Streptomyces 891-DC with high yield of aureomycin A and application of streptomyces 891-DC

Abstract

The invention discloses streptomyces sp. 891-DC with high yield of aureomycin A and application of the streptomyces sp. 891-DC. An incomplete attB site sequence in a streptomyces 891 genome is firstly changed into a complete attB site sequence by utilizing a CRISPR-Cas9 technology, plasmids containing a target gene chry, an integrase phiC31 gene and an attP site are promoted, and the target gene integration rate is improved through specific binding of the attP site and the attB site on the genome; secondly, a promoter capable of obviously improving the yield is screened to express a aureomycin biosynthetic gene cluster, so that streptomyces 891-DC which is more stable and higher in yield is obtained, the shake-flask fermentation yield of aureomycin A is 1411.23 + / -29 mg / L, the yield of aureomycin A is improved by 60% compared with that of an original strain aureomycin A, the hereditary stability is good, and the application prospect is wide. And a technical foundation is laid for industrial production of the aureomycin.

Description

(I) Technical field

[0001] The invention belongs to the field of microbial pharmacy and relates to a strain of Streptomyces 891-DC with high yield of chrysomycin A and application thereof. (II) Background technology

[0002] Chloramphenicol A was discovered in 1955 and is a glycoside compound with a benzonaphthopyranone structure. Chloramphenicol A exhibits strong antibiotic, antitumor, antituberculosis and anti-neuroinflammatory activities. It effectively inhibits the proliferation, viability, migration and invasion of U251 and U87-MG glioblastoma cells through the Akt / GSK-3β / β-catenin pathway. In addition, chloramphenicol A is a rapid bactericidal agent that is highly active against Staphylococcus aureus persisters, can effectively remove biofilms in vitro, and maintain sustained bactericidal efficacy in vivo. Therefore, as one of the drug leads, chloramphenicol A has great application potential in the pharmaceutical industry, and more and more researchers such as chemists, biologists and pharmacologists have begun to pay attention to chloramphenicol substances. In recent years, through the improvement of production conditions and preparation technology, the development of chloramphenicol A derived from the marine sediment strain Streptomyces sp.891 as a potential therapeutic agent has made significant progress. However, the existing chloramphenicol production process mainly relies on fermentation production of naturally isolated wild-type Streptomyces strains, but these natural strains usually have the following problems: the antibiotic production of natural strains is generally low, which limits their application in large-scale industrial production; traditional random mutagenesis breeding methods are difficult to significantly increase the yield of strains in a short period of time and the mutant strains obtained are not stable enough; due to changes in natural conditions and culture medium composition, the metabolite production of natural strains may fluctuate.

[0003] In recent years, with the development of synthetic biology and genetic engineering technology, increasing antibiotic production through genetic engineering has become a new research hotspot. In this regard, multiplication of the target gene cluster is an effective strategy. By introducing additional antibiotic biosynthetic gene clusters into the host bacteria, the synthesis efficiency of the target product can be significantly improved. At the same time, other strategies can be combined to further increase antibiotic production, such as overexpressing positive regulators or knocking out negative regulators, replacing promoters of different strengths, increasing precursor supply, knocking out non-target gene clusters, eliminating by-products, multiple copies of gene clusters, chassis modification, etc.

[0004] Therefore, constructing an engineered strain with high production of chloramphenicol A can provide strong support for industrial production. (III) Summary of the invention

[0005] The purpose of the present invention is to provide a Streptomyces 891-DC with high yield of chloramphenicol A and its application. The present invention adopts an engineering strategy of gene cluster multiplication, by pre-inserting a specific attB site into the original strain Streptomyces 891, and then integrating the chloramphenicol biosynthetic gene cluster into the original strain genome under the action of integrase and specific promoter, successfully achieving stable multiplication of the chloramphenicol gene cluster in Streptomyces. The engineered strain can significantly increase the yield of chloramphenicol A, providing strong support for its application in industrial production.

