4-propylguaiacol oxidase mutants, methods for making and using same
By directionally modifying 4-propylguaiacol oxidase to mutate it into D170E, S426T, S50Q/D170E, D170E/L411V, or D170E/L411V/S106C, the problems of insufficient activity and selectivity of existing enzymes have been solved, and efficient synthesis of trans-isoeugenol has been achieved, which has good prospects for industrial application.
Patent Information
- Application Number
- CN202411935971.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-26
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-12-26
AI Technical Summary
Existing 4-propylguaiacol oxidases suffer from problems such as low activity, low cis-trans selectivity, and low trans-isoeugenol yield, which cannot meet the needs of industrial applications.
By directionally modifying the 4-propylguaiacol oxidase of Penicillium simplicissimum to mutate it into D170E, S426T, S50Q/D170E, D170E/L411V or D170E/L411V/S106C, its activity and cis-trans selectivity were improved.
The synthesis of trans-isoeugenol with high activity, high cis-trans selectivity and high yield has been achieved, supporting the industrial synthesis of trans-isoeugenol and its application in the pharmaceutical field.
Smart Images
Figure CN119709670B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to an oxidase, in particular to a 4-propyl guaiacol oxidase, and belongs to the technical field of enzyme engineering and genetic engineering. BACKGROUND
[0002] E-isoeugenol is a natural phenolic compound with significant antioxidant, antibacterial, antifungal and anti-inflammatory biological activities, and has wide applications in food, medicine, agriculture and other fields. For example, E-isoeugenol can be used as a natural antioxidant and preservative; its unique fragrance also makes it useful for perfumes, essences or seasonings; E-isoeugenol is also a synthetic material for a variety of compounds, and has the potential to be used as an environmentally friendly pesticide ingredient in agriculture. Due to its low toxicity and natural properties, E-isoeugenol has become a popular research object for green substitutes, and has a broad application prospect in the future.
[0003] The production methods of E-isoeugenol mainly include natural extraction, biological transformation and chemical synthesis. Natural extraction is usually obtained from the essential oil of clove, cinnamon and other plants, but the extraction efficiency is low; biological transformation is a method of converting precursor substances (such as eugenol) into isoeugenol through microbial or enzymatic catalysis, which has high selectivity and environmental friendliness; chemical synthesis is usually through isomerization or specific catalytic reaction to convert eugenol or other related precursors into E-isoeugenol under specific conditions, but chemical synthesis requires noble metal catalysis, and the cis-trans selectivity of the product is poor. Therefore, the biological transformation method is a more economical and controllable means for large-scale production of E-isoeugenol. In the biological transformation method, 4-propyl guaiacol oxidase (also known as vanillyl alcohol oxidase) from Penicillium simplicissimum can catalyze the oxidation reaction to generate E-isoeugenol with 4-propyl guaiacol as the substrate. However, the natural 4-propyl guaiacol oxidase has low activity, low cis-trans selectivity, and low yield of E-isoeugenol, which cannot meet the needs of industrial application. SUMMARY
[0004] The purpose of the present application is to provide a 4-propyl guaiacol oxidase mutant with high activity, high cis-trans selectivity and high yield of E-isoeugenol, and to provide a preparation method of the enzyme mutant, related nucleotide sequences, recombinant vectors and recombinant cells.
[0005] Technical solution: The 4-propyl guaiacol oxidase mutant of the present application is obtained by amino acid mutation of the sequence shown in SEQ ID NO. 1, and the mutation is D170E, S426T, S50Q / D170E, D170E / L411V or D170E / L411V / S106C.
[0006] The amino acid sequences of the 4-propyl guaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V and D170E / L411V / S106C are respectively SEQ ID NO. 2-6.
[0007] The 4-propyl guaiacol oxidase (PDB:2VAO) of Penicillium simplicissimum is used as the original enzyme (wild type) in the present application, the amino acid sequence of which is SEQ ID NO. 1, and the gene sequence encoding the enzyme is SEQ ID NO. 7. The sequence and structure information of the 4-propyl guaiacol oxidase reported in the prior art are used, non-redundant search is performed in the PDB database, potential enzyme genes are screened according to the principles of protein structure similarity, conserved site analysis and host source diversity, the function of the enzyme genes is expressed in an E. coli expression system, and then the original enzyme is purified. Finally, the 4-propyl guaiacol oxidase VAO is selected as the original enzyme, the amino acids in the active site of the original enzyme are mutated by using semi-rational design, and the 4-propyl guaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V and D170E / L411V / S106C with high activity, cis-trans selectivity and trans-isoeugenol yield are screened.
