Conserved b-cell epitope peptide tg12 of ragapdh, nucleic acid molecule, recombinant vector and application thereof
By displaying the conserved B-cell epitope peptide TG12 of RaGAPDH on the surface of inert carrier bacteria, a direct-mediated agglutination assay method was established, which solved the specificity and sensitivity problems of existing detection of Riemerella anatipestifer and achieved rapid and highly specific detection of Riemerella anatipestifer.
Patent Information
- Application Number
- CN202411948684.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-12-27
AI Technical Summary
Existing methods for detecting Riemerella anatipestifer have problems such as cross-reactivity, low sensitivity, cumbersome operation, and long time consumption. They are difficult to detect infections of different serotypes and strains quickly and specifically. Furthermore, existing methods cannot effectively distinguish similar lesions caused by Riemerella anatipestifer from other bacteria.
Using the conserved B-cell epitope peptide TG12 of RaGAPDH and its nucleic acid molecule, a direct-mediated agglutination assay was established on the surface of inert bacterial vectors via a recombinant vector to specifically recognize RA infection antibodies and construct a rapid detection system.
It achieves specificity and sensitivity detection of different serotypes of Riemerella anatipestifer infection, reduces detection time, is suitable for large-scale rapid detection in large-scale farms, and has good specificity, sensitivity and repeatability.
Smart Images

Figure CN119709659B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology and immunodiagnostic detection technology, and particularly relates to a duck Riemerella anatipestifer surface adhesion factor 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) conserved B cell epitope peptide TG12, a nucleic acid molecule, a recombinant vector and application thereof. BACKGROUND
[0002] Riemerella anatipestifer infection (RAI) is an acute or chronic, contact, septic infectious disease caused by Riemerella anatipestifer (RA) infection in ducks, geese, turkeys and other birds, and is often combined with E. coli to cause disease, which can cause duck infectious serositis characterized by fibrin pericarditis, perihelitis, air sacculitis, caseous salpingitis and meningitis. The pathogen can cause the mortality of waterfowl to be as high as 90%, and because of its high pathogenicity and persistence in the environment, it has become one of the main pathogens causing serious economic losses in the duck industry.
[0003] RA is a gram-negative bacterium, belongs to the family of Flavobacteriaceae, and the genus of Riemerella. Under a microscope, it can be observed that the bacterium has a capsule, no spores, no flagella, and cannot move; gram staining can be seen at both poles. The bacterial body exists mostly in single form, and occasionally in chain arrangement. The bacterium has high requirements for growth conditions, needs sufficient nutrition, and grows well on suitable culture media such as chocolate plates, trypsin soybean agar (TSA), fresh blood agar plates, and other common culture media plates. The growth speed is slow or even does not grow on ordinary agar plates and other commonly used culture media plates. 5% CO2 is helpful for the growth of RA.
[0004] The preliminary diagnosis of RA infection is generally based on the clinical symptoms and necropsy changes of the diseased animals, such as whether obvious clinical symptoms such as fibrous perihelitis, fibrous pericarditis, and fibrous air sacculitis are found. However, clinical practice has found that not only Riemerella anatipestifer can cause the above-mentioned lesions, but also Escherichia coli and Salmonella infection can cause the above-mentioned lesions. Therefore, relying solely on clinical symptoms and necropsy changes to diagnose the disease is not accurate, and laboratory diagnosis is needed for accurate diagnosis. At present, the detection methods for Riemerella anatipestifer mainly revolve around pathogen observation, biochemical identification, agglutination test, agarose gel diffusion test, enzyme-linked immunosorbent assay, fluorescent antibody detection technology, and molecular biology detection technology. However, the existing detection techniques have many problems, such as the ordinary whole bacteria agglutination test is prone to cross-reaction; the agarose gel diffusion test has low sensitivity, and when the antibody titer is too low, the same type of antigen and antibody reaction is weak, false negative results are easily produced; the classical methods of isolation and culture and biochemical property observation have the defects of complicated operation, long time-consuming, and low initial isolation rate from infected animals. Therefore, there is an urgent need for a specific, sensitive, convenient, and fast detection and diagnosis method for Riemerella anatipestifer.
[0005] The serotypes of Riemerella anatipestifer are very complex, and there are regional differences in isolates. Currently, there have been 25 serotypes reported, and there is a lack of effective cross-protection between each serotype, so there may be mixed infection of several serotype RA strains in the same breeding farm, which brings great challenges to the diagnosis and prevention and control of Riemerella anatipestifer disease. At present, the dominant serotypes of Riemerella anatipestifer in China are serotypes 1, 2, and 10, and studies have shown that all Riemerella anatipestifer can secrete a GAPDH homolog protein on the cell surface, which is encoded by the gap gene and has a relative molecular weight of 36.7 KDa. Researchers named it RaGAPDH. Studies have shown that RaGAPDH deficiency significantly reduces the adhesion and invasion ability of duck embryo fibroblasts, indicating that RaGAPDH is related to RA adhesion, colonization, and pathogenicity. At the same time, the recombinant RaGAPDH protein (with enzyme activity) can bind to plasminogen and histidine-rich glycoprotein in duck plasma to interact with each other to promote bacterial invasion ability, which is a key step in bacterial adhesion, colonization, or establishment of infection in the host.