[0006] The technical solution adopted by the present invention is:

[0007] The invention provides a Streptomyces sp. 891-DC with high yield of chrysomycin A, which is deposited in China Center for Type Culture Collection (CCTCC), with a deposit number of CCTCC NO:M 20241963, a deposit date of September 13, 2024, and a deposit address of Wuhan University, Wuhan, China, with a zip code of 430072.

[0008] The Streptomyces 891-DC of the present invention is constructed by introducing the chrysomycin biosynthesis gene cluster into the Streptomyces 891 pre-inserted with a specific attB site under the action of a specific promoter, and the specific steps are as follows:

[0009] (1) Using CRISPR-Cas9 gene editing technology, the cluster 22 of the same type as the chrysomycin biosynthetic gene cluster in Streptomyces 891 was knocked out and an attB site was inserted in situ to construct a plasmid vector pCRI-22 containing an attB sequence, wherein the nucleotide sequence of the cluster 22 of the same type as the chrysomycin biosynthetic gene cluster is shown in NCBI Seq: CP050693.1 at 6857070-6865015 bp; the nucleotide sequence of the attB site is shown in SEQ ID NO.4;

[0010] (2) using Redαβ homologous recombination technology to add the promoter gapdh in front of the chrysomycin biosynthesis gene cluster to obtain the recombinant plasmid p15A-chry-gapdh-phiC31; the promoter gapdh nucleotide sequence is shown in 41-325 bp in SEQ ID NO.1;

[0011] (3) The plasmid obtained in step (1) was introduced into E. coli ET12567 / pUZ8002 by electroporation;

[0012] (4) introducing the plasmid extracted in step (3) into the genome of Streptomyces 891 by conjugation transfer to obtain an engineered strain containing one attB site;

[0013] (5) The plasmid in step (2) is introduced into the genome of the engineered strain containing an attB site in step (4) by conjugation transfer under the action of integrase to obtain the aureomycin gene cluster multiplication engineered strain 891-DC.

[0014] The present invention also provides the application of the Streptomyces 891-DC in the production of chrysomycin A, and the application method is: inoculating the Streptomyces 891-DC into a fermentation medium, culturing for at least 13 days under the conditions of 28° C. and 220 rpm to obtain a fermentation liquid containing chrysomycin A; the fermentation medium is composed of: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean powder, 2.0 g / L calcium carbonate, and natural pH.

[0015] Furthermore, the Streptomyces 891-DC is first subjected to seed expansion culture before being inoculated into the fermentation medium, and then the seed liquid is inoculated into the fermentation medium at an inoculum concentration of 5% by volume, and the seed expansion culture step is as follows: the Streptomyces 891-DC is inoculated into an MS agar medium containing 50 μg / mL apramycin, activated at 28° C. for 5-6 days, and then inoculated into an ISP2 liquid medium containing 50 μg / mL apramycin, and cultured at 28° C. and 220 rpm for 48-72 hours to obtain a seed liquid;

[0016] The composition of the MS agar medium is: 20.0 g / L mannitol, 25.0 g / L cooked soybean powder, 20.0 g / L agar, and the pH is natural; the composition of the ISP2 liquid medium is: 4.0 g / L glucose, 4.0 g / L yeast extract, 10 g / L malt extract, and the pH is natural.

[0017] The invention firstly changes the incomplete attB site sequence (GTGCCGGGGCGGCCCTTGG) in the genome of Streptomyces 891 into a complete attB site sequence (GTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCG), promotes the plasmid containing the target gene chry, the integrase phiC31 gene and the attP site to specifically bind to the attB site on the genome through the attP site, and improves the integration rate of the target gene; secondly, a promoter capable of significantly improving the yield is screened to express the chrysomehizobium biosynthesis gene cluster, so as to obtain a more stable Streptomyces 891-DC with higher yield.

[0018] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0019] The invention constructs a Streptomyces 891-DC with high yield of chrysomycin A by modifying the original strain of Streptomyces 891 to increase specific attB sites and a strong promoter. The strain has good genetic stability and the plasmid is not lost after being passed on for multiple generations.