[0008] The standard one-letter code of amino acids and the standard substitution notation are used in the present application, for example: D170E means that the aspartic acid (D) at the 170th position of the N terminal is mutated to glutamic acid (E); S50Q / D170E means that the serine (S) at the 50th position of the N terminal is mutated to glutamine (Q), and the aspartic acid (D) at the 170th position of the N terminal is mutated to glutamic acid (E).
[0009] The present application also provides a nucleotide sequence encoding the 4-propyl guaiacol oxidase mutants. The nucleotide sequence can be obtained by base mutation from the sequence shown in SEQ ID NO. 7, such as SEQ ID NO. 8-12.
[0010] The present application also provides a recombinant vector comprising the nucleotide sequence. The recombinant vector includes a cloning vector or an expression vector, and can be a plasmid or a virus, and can maintain the ability to replicate, amplify or express the nucleotide sequence in a host cell.
[0011] The present application also provides a recombinant cell comprising the recombinant vector.
[0012] The present application also provides a preparation method of the 4-propyl guaiacol oxidase mutants, comprising the following steps:
[0013] (1) designing point mutation primer, taking the plasmid with wild type 4-propyl guaiacol oxidase gene as template, adopting point mutation primer to carry out PCR reaction, obtaining mutation gene segment and linearized plasmid after purification;
[0014] (2) connecting mutation gene segment and linearized plasmid to construct expression vector, transferring the expression vector into host bacteria and then inducing expression of 4-propyl guaiacol oxidase mutant.
[0015] Preferably, in step (1), the point mutation primer is as follows:
[0016]
[0017]
[0018] Preferably, in step (1), the PCR reaction system is as follows:
[0019] Components Volume 10x Buffer for KOD-Plus- 2.5 μL 2 mM dNTP 2.5 μL 25 mM MgSO4 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75 μL 10 pmol / μL Reverse Primer 0.75 μL DNA template <100 ng KOD-Plus- 1 μL ddH2O up to 25 μL .
[0020] Preferably, in step (1), the PCR reaction condition is as follows:
[0021]
[0022] Preferably, in step (2), after expression, the cell is collected; or the cell is broken and the crude enzyme solution is collected; or the cell is broken and the separated and purified 4-propyl guaiacol oxidase mutant is collected.
[0023] The application further provides a product comprising the 4-propyl guaiacol oxidase mutant, the nucleotide sequence, the recombinant vector or the recombinant cell.
[0024] The application further provides application of the product in biological catalysis synthesis of trans-isoeugenol.
[0025] Preferably, the biological catalysis takes 4-propyl guaiacol as substrate, pH is 6-9 and temperature is 20-45℃.
[0026] The process of catalysis of the 4-propyl guaiacol oxidase in oxidation reaction to generate trans-isoeugenol is as follows:
[0027]
[0028] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages: the present application provides 4-propyl guaiacol oxidase mutants D170E, S426T, S50Q / D170E, D170E / L411V and D170E / L411V / S106C with higher activity, cis-trans selectivity and trans-isoeugenol yield, realizes efficient synthesis of high-value trans-isoeugenol from cheap 4-propyl guaiacol, is conducive to the industrialized synthesis and application of trans-isoeugenol, and has good application prospect in the field of medicine such as drug synthesis. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 Schematic diagram of yield and cis-trans selectivity of original enzyme WT and mutant catalytic synthesis of trans-isoeugenol;
[0030] Figure 2 Schematic diagram of yield and cis-trans selectivity of original enzyme WT catalytic synthesis of trans-isoeugenol at different temperatures;
[0031] Figure 3 Schematic diagram of yield and cis-trans selectivity of mutant D170E / L411V / S106C catalytic synthesis of trans-isoeugenol at different temperatures;
[0032] Figure 4 Schematic diagram of yield and cis-trans selectivity of original enzyme WT catalytic synthesis of trans-isoeugenol at different pH values;
[0033] Figure 5 Schematic diagram of yield and cis-trans selectivity of mutant D170E / L411V / S106C catalytic synthesis of trans-isoeugenol at different pH values;
[0034] Figure 6 Enzymatic reaction kinetic curve of original enzyme WT;
[0035] Figure 7 Enzymatic reaction kinetic curve of mutant D170E / L411V / S106C;
[0036] Figure 8 Gas chromatogram of 4-propyl guaiacol, cis-isoeugenol and trans-isoeugenol;
[0037] Figure 9 Nuclear magnetic resonance hydrogen spectrum of trans-isoeugenol. DETAILED DESCRIPTION
[0038] The technical solutions of the present application will be further described below in combination with the drawings.