[0006] In summary, RaGAPDH can play a role in the adhesion and infection of RA through two ways: (1) present on the surface of the bacterial cells, bind to host cells, improve the adhesion to host cells, and promote the colonization of bacteria; (2) secreted to the extracellular, interact with the plasma protein components of the host, and affect the blood coagulation system / fibrinolytic system. Therefore, RaGAPDH is an adhesion and infection factor of Riemerella anatipestifer, is highly conserved in different serotype strains, and plays an important role in the process of infection and pathogenesis. Based on the limitations of the existing detection methods and prevention and control measures, there is an urgent need for a rapid and convenient, specific, sensitive, suitable for different serotype strains of infection detection reagent and detection method. SUMMARY
[0007] The technical problem solved by the present application is to provide a RA adhesion and infection factor 3-phosphoglyceraldehyde dehydrogenase RaGAPDH conservative B cell epitope TG12 that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.
[0008] The technical problem solved by the present application is to provide a RA adhesion and infection factor 3-phosphoglyceraldehyde dehydrogenase RaGAPDH conservative B cell epitope TG12 that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.
[0009] The technical problem solved by the present application is to provide a RA adhesion and infection factor 3-phosphoglyceraldehyde dehydrogenase RaGAPDH conservative B cell epitope TG12 that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.
[0010] The technical problem solved by the present application is to provide a RA adhesion and infection factor 3-phosphoglyceraldehyde dehydrogenase RaGAPDH conservative B cell epitope TG12 that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.
[0011] The technical problem solved by the present application is to provide a RA adhesion and infection factor 3-phosphoglyceraldehyde dehydrogenase RaGAPDH conservative B cell epitope TG12 that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.
[0012] The technical problem solved by the present application is to provide a RA adhesion and infection factor 3-phosphoglyceraldehyde dehydrogenase RaGAPDH conservative B cell epitope TG12 that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.
[0013] Technical scheme: In order to solve the above technical problems, the first aspect of the present application provides a conservative B cell epitope peptide TG12 of 3-phosphoglyceraldehyde dehydrogenase which is an adhesion and infection factor of RA, and the amino acid sequence of the conservative B cell epitope peptide TG12 is TVDGPSMKDWRG.
[0014] Among them, TG12 is the 187-198th amino acid residue from the N terminus of RaGAPDH protein.
[0015] The nucleic acid molecule encoding the conserved B cell epitope peptide TG12 has a nucleotide sequence of ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.
[0016] The third aspect of the present application provides a recombinant gene peg-RA-TG12 in which the TG12 epitope sequence is inserted into the peg gene, and the nucleotide sequence of the recombinant gene is shown as SEQ ID NO. 1.
[0017] The fourth aspect of the present application provides a recombinant Peg protein in which the conserved B cell epitope TG12 is expressed on the Peg pilus, and the amino acid sequence of the recombinant Peg protein is shown as SEQ ID NO. 3.
[0018] The fifth aspect of the present application provides an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which comprises the nucleic acid molecule or the recombinant gene peg-RA-TG12 or the recombinant gene pegA-TG12.
[0019] The sixth aspect of the present application provides a construction method of the recombinant vector, comprising the following steps:
[0020] (1) obtaining the gene sequence of the conserved B cell epitope peptide TG12 of the RA adhesion colonization and the pathogenic factor 3-phosphoglyceraldehyde dehydrogenase, and the gene sequence is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.
[0021] (2) inserting the gene sequence obtained in step (1) into a vector containing the gene sequence of the Peg pilus, to construct a recombinant vector.
[0022] Specifically, the present application further provides an expression vector pBR-peg-RA-TG12, in which the DNA sequence of the conserved B cell epitope peptide TG12 of the RA adhesion colonization and the pathogenic factor 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) is inserted into the gene sequence of the Peg pilus, and the gene sequence of the Peg pilus with the conserved B cell epitope peptide TG12 is cloned into the pBR322 vector for expression, to obtain the pBR-peg-RA-TG12 expression vector.
[0023] The seventh aspect of the present application provides a construction method of the recombinant strain, comprising introducing the recombinant vector into a carrier bacterium.
[0024] The introduction method is an electrotransformation method, and the carrier bacterium is an inert carrier bacterium.