[0020] The present invention utilizes Streptomyces 891-DC to ferment and produce chrysomycin A, which is not only simple to operate, but also has a chrysomycin A yield as high as 1411.79±29.8 mg / L, which is 60% higher than that of the original strain.

[0021] The Streptomyces 891-DC provided by the invention can be applied to the industrial production of chrysomycin A, and provides an effective technical means for improving the fermentation potency of other antibiotics. (IV) Description of the drawings

[0022] Figure 1 :Gel electrophoresis of PCR products of plasmids p15A-chry-gapdh-phiC31 and p15A-chry-gapdh-cml-ccdb-phiC31. M: 2000 DNA marker, lanes 1-2: PCR products using the successfully constructed p15A-chry-gapdh-cml-ccdb-phiC31 and p15A-chry-gapdh-phiC31 plasmids as templates and T-gapdh-F and T-gapdh-R as upper and lower primers, respectively. The target band is 285 bp.

[0023] Figure 2 : Gel electrophoresis of PCR products after artificial insertion of one attB site in the genome of Streptomyces 891. M: 2000 DNA marker, lanes 1-4: PCR products using 22attB-F and 22attB-R as upper and lower primers after knocking in the attB site, the target band is 409 bp.

[0024] Figure 3 : Gel electrophoresis of PCR products of the genome of the original strain Streptomyces sp. 891 and the engineered strain Streptomyces sp. 891-DC obtained after the plasmid p15A-chry-gapdh-phiC31 was integrated into Streptomyces. a represents the original strain Streptomyces 891, M: 2000 DNA marker; lanes 1 and 2: PCR products of the genome of the original strain as a template using primers T-P15A-F / R and T-P15A-f / r as upper and lower primers, and the target band is 1589 bp; b represents the engineered strain, M: 2000 DNA marker; lanes 1 and 2: PCR products of the genome of the engineered strain as a template using primers T-P15A-F / R and T-P15A-f / r as upper and lower primers, and the target bands are 1589 and 1785 bp respectively.

[0025] Figure 4: HPLC detection chart of fermentation products of engineering strain 891-DC. According to the peak time, the three peaks B, A, and C are chrysomecin B, chrysomecin A, and chrysomecin C respectively.

[0026] Figure 5 : Bar chart of average yield of chloramphenicol A of engineered strain and original strain at 13 and 15 days of fermentation. (V) Specific implementation methods

[0027] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0028] The culture medium and solvent used in the examples are all water:

[0029] (1) Seed culture medium (ISP2 medium): 4.0 g / L glucose, 4.0 g / L yeast extract, 10 g / L malt extract, natural pH.

[0030] (2) Fermentation medium: 5.0 g / L soluble starch, 20.0 g / L glucose, 10.0 g / L soybean powder, 2.0 g / L calcium carbonate, pH natural.

[0031] (3) MS solid medium: 16.0 g / L mannitol, 25.0 g / L cooked soybean powder, 20.0 g / L agar, natural pH.

[0032] (4) LB solid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, 20.0 g / L agar powder, natural pH.

[0033] (5) LB liquid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, natural pH.

[0034] Example 1: Construction of a recombinant plasmid p15A-chry-gapdh-phiC3 with added promoter elements using Redαβ homologous recombination technology

[0035] (1) Construction of heterologous expression plasmid p15A-chry-phiC31 of chrysomycin biosynthetic gene cluster

[0036] A. Obtaining the target gene fragment: Extract the genome of the original strain Streptomyces 891 and digest it with the restriction endonuclease BsrGI-HF. After digestion, recover the chry fragment of the chrysomelin biosynthetic gene cluster. The nucleotide sequence is shown in NCBI Seq: CP050693.1, 6545734-6574668 bp.

[0037] B. Obtain the vector for expressing the target gene: Using the p15A-cm-tetR-tetO-hyg-ccdB (donated by Shandong University) plasmid as a template, use primers p15A-chry-F and p15A-chry-R to amplify the cloning vector p15A, so that both ends of the vector are endowed with homologous arms of the chrysomehizobium biosynthetic gene cluster, and recover the vector fragment after agarose gel electrophoresis.

