mass percentage of unripe mineral powder is 25-30%, the mass percentage of biochar is 5-10%, and the mass percentage of bentonite is 10-15%.
6. The agricultural microbial agent according to claim 5, characterized in that The concentration of Bacillus subtilis NXO3 in the agricultural microbial agent is 300 million / g.
7. Use of the Bacillus subtilis NXO3 of claim 1 or the fermentation liquid obtained by the culture method of claim 2 or 3 or the agricultural microbial agent of any one of claims 4 to 6 in at least one of the following: (1) phosphate solubilization; (2) Nitrogen fixation; (3)Production of IAA; (4) Promote the germination of crop seeds; (5) Promote crop yields; (6) Improve saline-alkali soil; (7) Antibacterial activity: the antibacterial activity is inhibition of anthrax, Fusarium graminearum, Fusarium oxysporum and Microbisporus.
Citation Information
Patent Citations
Bacillus subtilis, microbial agent prepared from bacillus subtilis, bio-organic fertilizer prepared from bacillus subtilis and application of bacillus subtilis and bio-organic fertilizer
CN117965349A