[0039] Example 1: A 4-propyl guaiacol oxidase mutant D170E
[0040] This example takes 4-propyl guaiacol oxidase (PBD: 2VAO) of Penicillium simplicissimum as the original enzyme, and the aspartic acid at the N-terminal 170th amino acid of the amino acid sequence is mutated to glutamic acid.
[0041] The preparation method is as follows: (1) designing point mutation primers, performing PCR reaction to obtain mutant gene fragments; (2) constructing expression vectors and transferring into host bacteria for induction expression. The specific process is as follows:
[0042] (1) designing point mutation primers, performing PCR reaction to obtain mutant gene fragments
[0043] The wild-type 4-propyl guaiacol oxidase VAO gene sequence is designed and synthesized, and an expression vector is constructed. The VAO gene fragment is synthesized by Suzhou Jinyuzhi Biological Technology Co., Ltd. and constructed on the pET22b vector, named pET22b-VAO gene (as shown in SEQ ID NO. 7), and the corresponding amino acid sequence is shown in SEQ ID NO. 1.
[0044] The vector is transformed into E. coli Top10 strain, and ampicillin-resistant LB plates are screened to obtain clones. One clone is selected and inoculated in an ampicillin-resistant LB medium test tube with a liquid volume of 20 mL and cultured at 37°C, 220 rpm for 12 h. After the culture is completed, the cells are collected by centrifugation at 12,000 rpm for 1 min, and the plasmid is extracted from E. coli Top10 / pET22b-VAO using a high-purity plasmid extraction kit as a template for iterative mutation. The plasmid pET22b-VAO mutant is constructed, sequenced by Suzhou Jinyuzhi Biological Technology Co., Ltd., and the correct insertion vector without mutation is selected to obtain the 4-propyl guaiacol oxidase gene expression vector pET22b-VAO.
[0045] The wild-type 4-propyl guaiacol oxidase is expressed and prepared. The expression vector is transformed into E. coli BL21 (DE3) to obtain E. coli gene engineering bacteria pET22b-VAO / BL21 (DE3) capable of expressing 4-propyl guaiacol oxidase. The engineering bacteria are inoculated into the culture medium at an inoculation amount of 0.1%, and the liquid volume of the shake flask is 100 mL / 250 ml (containing 100 mg / L ampicillin). When the OD600 of the bacterial solution reaches 0.6-0.8, 1 mM IPTG is added for induction, and the temperature is reduced to 18°C for continuous culture for about 20 h. The bacterial cells are collected by centrifugation at 4000 rpm for 10 min, resuspended with 100 mM pH 9 Tris-HCl buffer, and the bacterial cells containing 4-propyl guaiacol oxidase are obtained for subsequent catalytic research and enzyme activity determination.
[0046] The recombinant E. coli BL21(DE3) / pET22b-VAO mutant D170E was constructed. The gene mutation was performed by the method of whole plasmid PCR, and the target mutant gene was obtained. The D170E primer is shown in Table 1, and the single point iterative mutation was performed. The D170E amino acid sequence is shown in SEQ ID NO. 2, and the nucleotide sequence is shown in SEQ ID NO. 8.
[0047] Table 1 Mutant D170E primer sequence
[0048] Mutant primer name Sequence (5'-3') D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC
[0049] The PCR reaction system is shown in Table 2:
[0050] Table 2 PCR reaction system
[0051]
[0052]
[0053] The PCR reaction conditions are shown in Table 3.
[0054] Table 3 PCR reaction conditions
[0055]
[0056] After the PCR amplification, the amplification product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplification product was a single band with a size of about 7000 bp. The amplification product was purified and recovered by using a DNA recovery and purification kit.
[0057] The purified gene fragment was digested with DpnI to remove the template, and then recombined with a recombinase. The recombination product was transformed into E. coli DH5α competent cells, and was coated on the surface of LB solid medium containing 100 μg / mL ampicillin, and was incubated at 37°C for 12 h. Single colonies were picked to LB liquid culture, and the positive transformants constructed successfully were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, a part was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80°C for preservation, and a part of the bacteria was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a refrigerator at -20°C.