[0038] Primer sequences:

[0039] p15A-chry-F:gcagggtcggcctgagcgccggaccggctcccgtgatcctgccggtgaacttcctggtcgacggcc

[0040] gcaccatcgtAGATCCGAAAACCCCAAGTTACG;

[0041] p15A-chry-R:ggccgtagatcgcgcccagcagggccagtttggcctggtcgcggtcgccggagaacgcccgctcggagagggccgt AGATCCTTTCTCTCTTTAGATC.

[0042] C. Obtaining the vector for expressing the target gene: The fragments obtained in A and B were treated with T4 DNA polymerase in vitro, and then electroporated into E. coli GB05-dir induced by arabinose and carrying the plasmid pSC101-BAD-ETgA-tet (gift from Shandong University) for assembly. The plasmid was extracted and named p15A-chry.

[0043] D. Obtain the target gene heterologous expression plasmid: transfer the p15A-chry plasmid into E. coli GB08-red (gift from Shandong University) to obtain E. coli GB08-red containing the p15A-chry plasmid. Extract the plasmid pR6K-oriT-phiC31 (gift from Shandong University) and cut it with restriction endonuclease AseI to release the oriT-attP-phiC31 fragment (phiC31 can promote the recombination of the attP site on the plasmid and the attB site in the Streptomyces genome), then electroporate the fragment into E. coli GB08-red containing the p15A-chry plasmid and culture at 37°C for 16-18h. Single colonies were picked for sequencing verification. The correct clones contained the heterologous expression plasmid p15A-chry-phiC31 of the chrysomycin biosynthesis gene cluster. The nucleotide sequence of the chry of the chrysomycin biosynthesis gene cluster was shown in NCBI Seq: CP050693.1 at 6545734-6574668 bp.

[0044] (2) gapdh promoter: gapdh-F and gapdh-R primers were used with pCRISPomyces-2 plasmid (purchased from Miaoling Biotechnology Co., Ltd.) as template, and PCR amplification was performed using the system in Table 1 and the amplification program in Table 2 to obtain a gapdh promoter fragment with a 40 bp left homology arm of plasmid p15A-chry-phiC31 on the left side, denoted as DNA1, with the nucleotide sequence shown in SEQ ID NO.1, wherein the primer sequences involved are as follows:

[0045] gapdh-F: ATCTacggccctctccgagcgggcgttctccggcgaccgcgctgctccTTcggt;

[0046] gapdh-R: TGTACAgcgtatcccctttcagatac;

[0047] (3) Resistance screening marker gene: cml-ccdb-F and cml-ccdb-R primers were used with p15A-cml-ccdb plasmid (gift from Shandong University) as template, and PCR amplification was performed using the system in Table 1 and the amplification program in Table 2 to obtain the cml-ccdb resistance fragment with BsrGI restriction sites added to both ends of the fragment and a 40 bp plasmid p15A-chry-phiC31 right homology arm on the right side of the fragment, denoted as DNA2, with the nucleotide sequence shown in SEQ ID NO.2, wherein the primer sequences involved are as follows:

[0048] cml-ccdb-F:tgaaaggggatacgcTGTACAATGGAGAAAAAAATCACTGG;

[0049] cml-ccdb -R: cccggtgacacaggccagggcgcaagagTGTACATGTACAtattccccagaacatcagg.

[0050] Table 1 PCR amplification system

[0051]

[0052]

[0053] Table 2 PCR amplification program:

[0054]

[0055] (4) Overlap extension PCR:

[0056] Using the overlap extension PCR amplification system in Table 3, under the action of primers gapdh-F and cml-ccdb-R, the two fragments of step (2) DNA1 and (3) DNA2 were fused into one fragment to obtain the fusion fragment chry-gapdh-cml-ccdb.

[0057] The first 15 cycles were performed according to the system in Table 3 and the amplification program in Table 2 for PCR reaction without adding primers to the system. After 15 cycles, the upstream and downstream primers gapdh-F and cml-ccdb-R were added to the system according to the system in Table 3 for PCR amplification reaction with 15 cycles. After the reaction was completed, the gel was cut and recovered.