[0025] Specifically, the application further provides a S9H-pBR-peg-RA-TG12 recombinant bacteria which displays a conserved B cell epitope peptide TG12 of RA adhesion and infection pathogenic factor 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) on the surface, wherein the expression vector pBR-peg-RA-TG12 is introduced into the inert carrier Salmonella S9H by means of electroporation, and the expression of the conserved B cell epitope peptide TG12 of the RA adhesion and infection pathogenic factor 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) on the surface of the S9H-pBR-peg-RA-TG12 recombinant bacteria is verified by agglutination test.
[0026] The eighth aspect of the application provides application of the conserved B cell epitope peptide TG12, the nucleic acid molecule, the recombinant gene peg-RA-TG12 or the recombinant gene pegA-TG12, the recombinant protein, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain in preparation of a reagent or kit for detecting duck infectious bursal disease virus.
[0027] The ninth aspect of the application provides a detection system or a detection kit for RA infection antibody, wherein the detection system or the detection kit comprises the conserved B cell epitope peptide TG12, the nucleic acid molecule, the recombinant gene peg-RA-TG12 or the recombinant gene pegA-TG12, the recombinant protein, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain.
[0028] The tenth aspect of the application provides an in vitro agglutination test detection method for specific recognition and combination of RA infection antibody mediated by the conserved B cell epitope peptide TG12, wherein the detection antigen in the plate agglutination test detection method is S9H-pBR-peg-RA-TG12 recombinant bacteria which expresses the conserved B cell epitope peptide TG12, and the detection control is S9H-pBR-peg, which is compared with the detection antigen and only lacks the conserved B cell epitope peptide TG12 of the RaGAPDH protein, so that the specificity of detection is ensured.
[0029] Beneficial effects: Compared with the prior art, the application has the following obvious advantages:
[0030] (1) The conserved B cell epitope peptide TG12 provided by the application is a functional domain of the conserved epitope of RA adhesion and infection pathogenic factor 3-phosphoglyceraldehyde dehydrogenase.
[0031] (2) The present application also verifies that the vector bacteria surface expresses the Peg pilus, and the functional domain of the specific antigen epitope of the 3-phosphoglyceraldehyde dehydrogenase of the duck Riemerella anatipestifer adhesion and infection pathogenic factor expressed on the surface of the vector bacteria through the Peg pilus functional display can specifically recognize and combine the RA infectious antibody against the 3-phosphoglyceraldehyde dehydrogenase epitope antigen.
[0032] (3) The detection antigen S9H-pBR-peg-RA-TG12 of the present application only increases the conservative B cell epitope peptide TG12 compared with the detection control S9H-pBR-peg, which ensures the specificity of the agglutination test detection method directly mediated by the conservative B cell epitope antigen TG12;
[0033] (4) The present application uses the Peg pilus display expression system to amplify and display the conservative B cell epitope peptide TG12 of the RA adhesion and infection pathogenic factor 3-phosphoglyceraldehyde on the surface of the inert vector bacteria S9H, which ensures the sensitivity of the detection;
[0034] (5) The present application selects the conservative B cell epitope peptide TG12 to establish the in vitro agglutination test detection method of the RA infectious antibody specific recognition and combination directly mediated by the conservative B cell epitope peptide TG12. The method does not need bacterial isolation and culture, and reduces the identification time required.
[0035] In summary, the present application provides a convenient, specific, and suitable agglutination test detection reagent, kit and detection method for different serotypes of RA infection. The B cell epitope peptide TG12 selected in the present application is highly conservative in different serotypes of RA strains, and is expected to become an important technology and platform for the diagnosis, monitoring and prevention and control of RA infection. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 , RA 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) protein conservation analysis. The RaGAPDH protein conservative B cell epitope peptide sequence provided by the present application is displayed in the red rectangular box.
[0037] Figure 2 , RA 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) and B cell epitope peptide conservation analysis results. The RaGAPDH amino acid sequences in different duck Riemerella anatipestifer are highly conservative and consistent, and are significantly different from the GAPDH protein sequences in the RA infected host ducks, geese and other host animals. The RaGAPDH conservative B cell epitope amino acid sequence provided by the present application is shown in the yellow rectangular box in the figure, and the sequence and difference of the GAPDH protein in the infected duck and goose host are displayed.
[0038] Figure 3, the schematic diagram of recombinant vector pBR-peg-RA-TG12 plasmid expressing TG12.
[0039] Figure 4 , the electrophoretogram of PCR amplification identification of peg-RA-TG12 and the peg operon gene carried by Salmonella pullorum standard strain CVCC 526, wherein lane M is Trans 2K plus II DNA Marker, lane 1 is the genome amplification product of DH5α engineering bacteria as a negative control, lane 2 is the PCR amplification product of the Peg fimbrial operon containing TG12 epitope peptide of pUC57-peg-RA-TG12, and lane 3 is the PCR amplification product of the Peg fimbrial operon of Salmonella pullorum standard strain CVCC 526.