[0058] (2) Construction of expression vector and induction of expression after being introduced into host bacteria
[0059] The recombinant expression plasmid pET22b successfully sequenced was introduced into E. coli BL21(DE3) as an expression host, and the recombinant mutant expression strain E. coli BL21(DE3) / pET22b-VAO was constructed.
[0060] The recombinant mutant expression strain E. coli BL21(DE3) / pET22b-VAO which was successfully constructed was spread on a plate containing ampicillin with a final concentration of 100 μg / mL, and a single colony was inoculated in 20 mL of LB medium containing resistance and cultured at 37°C, 200 rpm / min overnight. A 1% inoculation amount was transferred to 500 mL of LB medium containing resistance, and the OD 600 When the OD reached about 0.6, IPTG with a final concentration of 0.5 mM was added, and induction was performed at 18°C for about 14 h.
[0061] After centrifugation to obtain the bacterial cells, the bacterial cells were resuspended with a buffer, and the cells were broken by ultrasonic treatment in an ice bath (working for 3 s, interval for 6 s, and working time for 15 min) and centrifuged at 12,000 rpm / min for 20 min at 4°C. After the supernatant was collected, it was filtered through a 0.22 μm water filter head as a sample, and then subjected to nickel column enzyme purification to obtain a pure enzyme solution. According to the molar absorption coefficient ε of the amino acid sequence of VAO, the absorbance of the protein was measured by the A280 method, and the concentration of the protein was calculated.
[0062] Example 2: A 4-propyl guaiacol oxidase mutant S426T
[0063] In this example, the original enzyme of Example 1 was used, and the serine at the N-terminal 426th position of the amino acid sequence was mutated to threonine. The amino acid sequence of the mutant is shown in SEQ ID NO. 3, and the nucleotide sequence is shown in SEQ ID NO. 9. The preparation method is basically the same as that of Example 1, except that the mutation primer is different, as shown in Table 4:
[0064] Table 4 Primer sequence of mutant S426T
[0065] Mutant primer name Sequence (5'-3') S426T_F GGCGCACATCTGTTCTTTACTCCGATTGCCAAAG S426T_R CTTCACCGCTAACTTTGGCAATCGGAGTAAAGAACAG
[0066] Example 3: A 4-propyl guaiacol oxidase mutant S50Q / D170E
[0067] In this example, the original enzyme of Example 1 was used, and the serine at the N-terminal 50th position of the amino acid sequence was mutated to glutamine, and the aspartic acid at the 170th position was mutated to glutamic acid. The amino acid sequence of the mutant is shown in SEQ ID NO. 4, and the nucleotide sequence is shown in SEQ ID NO. 10. The preparation method is basically the same as that of Example 1, except that the mutation primer is different, as shown in Table 5:
[0068] Table 5 Primer sequence of mutant S50Q / D170E
[0069] Mutant primer name Sequence (5'-3') S50Q_F GCAAAGATCAGATTGTGGATGGCCAATATATGAAACC S50Q_R CATGGGTATGGGTCGGTTTCATATATTGGCCATCCAC D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC
[0070] Example 4: A 4-propylguaiacol oxidase mutant D170E / L411V
[0071] This example uses the same original enzyme as Example 1, which is mutated at the 170th aspartic acid to glutamic acid and the 411th leucine to valine in the N-terminal amino acid sequence. The amino acid sequence of the mutant is shown in SEQ ID NO. 5, and the nucleotide sequence is shown in SEQ ID NO. 11. The preparation method is basically the same as that of Example 1, except for the mutation primer, which is shown in Table 6:
[0072] Table 6 Primer sequence of mutant D170E / L411V
[0073] Mutant primer name Sequence (5'-3') D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC L411V_F TCCGACCTATGATGAAGTGAAATGGATTGATTGGCTGCC L411V_R CGGCAGCCAATCAATCCATTTCACTTCATCATAG
[0074] Example 5: A 4-propylguaiacol oxidase mutant D170E / L411V / S106C
[0075] This example uses the same original enzyme as Example 1, which is mutated at the 170th aspartic acid to glutamic acid, the 411th leucine to valine, and the 106th serine to cysteine in the N-terminal amino acid sequence. The amino acid sequence of the mutant is shown in SEQ ID NO. 6, and the nucleotide sequence is shown in SEQ ID NO. 12. The preparation method is basically the same as that of Example 1, except for the mutation primer, which is shown in Table 7:
[0076] Table 7 Primer sequence of mutant D170E / L411V / S106C
[0077] Mutant primer name Sequence (5'-3') D170E_F CGATAAACTGTGGCTGGATGTGCCGGAACTGGGCGGTGG D170E_R CATTACCCAGAACACTACCACCGCCCAGTTCCGGCAC S106C_F GGCGCACATCTGTTCTTTACTCCGATTGCCAAAG S106C_R CTTCACCGCTAACTTTGGCAATCGGAGTAAAGAACAG L411V_F TCCGACCTATGATGAAGTGAAATGGATTGATTGGCTGCC L411V_R CGGCAGCCAATCAATCCATTTCACTTCATCATAG CGGCAGCCAATCAATCCATTTCACTTCATCATAG
[0078] Performance test
[0079] 1. Yield and cis-trans selectivity of 4-propylguaiacol oxidase and its mutants in catalyzing the synthesis of trans-isoeugenol The whole cells of the wild-type enzyme and mutants obtained in Examples 1-5 were used as catalysts.