[0058] Table 3 Overlap extension PCR amplification system

[0059]

[0060] (5) The p15A-chry-phiC31 plasmid constructed in step (1) was electroporated into E. coli GB08-red.

[0061] (6) The fusion fragment obtained in step (4) was mixed with the E. coli containing the p15A-chry-phiC31 plasmid in step (5), and linear-loop recombination was performed at 37°C under the action of Red αβ recombinase. The cells were then spread on an LB double-antibody plate containing 50 μg / mL apramycin and 25 μg / mL chloramphenicol, and cultured at 37°C for 16-20 h.

[0062] (7) The plasmid of the monoclonal clone grown in step (6) was extracted and then verified by PCR and sequencing using T-gapdh-F and T-gapdh-R. The electrophoresis diagram of PCR verification was as follows: Figure 1 As shown in lane 1, the recombinant plasmid p15A-chry-gapdh-cml-ccdb-phiC31 with added promoter elements and resistance selection markers was obtained.

[0063] T-gapdh-F:gctgctccttcggtcg

[0064] T-gapdh-R:gcgtatcccctttcagatac

[0065] (8) After plasmid extraction from the single clone verified correctly in step (7), BsrGI digestion was performed using the system in Table 4 to remove the resistance screening marker. After digestion, the p15A-chry-gapdh-phiC31 linear vector was recovered by electrophoresis gel.

[0066] Table 4 BsrGI enzyme digestion system

[0067]

[0068] (9) The vector fragments recovered from the electrophoresis gel in step (8) were ligated using the T4 ligase system in Table 5 at 16°C overnight. 10 μL of the ligated product was heat-shocked at 42°C and transformed into E. coli DH5α. After recovery, it was centrifuged at 5000 rpm for 5 min, the supernatant was removed, 100 μL was mixed by pipetting and spread on an LB plate containing 50 μg / mL apramycin, and cultured at 37°C for 16-20 h.

[0069] Table 5 T4 ligase system

[0070]

[0071] (10) Extract the plasmid from the monoclonal clone grown in step (9) and perform PCR verification and sequencing verification. The PCR verification electrophoresis diagram is as follows: Figure 1 As shown in lane 2, the recombinant plasmid p15A-chry-gapdh-phiC31 with added promoter elements was obtained.

[0072] Under the same conditions, the gapdh (EL) promoter was replaced with the ermEp* promoter (nucleotide sequence as shown in SEQ ID NO. 3) to construct the recombinant plasmid p15A-chry-ermEp*-phiC31 as a control.

[0073] Example 2: Construction of a plasmid for in situ introduction of a complete attB site into cluster 22 of the same type as chrysomycin in Streptomyces 891 using CRISPR-Cas9 gene editing technology

[0074] (1) Using the aureomycin homologous cluster 22 in Streptomyces 891 (nucleotide sequence as shown in NCBI Seq: CP050693.1 6857070-6865015 bp) as a template, 22-sgRNA-F and 22-sgRNA-R primers were designed, and the primers were annealed at 95°C for 5 min in a PCR instrument, and then cooled to 4°C at a rate of 0.1°C / S to form a double-stranded product sgRNA. After being diluted 10 times with ddH2O, the PCR reaction was carried out according to the system in Table 6 and the program in Table 7.

[0075] The primer sequences involved are as follows:

[0076] 22-sgRNA-F: AcgcGGATGAGCAGCCAGGACTAC;

[0077] 22-sgRNA-R:aaacGTAGTCCTGGCTGCTCATCC.

[0078] The Golden Gate assembly system is shown in Table 6 below:

[0079] Table 6 Golden Gate assembly system

[0080]

[0081] Table 7 Golden Gate assembly reaction procedure

[0082]

[0083] (2) Take 10 μL of the product after the Golden Gate assembly in step (1), heat-shock transform it into Escherichia coli DH5α at 42°C, centrifuge it at 5000 rpm for 5 min after recovery, remove the supernatant, take 100 μL of it, pipette and mix it, and spread it on a blue-white screening plate containing 50 μg / mL apramycin (spread 40 μL of 20 mg / mL Bluo-gal and 10 μL of 0.5 M IPTG on the surface of the LB plate), and culture it in a 37°C incubator for 12-16 h.