[0040] Figure 5 , the nucleic acid electrophoretogram of pBR-peg-RA-TG12 and pBR-peg identified by enzyme digestion, wherein lane M is Trans 2K plus II DNA Marker, lane 1 is pBR322 circular plasmid, lane 2 is recombinant circular plasmid pBR-peg-RA-TG12, lane 3 is the product of double enzyme digestion of pBR-peg-RA-TG12 by Nhe I and Eag I, lane 4 is recombinant circular plasmid pBR-peg, and lane 5 is the product of double enzyme digestion of pBR-peg by Nhe I and Eag I.
[0041] Figure 6 , the specificity verification detection result map of the in vitro agglutination test detection method of duck Riemerella anatipestifer infection antibody specific recognition and combination directly mediated by conserved B cell epitope peptide TG12, wherein the detection antigen is recombinant bacteria S9H-pBR-peg-RA-TG12 expressing TG12 (right) and the detection control is S9H-pBR-peg (left). If the agglutination reaction is negative, there are no agglutination particles in the reaction solution, and the background is turbid; if the agglutination reaction is positive, visible agglutination particles are produced in the reaction solution, and white agglutination particles are deposited on both sides of the reaction solution. “-” represents negative agglutination reaction, “+” represents positive agglutination reaction, and the agglutination particles in the positive reaction are marked with a red arrow in the figure. DETAILED DESCRIPTION
[0042] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for the purpose of describing specific specific embodiments, rather than for the purpose of limiting the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. The embodiments of the present invention will be further described below in conjunction with the examples. The examples are intended to illustrate the present invention and should not be construed as limiting the scope of the invention. In addition to the specific methods, equipment, and materials used in the examples, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials described in the examples of the present invention may also be used to implement the present invention, based on the prior art mastery of those skilled in the art and the description of the present invention.
[0043] Example 1. Comparison and Analysis of RaGAPDH Protein Sequences, a Pathogenic Factor for RA Adhesion, Colonization, and Infection, and Determination of the Conserved B Cell Epitope Peptide TG12 Sequence
[0044] The RA genome sequence was retrieved from the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / ). Only strains with complete genome information were collected. Sequence alignment and analysis of the RaGAPDH proteins from 40 strains revealed that the amino acid sequence conservation of Riemerella anatipestifer RaGAPDH ranged from 97.9% to 100%, indicating that this protein is highly conserved among RA strains and could serve as a candidate antigen for diagnosing all RA serotypes. Conserved sequences of the RaGAPDH protein were further analyzed. Based on predictions from the online B cell epitope prediction website (https: / / www.iedb.org / ), conserved B cell epitopes of the RaGAPDH protein were identified. An optimized amino acid sequence of the conserved RaGAPDH epitope peptide was selected and named TG12: TVDGPSMKDWRG.
[0045] The nucleotide sequence of the conserved B cell epitope peptide TG12 of RA adhesion, colonization and pathogenicity factor RaGAPDH is: ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.
[0046] Example 2 Selection of replacement sites for the conserved B cell epitope peptide TG12 of RaGAPDH in Peg pili
[0047] According to the Salmonella Pullorum CVCC 526 peg operon sequence (SEQ ID NO. 4), the chicken Salmonella Pullorum CVCC526 Peg pilus was predicted using the PredictProtein online website (https: / / predictprotein.org / ), to find the amino acids exposed on the surface of Peg, and the spatial structure of Peg was predicted using the protein tertiary structure online prediction website SWISS-MODEL, and the spatial structure of Peg was visualized using the protein analysis software Pymol (https: / / pymol.org / 2 / ). The exposed position of PegA was selected as the replacement site of the RaGAPDH protein conserved B cell epitope TG12.
[0048] Construction of recombinant vectors pBR-peg-RA-TG12 and pBR-peg expressing TG12 and Peg respectively
[0049] According to the Salmonella Pullorum CVCC 526 peg operon sequence (SEQ ID NO. 4), the above determined RaGAPDH conserved B cell epitope TG12 sequence and the replacement exposed site of RaGAPDH conserved B cell epitope TG12 in pegA, a plasmid containing the full-length peg operon of RaGAPDH conserved B cell epitope TG12 nucleotide sequence was synthesized by Beijing Qikexin Biotechnology Co., Ltd., named pUC57-peg-RA-TG12. At the same time, a pair of molecular cloning primers was designed for peg-RA-TG12 (SEQ ID NO. 1), the upstream primer was peg-F: 5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3'; the downstream primer was peg-R: 5'-CT CGGCCGTTAATTATAAGATACCACGATTAATGC-3', the underlined sequences represent Nhe I and Eag I restriction enzyme sites respectively. The full length of peg-RA-TG12 was amplified using the upstream and downstream primers peg-F / R with pUC57-peg-RA-TG12 as template, the amplification system was pfu high-fidelity DNA Polymerase (2.5 U / μL) (Beijing Zixingjin Biotechnology Co., Ltd.) 1 μL, 5x pfu DNA polymerase buffer 10 μL, dNTPs 4 μL, the upstream and downstream primers (10 μM) 1 μL each, pUC57-peg-RA-TG12 template 1 μL, ultrapure water 32 μL. The above system was mixed uniformly and then PCR amplification was performed using a thermal cycler (Bio-Red), the PCR program was: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 3 min, 30 cycles; 72 °C extension for 10 min again; after the amplification ended, the temperature was reduced to 4 °C for preservation. At the same time, the genome of Salmonella pullorum CVCC 526 was set as a positive control; the genome of E. coli engineering bacteria DH5α was set as a negative control.