[0080] The reaction system was: OD = 20 of whole cell bacteria solution, 50 mM of 4-propylguaiacol, and 100 mM of Tris-HCl buffer with pH = 8.5. The reaction temperature was controlled at 30°C by water bath, and the reaction was stirred by magnetic stirring. The product trans-isoeugenol concentration was detected by gas chromatograph after 20 h of reaction. The results are shown in Figure 1 .
[0081] The gas chromatogram of 4-propylguaiacol, cis-isoeugenol, and trans-isoeugenol is shown in Figure 8 . The nuclear magnetic resonance hydrogen spectrum of trans-isoeugenol is shown in Figure 9 . The nuclear magnetic resonance hydrogen spectrum of trans-isoeugenol is shown in Figure 1 (Bar chart for yield, line chart for selectivity) can be obtained, in WT, mutant D170E, S426T, S50Q / D170E, L411V / D170E, L411V / D170E / S106C, the mutant has higher yield and anti-selectivity than WT, and L411V / D170E / S106C has the most significant improvement compared with WT, with an increase of about 40% in yield and 65% in anti-selectivity.
[0082] 2, Optimum temperature of 4-propylguaiacol oxidase and its mutants for synthesizing trans-isoeugenol
[0083] The whole cells of wild type and mutant D170E / L411V / S106C were used as catalysts.
[0084] The reaction system was OD=40 of whole cell bacteria solution, 100 mM of 4-propylguaiacol, 10% of DMSO, and 100 mM of Tris-HCl with pH=8.5 as reaction buffer. The reaction temperature was controlled at 20°C, 25°C, 30°C, 37°C and 45°C by water bath, and the reaction was stirred by magnetic stirring for 16 h. The concentration of product trans-isoeugenol and the anti-selectivity were detected by gas chromatography. The results are shown in Figure 2 and Figure 3 .
[0085] From Figure 2 and Figure 3 (Bar chart for yield, line chart for selectivity) can be obtained, in WT, mutant D170E, S426T, S50Q / D170E, L411V / D170E, L411V / D170E / S106C, the mutant has higher yield and anti-selectivity than WT, and L411V / D170E / S106C has the most significant improvement compared with WT, with an increase of about 40% in yield and 65% in anti-selectivity.
[0086] 3, Optimum pH of 4-propylguaiacol oxidase and its mutants for synthesizing trans-isoeugenol
[0087] The whole cells of wild type and mutant D170E / L411V / S106C were used as catalysts.
[0088] Reaction system: OD = 40 of whole cell bacteria solution, 100 mM of 4-propyl guaiacol, 10% of DMSO. Reaction buffer: different pH buffers, respectively: 50 mM disodium hydrogen phosphate-citric acid buffer with PH = 6, 50 mM sodium phosphate buffer with PH = 7, 50 mM dipotassium hydrogen phosphate-potassium hydrogen phosphate buffer with PH = 8, 100 mM Tris-HCl buffer with PH = 8.5, 100 mM Tris-HCl buffer with PH = 9, 50 mM boric acid buffer with PH = 10, reaction temperature is controlled by water bath at 30℃, magnetic stirring, reaction for 16 h, and the concentration of product trans-isoeugenol and cis-trans selectivity are detected by gas chromatography. The results are shown in Table 7. Figure 4 and Figure 5 .