[0084] (3) The white monoclonal clone grown in step (2) was subjected to plasmid extraction and sequencing verification to obtain a vector for knocking out cluster 22 of the same type as aureomycin in Streptomyces 891.

[0085] (4) Using 22-up-F / R and 22-down-F / R primers and the genome of Streptomyces 891 as a template, PCR amplification was performed according to the system in Table 1 to obtain 1000 bp upstream and downstream homology arms of the aureomycin homologous cluster cluster 22, and the upstream and downstream homology arms were fused into one fragment according to the overlap extension PCR system in Table 3.

[0086] 22-up-F:gcgttttttatctagccgcgaggagctcgac;

[0087] 22-up-R:agtcgtccgctccgtcac.

[0088] 22-down-F:Gacggagcggacgact GTGCCAGGGCGTGCCCTTGGGCCTCCCCGGGCGCG tcatggctac ccacaac (the underline indicates the attB site, SEQ ID NO. 4);

[0089] 22-down-R: Gttcctggcctctagcgggcaacatgtttacgcc.

[0090] (5) The vector in step (3) was digested with XbaI according to the restriction system in Table 4 and recovered by electrophoresis. The fragment in step (4) was ligated to it according to the instructions of the seamless cloning kit, and heat-shocked and transformed into DH5α at 42°C. After recovery, the supernatant was removed and 100 μL was taken out by pipetting and mixed, and then coated on an LB plate containing 50 μg / mL apramycin, and cultured in a 37°C incubator for 12-16 h.

[0091] (6) The single clone grown in step (5) was subjected to plasmid extraction and sequencing verification to obtain a plasmid pCRI-22 in which the aureomycin homologous cluster cluster 22 was completely knocked out and a complete attB site was introduced in situ.

[0092] Example 3: Using CRISPR-Cas9 gene editing technology to insert the attB site into Streptomyces 891

[0093] (1) The plasmid pCRI-22 obtained in Example 2 was electroporated into the E.coil ET12567 / pUZ8002 strain, inoculated onto an LB plate containing 50 μg / mL apramycin, and cultured in a 37°C incubator for 12-16 h. Positive strains were screened to obtain the E.coil ET12567 / pUZ8002 strain containing the attB site as the donor strain.

[0094] (2) Inoculate Streptomyces 891 onto an IPS2 plate and culture it in a 28°C incubator for 3-4 days. Then add 5-6 mL of ddH2O to the plate and smear the plate with sterile cotton balls of uniform size. After smearing 5-6 plates in sequence, add the spore solution to a funnel with cotton and dispense the filtrate into 1.5 mL centrifuge tubes. Centrifuge at 12,000 rpm for 2 min, remove the supernatant and add 500 μL of

[0095] 20% glycerol, as recipient bacteria.

[0096] (3) Take 200 μL of the donor bacteria and recipient bacteria prepared in step (1) and step (2), mix them evenly and spread them on MS plate culture medium (70 mM MgCl2, 90 mM CaCl2), and place the plate in a 28°C incubator for 12-16 hours overnight.

[0097] (4) Spread 800 μL of sterile ddH2O (containing 500 μg / mL nalidixic acid and 1 mg / mL apramycin antibiotic) on the plate prepared in step (3), and then culture in a 28°C incubator until spores grow, which takes about 5-7 days.

[0098] (5) After selecting a single colony and culturing it for three generations, the genomic DNA was extracted and primers 22attB-F and 22attB-R were designed upstream and downstream of the knocked-out aureomycin homologous cluster cluster 22 for PCR verification and sequencing verification. The PCR verification results were as follows: Figure 2 The results showed that an engineered Streptomyces 891 was obtained with an attB site inserted in situ in cluster 22 of the same type as chrysomycin. This improved the recognition of the artificially inserted attB site by the integrase phiC31 on the plasmid, promoted the specific binding of the attP site on the plasmid with it, and further improved the integration efficiency of the chrysomycin gene cluster.