[0050] The PCR products were electrophoresed in a 1.0% agarose gel at 110 V, after electrophoresis, the electrophoresis results were observed using a gel imaging instrument after staining with ethidium bromide, the results are shown in Figure 4 , Salmonella pullorum CVCC 526 and pUC57-peg-RA-TG12 both amplified 4850 bp of DNA product, while the negative control E. coli engineering bacteria DH5α genome did not amplify any band. The peg-RA-TG12 amplified by pUC57-peg-RA-TG12 and the full length of the peg operon (SEQ ID NO. 4) amplified by the genome of Salmonella pullorum CVCC 526 were purified using a universal DNA purification and recovery kit (Tiangen Biotech (Beijing) Co., Ltd., Catalog No: DP214), and the purified products were stored at -20 °C for standby.
[0051] The E. coli DH5α engineering bacteria were preserved in the laboratory. The pBR322 plasmid purchased from Moliol plasmid platform was electroporated into DH5α competent cells using an electroporator at 1.8 KV voltage to obtain DH5α recombinant bacteria containing pBR322 plasmid, which was stored at -80 °C. The DH5α containing pBR322 plasmid stored in the -80 °C frozen tube was streaked on an LB plate containing ampicillin (Amp + ) and incubated at 37 °C overnight under inversion, and then a single colony was picked and inoculated in 4 mL of fresh Amp +Liquid LB medium, 37℃, 220rpm overnight shaking culture, the next day 1:100 transfer to 4 mL fresh Amp + Liquid LB medium, after 37℃, 220rpm overnight shaking culture, use fast plasmid extraction kit (Tiangen, Beijing, China, Cat: DP105) to extract pBR322 plasmid. Use Nhe I and Eag I restriction endonuclease (NEB, Beijing, China, Cat: R3131, R3505) to double enzyme cut the extracted pBR322 plasmid and purified peg-RA-TG12 fragment and peg operon full length, electrophoresis in 1.0% agarose gel at 110V voltage, cut the target band and purify using universal DNA purification recovery kit, then use T4 DNA ligase (NEB, Beijing, China, Cat: M0202) to connect the purified pBR322 plasmid enzyme cut fragments with peg-RA-TG12 enzyme cut fragments and peg operon enzyme cut fragments at 16℃ metal bath overnight, the next day transform the DH5α competent cells with the ligation product, and plate on solid medium containing 100 μg / mL Amp + for resistance screening. After 37℃ inverted culture for 16h, pick single colonies on the plate and inoculate into Amp + LB liquid medium, extract plasmid after overnight culture, double enzyme cut with Nhe I and Eag I. After electrophoresis in 1.0% agarose gel at 110V voltage for 45min, use ethidium bromide staining and observe the electrophoresis result in the gel imaging instrument, the result is shown in Figure 5 The double enzyme cut products of recombinant plasmid pBR-peg-RA-TG12 are 3651bp linear pBR322 vector and 4850bp peg-RA-TG12 linear DNA fragment respectively; the double enzyme cut products of recombinant plasmid pBR-peg are 3651bp linear pBR322 vector and 4850bp peg linear DNA fragment (SEQ ID NO. 4) respectively, which are consistent with the expectation. The recombinant plasmids are named as pBR-peg-RA-TG12 and pBR-peg respectively. A pair of identification primers are designed for pegA to identify whether RA-TG12 is inserted into the surface exposed position of pegA, the upstream primer is pegA-F: 5'-ATGAAACGTTCACTTATTGCTGCT-3'; the downstream primer is pegA-R: 5'-TTAATCAGTTAATACCGTCATCGTCA-3'. After sequencing the pBR-peg-RA-TG12 plasmid and the identification primers in Beijing Genesee Biotech Co., Ltd., it is verified and found that RA-TG12 is inserted into the surface exposed position of pegA.