[0089] From Figure 4 and Figure 5 (Bar chart is yield, line chart is selectivity) can be obtained, after the reaction of 4-propyl guaiacol oxidase and mutant D170E / L411V / S106C at different pH, the highest enzyme activity measured is 100% relative enzyme activity. The experiment proves that the cleavage activity of VAO is limited under acidic and neutral conditions, but the activity reaches the maximum value when the pH rises to 8.5, the wild type 4-propyl guaiacol oxidase and the mutant have the highest yield at pH = 8.5, and the cis-trans selectivity does not change much with pH, and the enzyme activity of the two enzymes is almost completely lost at pH = 10, and the enzyme activity of the mutant is more stable than that of the wild type between pH = 7-8.5.
[0090] 4, Effect of different substrate concentrations and enzyme concentrations on 4-propyl guaiacol oxidase and its mutant catalyzed synthesis of trans-isoeugenol
[0091] The whole cells of wild type and mutant D170E / L411V / S106C are used as catalysts.
[0092] Reaction system: OD = 10, 20, 40, 80 of whole cell bacteria solution, 10 mM, 20 mM, 50 mM of 4-propyl guaiacol, 10% of DMSO, reaction buffer is 100 mM Tris-HCl with PH = 8.5. The reaction temperature is controlled by water bath at 30℃, magnetic stirring, reaction for 16 h, and the concentration of product trans-isoeugenol and cis-trans selectivity are detected by gas chromatography. The results are shown in Table 8.
[0093] From Table 8, it can be obtained that with the increase of bacteria concentration, the yield of trans-isoeugenol gradually increases, and the yield of the mutant is always higher than that of the wild type, and the cis-trans selectivity slightly increases with the increase of bacteria concentration, but the change is not large. The optimal reaction condition is OD = 40, and the substrate concentration is 10 mM.
[0094] Table 8 Effect of substrate concentration and enzyme concentration on enzyme catalytic effect
[0095]
[0096]
[0097] 5. Kinetic parameters of 4-propylguaiacol oxidase and its mutants
[0098] The initial velocity of the enzymatic reaction of wild-type 4-propylguaiacol oxidase and mutant D170E / L411V / S106C was determined with 4-propylguaiacol as substrate at pH 8.5 and 30°C, and the kinetic parameters (K M , K CAT , K CAT / K M ) were calculated by Michaelis-Menten plot. The results are shown in Figure 6 and Figure 7 . The kinetic parameters of wild-type VAO with 4-propylguaiacol were K M 1.37 mM, K CAT 17.88 min -1 , K CAT / K M 13.05, and the kinetic parameters of mutant D170E / L411V / S106C with 4-propylguaiacol were K M 1.15 mM, K CAT 4.50 min -1 , K CAT / K M 3.91.
[0099] The analysis results show that the K M of the mutant is 0.8 times that of the wild type when 4-propylguaiacol is used as substrate, indicating that the mutant has better affinity to the substrate. From the change of K CAT value, the K CAT value of the mutant is 0.3 times that of the wild type, and the decrease of K CAT indicates that the number of molecules of the substrate converted by the mutant per unit time is reduced, which may be due to the mutation of the related site affecting the binding of the enzyme and the substrate.
Claims
1. A 4-propylguaiacol oxidase mutant, characterized in that, obtained by amino acid mutation of the sequence shown in SEQ ID NO. 1, and the mutation is D170E / L411V / S106C.
2. A polynucleotide, comprising, The 4-propyl guaiacol oxidase mutant of claim 1.
3. A recombinant vector, characterized in that, The polynucleotide of claim 2.
4. A recombinant cell, characterized in that, The recombinant vector of claim 3.
5. A method of producing the 4-propylguaiacol oxidase mutant of claim 1, characterized by, The method comprises the following steps: (1) designing point mutation primers, using a plasmid with a wild-type 4-propyl guaiacol oxidase gene as a template, and performing PCR reactions using the point mutation primers, to obtain a mutant gene fragment and a linearized plasmid after purification; (2) connecting the mutant gene fragment and the linearized plasmid to construct an expression vector, and transferring the expression vector into a host cell to induce expression of the 4-propyl guaiacol oxidase mutant.
6. The production method according to claim 5, wherein In step (1), the point mutation primers are as follows: 。 7. The preparation method according to claim 5, characterized in that, In step (1), the PCR reaction system is as follows: 。 8. Use of the 4-propyl guaiacol oxidase mutant of claim 1, or the polynucleotide of claim 2, or the recombinant vector of claim 3, or the recombinant cell of claim 4 in biological catalysis to synthesize trans-isoeugenol.
9. The use according to claim 8, wherein the biological catalysis uses 4-propyl guaiacol as a substrate, at a pH of 6-9 and a temperature of 20-45°C.