[0099] 22attB-F: ctacatgctgccgcactcg;

[0100] 22attB-R: cgagaccggagacctg.

[0101] Example 4. Acquisition of Streptomyces 891-DC strain

[0102] (1) The p15A-chry-gapdh-phiC31 plasmid obtained in Example 1 was electrotransformed into the E.coil ET12567 / pUZ8002 strain, inoculated onto an LB plate containing 50 μg / mL apramycin, and cultured in a 37°C incubator for 12-16 h. Positive strains were screened to obtain the E.coil ET12567 / pUZ8002 strain containing the p15A-chry-gapdh-phiC31 plasmid as the donor strain.

[0103] (2) The engineered Streptomyces 891 successfully inserted into the attB site obtained in Example 3 was used to prepare a recipient bacterium according to step (2) of Example 3.

[0104] (3) Take 200 μL of the donor bacteria and recipient bacteria prepared in step (1) and step (2), mix them evenly and spread them on MS plate culture medium (70 mM MgCl2, 90 mM CaCl2), and place the plate in a 28°C incubator for 12-16 hours overnight.

[0105] (4) Spread 800 μL of sterile ddH2O (containing 500 μg / mL nalidixic acid and 1 mg / mL apramycin antibiotic) on the plate prepared in step (3), and then culture in a 28°C incubator until spores grow, which takes about 5-7 days.

[0106] (5) After selecting a single colony and culturing it for three generations, genomic DNA was extracted. Two gene sequences on the plasmid that were not found in Streptomyces 891 were selected to design primers T-P15A-F / R and T-P15A-r / f. PCR amplification and sequencing were performed to verify the results. The genome of the original strain Streptomyces 891 was used as a control. The results were as follows: Figure 3 The engineered strain Streptomyces sp. 891-DC with the chrysomycin biosynthesis gene cluster inserted was obtained. It was deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCCNO: M 20241963 and a deposit date of September 13, 2024. Under the same conditions, the p15A-chry-gapdh-phiC31 plasmid was replaced with the plasmid p15A-chry-ermEp*-phiC3, and other operations were the same. The engineered bacteria obtained were the control engineered bacteria.

[0107] T-P15A-F:ggtaggaagcagggagtgac T-P15A-R:cgaaaggcaggaacagga

[0108] T-P15A-f:aggaccagccgaggagtt T-P15A-r:cgaccacgatgaccgagt

[0109] Example 5: Detection of fermentation products of engineered strains

[0110] (1) The engineered strain 891-DC was inoculated into MS agar medium containing 50 μg / mL apramycin, activated at 28° C. for 5 days, and then inoculated into ISP2 liquid medium, cultured at 28° C. and 220 rpm for 48 to 72 hours to obtain seed liquid;

[0111] (2) The seed solution obtained in step (1) was inoculated into the fermentation medium at a volume concentration of 5%, and cultured at 28° C. and 220 rpm for 13 days to obtain the fermentation liquid, which was centrifuged to collect the mycelium. Three parallel experiments were set up.

[0112] (3) The mycelium obtained in step (2) was suspended in two volumes of methanol, ultrasonicated at 40 kHz and 100 W for 30 min, filtered through a 0.22 μm filter membrane, and the supernatant was taken and the content of chloramphenicol A was detected by HPLC to calculate its potency. The detection chart is as follows: Figure 4 shown.

[0113] (4) The chloramphenicol A standard was prepared into a solution with a certain concentration gradient using methanol, and the peak area was determined by HPLC and a chloramphenicol A standard curve was drawn to quantitatively analyze the chloramphenicol A in the fermentation product. The total titer of chloramphenicol A in the shake flask fermentation of the engineered strain 891-DC was 1411.23±29 mg / L. The total titer of chloramphenicol A in the shake flask fermentation of the control engineered strain was 1161.35±74 mg / L.