[0052] Example 4 Construction and functional verification of an in vitro agglutination assay for specific recognition and binding of RA infection antibodies mediated directly by the conserved B cell epitope peptide TG12
[0053] S9H (Chinese Patent ZL202010427735.8, a pan-inert carrier Salmonella and its potential application) stored in a -80℃ cryotube was streaked onto a solid LB plate, incubated at 37℃ for 24h, and then a single colony was picked and transferred to 4mL LB liquid medium. The culture was shaken at 37℃ and 220rpm for 12h. After the first generation, the culture was transferred to a 50mL centrifuge tube containing 40mL LB medium at a ratio of 1:100 for the volume of the culture medium and the volume of the LB liquid medium. The culture was shaken at 37℃ until the OD 600 =0.4-0.6, place the 50 mL centrifuge tube in an ice bath for 30 min, centrifuge at 4°C, 4000 rpm for 10 min, then resuspend with pre-chilled 10% glycerol, centrifuge at 4°C, 4000 rpm for 10 min, wash the bacteria three times with 10% glycerol, and finally resuspend with 40 μL of 10% glycerol per 4 mL of bacterial solution, aliquot 100 μL / cell to make S9H competent culture, and freeze at -80°C for later use.
[0054] 200 ng of pBR-peg-RA-TG12 plasmid and pBR-peg plasmid (see Example 3) were mixed with 100 μL S9H competent cells, electroporated at 2.2 kV using an electroporator, and then added with 1 mL of SOC medium. The cells were shaken and cultured at 37°C for 1 hour. 200 μL of the bacterial solution was spread on a plate containing 100 μg / mL Amp. + LB plates were plated and inverted at 37°C. Positive clones were picked and identified using pegA-F / R. The positive clone containing pBR-peg-RA-TG12 was named S9H-pBR-peg-RA-TG12, and the positive clone containing pBR-peg was named S9H-pBR-peg.
[0055] S9H-pBR-peg-RA-TG12 and S9H-pBR-peg were mixed in the presence of 100 μg / mL Amp + The cells were grown in LB liquid medium to the plateau phase, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The cells were resuspended with an equal volume of sterile saline and washed twice to prepare S9H-pBR-peg-RA-TG12 and S9H-pBR-peg bacterial suspensions (final concentration 1×10 10 CFU / mL).
[0056] Agglutination test was performed with S9H-pBR-peg-RA-TG12 bacterial suspension, S9H-pBR-peg bacterial suspension and negative chicken serum (90-day-old SPF chicken serum) and chicken Salmonella pullorum positive serum (90-day-old SPF chicken immunized twice with chicken Salmonella pullorum standard strain CVCC 526, blood was collected at 45 days after immunization to obtain). S9H (S9H-pBR322) bacterial suspension containing pBR322 empty vector was used as negative control. The results are shown in Table 1. The bacterial suspensions of S9H-pBR-peg-RA-TG12, S9H-pBR-peg and S9H-pBR322 did not react with negative serum. The bacterial suspensions of S9H-pBR-peg-RA-TG12 and S9H-pBR-peg both showed significant agglutination with chicken Salmonella pullorum positive serum, and white agglutination particles were deposited on both sides of the reaction solution. The bacterial suspension of S9H-pBR322 containing pBR322 empty vector did not agglutinate with positive serum, and there were no agglutination particles, and the background was turbid. The results showed that chicken Salmonella pullorum positive serum was specifically recognized by chicken Salmonella pullorum Peg pilus, and chicken Salmonella pullorum Peg pilus could be successfully and functionally displayed on the surface of inert carrier Salmonella S9H.
[0057] Table 1 Functional display verification of chicken Salmonella pullorum Peg pilus on the surface of inert carrier Salmonella S9H
[0058]
[0059]
[0060] Note: "negative" refers to negative agglutination reaction, no agglutination particles, and the background is turbid; "positive" refers to positive agglutination reaction, and white agglutination particles are deposited on both sides of the reaction solution.
[0061] The above S9H-pBR-peg-RA-TG12 bacterial suspension was agglutination tested with 10 portions of 7-day-old healthy duck serum (donated by Tianjin Hailaiyint Biological Technology Co., Ltd.), 10 portions of 1-day-old healthy goose serum (donated by the Poultry Institute of the Agricultural Science Research Institute of Ningbo, Zhejiang Province), and 15 portions of RA positive serum (5 portions of duck serum infected with RA types 1, 2, and 10 by oral administration, donated by Tianjin Hailaiyint Biological Technology Co., Ltd. and the Poultry Institute of the Agricultural Science Research Institute of Ningbo, Zhejiang Province), and the S9H-pBR-peg bacterial suspension containing pBR-peg was used as a negative control. The results are shown in Table 2. The S9H-pBR-peg-RA-TG12 bacterial suspension and the S9H-pBR-peg bacterial suspension did not agglutinate with the healthy duck and healthy goose serum. The S9H-pBR-peg-RA-TG12 bacterial suspension significantly agglutinated with the 15 portions of positive serum infected with RA, and white agglutination particles were deposited on both sides of the reaction solution. The S9H-pBR-peg control did not agglutinate with the positive serum, and no agglutination particles were present, and the background was turbid. The results show that the conserved B cell epitope peptide TG12 can be displayed and expressed on the surface of the inert carrier Salmonella by Peg pilus, and can detect antibodies against RA. In this detection method, S9H-pBR-peg is used as a detection control, and compared with the detection antigen S9H-pBR-peg-RA-TG12, the detection control only lacks the conserved B cell epitope peptide TG12, and the absence of agglutination reaction ensures the specificity of the detection results.