[0114] The HPLC detection conditions are as follows: the chromatographic column is a Phenomenex (Luna, 250×4.6 mm) C18 chromatographic column, the HPLC mobile phase is a 50% acetonitrile aqueous solution, the detection wavelength is 254 nm, and the injection volume is 5 μL.

[0115] Example 6: Detection of the potency of chlortetracycline A after fermentation of the engineered strain for 13 and 15 days

[0116] The engineered strain 891-DC and the original strain 891 obtained in Example 6 were fermented and cultured under the conditions of Example 5, and three parallels were set. Samples were taken for detection on the 13th day and the 15th day, and the chrysomycin A production of the original strain was 885.25±61.24 mg / L when the sampling time was 13d, and the chrysomycin A production of the engineered strain 891-DC was 1039.49±57.5 mg / L, which was higher than the chrysomycin A production of the original strain. At 15d, the chrysomycin A production of the original strain was 881.84±43.08 mg / L, and the chrysomycin A production of the engineered strain 891-DC was 1411.79±29.8 mg / L, which was 60% higher than that of the original strain. The average yield analysis diagram is shown in the figure below. Figure 5 shown.

[0117] The above-described embodiment is only a preferred solution of the present invention and does not limit the present invention in any form. Any modification, replacement and improvement made on the basis of the present invention shall be included in the protection scope of the present invention.

Claims

1. Streptomyces sp. 891-DC with high production of chrysomycin A is deposited in China Center for Type Culture Collection with the deposit number CCTCC NO:M 20241963, the deposit date is September 13, 2024, and the deposit address is Wuhan University, Wuhan, China, Postal Code 430072.

2. A method for constructing the Streptomyces 891-DC according to claim 1, comprising the following steps: (1) Using CRISPR-Cas9 gene editing technology, the cluster 22 of the same type as the chrysomycin biosynthesis gene cluster in Streptomyces 891 was knocked out and an attB site was inserted in situ to construct a plasmid vector pCRI-22 containing an attB sequence; the nucleotide sequence of the attB site is shown in SEQ ID NO.4; (2) using Redαβ homologous recombination technology to add the promoter gapdh in front of the chrysomycin biosynthesis gene cluster to obtain the recombinant plasmid p15A-chry-gapdh-phiC31; the promoter gapdh nucleotide sequence is shown in 41-325 bp in SEQ ID NO.1; (3) The plasmid obtained in step (1) was introduced into E. coli ET12567 / pUZ8002 by electroporation; (4) introducing the plasmid extracted in step (3) into the genome of Streptomyces 891 by conjugation transfer to obtain an engineered strain containing one attB site; (5) The plasmid in step (2) is introduced into the genome of the engineered strain containing an attB site in step (4) by conjugation transfer under the action of integrase to obtain Streptomyces 891-DC.

3. Use of the Streptomyces 891-DC according to claim 1 in the fermentation production of chrysomycin A.

4. The use according to claim 3, characterized in that The application method is: inoculating the Streptomyces 891-DC into a fermentation medium, culturing for at least 13 days at 28°C and 220rpm to obtain a fermentation liquid containing chrysomycin A; the fermentation medium is composed of: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean powder, 2.0 g / L calcium carbonate, and natural pH.

5. The use according to claim 4, characterized in that The Streptomyces 891-DC is firstly subjected to seed expansion culture before being inoculated into the fermentation medium, and then the seed liquid is inoculated into the fermentation medium at an inoculum amount of 5% by volume, wherein the seed expansion culture steps are as follows: inoculating the Streptomyces 891-DC into the MS agar medium containing 50 μg / mL apramycin, activating at 28° C. for 5-6 days, and then inoculating into the ISP2 liquid medium containing 50 μg / mL apramycin, culturing at 28° C. and 220 rpm for 48-72 hours to obtain the seed liquid; the composition of the MS agar medium is: 20.0 g / L mannitol, 25.0 g / L cooked soybean powder, 20.0 g / L agar, and the pH is natural; The composition of ISP2 liquid medium is: 4.0 g / L glucose, 4.0 g / L yeast extract, 10 g / L malt extract, pH natural.

Images