[0062] Table 2 Functional verification of RaGAPDH conserved B cell epitope peptide TG12 displayed and expressed on the surface of S9H
[0063]
[0064] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction
[0065] Example 5 Specificity and sensitivity test of the in vitro agglutination test method for specific recognition and binding of antibodies against duck Riemerella anatipestifer infection directly mediated by conserved B cell epitope peptide TG12
[0066] According to the method in Example 4, the detection control S9H-pBR-peg bacterial suspension and the detection antigen S9H-pBR-peg-RA-TG12 bacterial suspension (bacterial solution concentration was 1 x 10 10To verify the specificity of the plate agglutination detection method, the two bacterial suspensions above were respectively subjected to agglutination test with positive serum / antibody of different background information to verify the specificity of the plate agglutination detection method. The serum / antibody used includes: 15 serum 1, 2, 10 type RA orally infected duck serum (donated by Tianjin Huleiante Biological Technology Co., Ltd., Zhejiang Province Ningbo Agricultural Science Research Institute of Poultry), 4 serum 1 type RA orally infected goose serum (donated by Tianjin Huleiante Biological Technology Co., Ltd.), 3 clinical RA positive goose serum (after bacterial separation and identification, donated by Zhejiang Province Ningbo Agricultural Science Research Institute of Poultry), 2 RA positive serum (donated by Hebei Normal University of Science and Technology), 10 SPF chicken serum (prepared and preserved in the laboratory), 10 CIAV artificially infected positive serum (artificially infected and collected and prepared in the laboratory), 7 duck serum infected with E. coli APEC (obtained by infecting ducks with E. coli APEC TW-XM strain in the laboratory), 6 E. coli positive mouse serum (obtained by infecting SPF mice with E. coli APEC TW-XM strain in the laboratory), 5 mouse typhoid salmonella positive serum (preserved in the laboratory), and 1 E. coli F4 monoclonal antibody (prepared and preserved in the laboratory). The experimental results are shown in Table 3, and part of the agglutination test results are shown in Figure 6 S9H-pBR-peg detection control does not agglutinate with all serum / antibody; S9H-pBR-peg-RA-TG12 only reacts with RA positive serum, and does not react with negative serum and other serum / antibody.
[0067] Table 3 Specificity verification of in vitro agglutination test detection method of duck Riemerella anatipestifer infection antibody specific recognition and binding directly mediated by conserved B cell epitope peptide TG12
[0068]
[0069] Note: "-" represents negative agglutination reaction; "+" represents positive agglutination reaction
[0070] The sensitivity test of the present application is to determine the earliest detection time of duck Riemerella anatipestifer antibody by detecting duck serum of different days after oral infection of duck Riemerella anatipestifer RA strain (donated by Tianjin Huleiante Biological Technology Co., Ltd.). Before artificial infection, the duck whole blood was collected, and the serum separation and preparation were carried out; then the ducklings were orally infected with RA attenuated strain, and the duck serum was collected and prepared at 7 and 14 days, and the RA infection antibody in the serum was detected by the in vitro agglutination test directly mediated by the conserved B cell epitope antigen TG12 of the present application. The antibody detection results of the duck serum after infection are shown in Table 4, and the in vitro agglutination test detection method directly mediated by the conserved B cell epitope peptide TG12 of the present application can detect the RA agglutination antibody in the infected duck serum at 7 days, which has high sensitivity.
[0071] Table 4 In vitro coagulation of RA infection antibodies specifically recognized and bound by the conserved B cell epitope antigen TG12
[0072]
[0073] Sensitivity validation of the cluster test method
[0074] In summary, the present invention provides a conserved B cell epitope peptide TVDGPSMKDWRG (TG12) on the surface of the RA adhesion colonization and infection pathogen RaGAPDH protein and an in vitro agglutination test detection method for specific recognition and binding of RA infection antibodies directly mediated by the conserved B cell epitope peptide TG12, which has potential application prospects in the differential diagnosis and prevention and control of RA clinical infection. The in vitro agglutination test for specific recognition and binding of RA infection antibodies directly mediated by the conserved B cell epitope peptide TG12 of the present invention is used to detect the level of RA post-infection antibodies in the sample (serum), which has good specificity, sensitivity and repeatability, and has the advantages of convenience and speed. Its low detection cost and convenience can be used for large-scale rapid detection in farms.
[0075] SEQ ID NO.1: peg-RA-TG12 gene fragment
[0076]
[0077] SEQ ID NO. 2: Recombinant pegA-TG12 gene sequence
[0078] ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTATTTATGAGCGCTGGGGTTTTTGCTGCTGATGAAGATATGGGGGAATTAAAAATAAACGGAGAAGTGGTGGGAACATCCTGTACTTTCGAAGGTGCAAATAGCGCGACTATTGAATTATCCCAGGTAGGTGTTGATAGATTGACTACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGTAGCCCAGAAGCGATTTTAAAAGTAAGATGTACGAATACAGCTAATCCACGAATTAGTTTTAACCGTTCTCAATTTGTGGATAACATGCAAATCACCAAAAATAATGCTACTAATAATGGTGCGGGCTTCGCTGTTTATCTTGATGGTATTCAGGTGAAACCGGATGAGGCGGGGAATTACACTCTGAATTCAAGTAAGTTTGAAAATGGTGTATATACCCTGAACTTTTCTGCCCGCTATGCCGCCGTTGAAAATACTGTAACACCAGGTTCTGTTGAATCTGTACTGACGATGACGGTATTAACTGATTAA
[0079] SEQ ID NO. 3: Recombinant PegA-TG12 protein amino acid sequence
[0080] MKRSLIAASVLSAVFMSAGVFAADEDMGELKINGEVVGTSCTFEGANSATIELSQVGVDRLTTVDGPSMKDWRGSPEAILKVRCTNTANPRISFNRSQFVDNMQITKNNATNNGAGFAVYLDGIQVKPDEAGNYTLNSSKFENGVYTLNFSARYAAVENTVTPGSVESVLTMTVLTD
[0081] SEQ ID NO. 4: Full-length peg operon
[0082]
Claims
1. A conserved B cell epitope peptide TG12 of the surface adhesion factor 3-glyceraldehyde phosphate dehydrogenase of Riemerella anatipestifer, characterized in that: The amino acid sequence of the conserved B cell epitope peptide TG12 is TVDGPSMKDWRG.
2. The nucleic acid molecule encoding the conserved B cell epitope peptide TG12 according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid molecule is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.
3. A recombinant gene peg-RA-TG12 or recombinant genes pegA-TG12 , characterized in that, Its nucleotide sequence is shown as SEQ ID NO.1 or SEQ ID NO.
2.
4. A recombinant Peg protein expressing a conserved B cell epitope peptide TG12 in Peg pili, characterized in that: The amino acid sequence of the recombinant Peg protein is shown in SEQ ID NO.
3.
5. An expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the nucleic acid molecule of claim 2 or the TG12 epitope sequence of claim 3 inserted peg Recombinant genes peg-RA-TG12 or recombinant genes pegA-TG12 .
6. The method for constructing the recombinant vector according to claim 5, characterized in that: The following steps are involved: (1) Obtaining the nucleotide sequence of the nucleic acid molecule of the conserved B cell epitope peptide TG12 of the surface adhesion factor 3-glyceraldehyde phosphate dehydrogenase of Riemerella anatipestifer; the nucleotide sequence of the nucleic acid molecule is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT; (2) Inserting the nucleic acid molecule sequence obtained in step (1) into a vector containing the Peg pili encoding gene sequence to construct a recombinant vector.
7. The method for constructing the recombinant strain according to claim 5, characterized in that: The recombinant vector according to claim 5 is introduced into a carrier bacterium to obtain the product.
8. The method for constructing the recombinant strain according to claim 7, characterized in that: The introduction method is an electrotransformation method, and the carrier bacteria are inert carrier bacteria.
9. The conserved B cell epitope peptide TG12 according to claim 1, the nucleic acid molecule according to claim 2, and the recombinant gene according to claim 3 peg-RA-TG12 or recombinant genes pegA-TG12 , the use of the recombinant Peg protein according to claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5 in the preparation of a reagent or kit for detecting infectious antibodies to Riemerella anatipestifer.
10. A detection system or kit for detecting antibodies to the pathogen Riemerella anatipestifer, characterized in that: The detection system or detection kit for Riemerella anatipestifer infection antibodies comprises the conserved B cell epitope peptide TG12 according to claim 1, the nucleic acid molecule according to claim 2, the recombinant gene according to claim 3 peg-RA-TG12 or recombinant genes pegA-TG12 , the recombinant Peg protein according to claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5.
Citation Information
Patent Citations
A generalized inert vector Salmonella and its potential applications
CN111500504B
Riemerella anatipestifer surface antigen D15 truncated recombinant protein and preparation method and application thereof
CN103923193A
OMPA GENE FOR AN OUTER MEMBRANE PROTEIN OF RIEMERELLA ANATIPESTIFER AND METHODS OF USE
WO2001004317A1