Dammarendiol synthase mutant and application of dammarendiol synthase mutant in preparation of beta-amyrin alcohol

Abstract

The invention relates to a dammarendiol synthase mutant and application of the dammarendiol synthase mutant in preparation of beta-amyrin alcohol, and belongs to the technical field of genes. The dammarendiol synthase mutant is subjected to the following amino acid mutation based on a sequence as shown in SEQ ID NO.1: T128L, and other amino acid sequences are kept unchanged; or the dammarendiol synthase mutant is subjected to the following amino acid mutation on the basis of the sequence as shown in SEQ ID NO: 1: T128L, L242M, F253L, F255M, V327L, A377V, V485Q and A493G, and other amino acid sequences are kept unchanged. According to the invention, reverse mutation modification is carried out through the difference sites, so that DDS has a catalytic function of beta-AS, and further deep analysis is carried out on the catalytic difference formed by DDS and beta-AS in the evolution process.

Description

Technical Field

[0001] The invention belongs to the field of gene technology, and particularly relates to a dammarene diol synthase mutant and application thereof in preparing beta-amyrin alcohol. Background Art

[0002] Pentacyclic triterpenes are important natural plant secondary metabolites, composed of 6 isoprene units connected, and are triterpenoid compounds with a closed pentacyclic ring as the parent. According to their different aglycones, pentacyclic triterpenes can be divided into many types. Pentacyclic triterpenes are not only involved in plant communication, defense and sensory regulation, but also have a wide range of pharmacological effects and important biological activities. Studies have shown that pentacyclic triterpenes play an important role in protecting cardiovascular and cerebrovascular, improving immunity, lowering blood sugar, anti-inflammatory, anti-oxidation, anti-fatigue, anti-new coronavirus, anti-AIDS and anti-cancer. However, pentacyclic triterpenoid compounds are scarce in natural resources, low in content in plants, long in growth cycle, and complex in structure. It is difficult to extract them in large quantities from natural plants, which seriously limits the development and application of pentacyclic triterpenes. To this end, it is urgent to open up new ways to mass-produce pentacyclic triterpenes.

[0003] Pentacyclic triterpenes in plants are mainly synthesized through the mevalonic acid (MVA) pathway in the cytoplasm and the methylerythritol phosphate (MEP) pathway in the plastids. The MVA pathway is currently recognized as the main pathway for the synthesis of triterpenoid sapogenins. Squalene is converted into 2,3-oxidosqualene by the action of squalene epoxidase (SE), which is the precursor of pentacyclic triterpenoids, and this process is a key step in the production of triterpenoid product diversity. OSC can catalyze the cyclization of 2,3-oxidosqualene to generate more than 100 triterpenoids with different carbon skeletons. Higher plants have evolved multiple 2,3-oxidosqualene cyclases (OSCs) for the biosynthesis of different types of triterpenoid saponins. 2,3-oxidosqualene cyclase can catalyze the cyclization of 2,3-oxidosqualene through protonation, cyclization, rearrangement and deprotonation to generate the precursor of triterpenoid saponins.

[0004] OSCs are a group of cyclases encoded by a specific gene family that catalyze the cyclization of 2,3-oxidosqualene to form a variety of sterol and triterpene skeletons. In the biosynthesis of phytosterols such as lanosterol and cycloartenol, OSCs catalyze the cyclization of 2,3-oxidosqualene through the CBC conformation. Lanosterol synthase (LAS) and cycloartenol synthase (CAS) are involved in these processes, respectively. In the biosynthesis of pentacyclic triterpenes, OSCs catalyze the cyclization of 2,3-oxidosqualene through the CCC conformation, and the products include mixed-amyrin synthase (MAS), lupeol synthase (LUS), β-amyrin synthase (BAS), and dammarenediol synthase (DDS). Oleanane type is the main structure of pentacyclic triterpene saponins, and its biosynthesis is catalyzed by β-amyrin synthase. 2,3-oxidosqualene is cyclized in a "chair-chair-chair" conformation to form β-amyrinol under the catalysis of β-amyrin synthase.

[0005] The previously reported substitution (Oatβ-AS S728F) may lead to the formation of a truncated tetracyclic OS cyclization product by impairing the ring expansion of the dammarene cation, thereby generating DM-II. No obvious changes in the product spectrum were observed in the F728T and F728S mutants, but trace amounts of DM-II were detected, suggesting that it may be related to the early quenching of the carbocation intermediate. However, these substitutions were either identified through forward genetic screening in plants or designed based on the catalytic mechanism of quenching the cationic intermediate during the cyclization process. Currently, the specific residue motifs that are critical for the functional innovation of DDS remain poorly understood.

[0006] Therefore, how to overcome the shortcomings of existing technologies is an urgent problem to be solved in the field of genetic technology. Summary of the invention

[0007] The purpose of the present invention is to solve the deficiencies of the prior art and to provide a dammarenediol synthase mutant and its application in the preparation of β-amyrin alcohol.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] The first aspect of the present invention provides a dammarene diol synthase mutant, wherein the dammarene diol synthase mutant is subjected to the following amino acid mutations based on the sequence (PgPNA) as shown in SEQ ID NO. 1: T128L, while keeping the other amino acid sequences unchanged;

[0010] Alternatively, the dammarene diol synthase mutant is subjected to the following amino acid mutations based on the sequence shown in SEQ ID NO. 1: T128L, L242M, F253L, F255M, V327L, A377V, V485Q and A493G, while keeping the other amino acid sequences unchanged.

[0011] The second aspect of the present invention provides an isolated polynucleotide encoding the dammarene diol synthase mutant as described above.

[0012] The third aspect of the present invention provides a vector, characterized in that the vector contains the polynucleotide as described above.

[0013] The fourth aspect of the present invention provides a host cell, characterized in that the host cell contains the above-mentioned vector, or the above-mentioned polynucleotide is integrated into its genome.

[0014] The fifth aspect of the present invention provides a method for producing the above-mentioned dammarene diol synthase mutant, comprising the steps of: culturing the above-mentioned host cell under suitable conditions to express the dammarene diol synthase mutant; and / or isolating the dammarene diol synthase mutant.

[0015] A sixth aspect of the present invention provides use of a dammarene diol synthase mutant in the preparation of β-amyrin, wherein the dammarene diol synthase mutant is used to catalyze 2,3-oxidized squalene to produce β-amyrin.

[0016] A seventh aspect of the present invention provides a method for preparing β-amyrin, characterized in that it comprises the following steps: contacting the above-mentioned dammarene diol synthase mutant with a reaction substrate 2,3-squalene oxide to carry out a catalytic reaction, thereby obtaining β-amyrin.

[0017] Further, preferably, the catalytic reaction is specifically as follows: a dammarene diol synthase mutant is constructed on a pYES2 expression vector, transformed into BY4742 yeast cells and fermented to obtain β-amyrin alcohol.

[0018] Furthermore, preferably, the fermentation time is 7 days.

[0019] After 7 days of fermentation, the yeast cell products were extracted with methanol and subsequently detected by high performance liquid chromatography.

[0020] In the early stage, we determined the mutation of key amino acids through site-directed mutagenesis of β-AS (PgOSCPNY1), which enabled β-AS to complete the function of catalyzing the production of dammarenediol II (DM-II).

[0021] The inventors of the present invention conducted site-directed mutagenesis on DDS (PgPNA) and determined the key amino acid mutations, which enabled DDS to acquire the function of catalyzing the production of β-Amyrin (β-AM). These differential sites were reversely mutated, enabling DDS (PgPNA) to acquire the catalytic function of β-AS. This study further analyzed the catalytic differences between DDS and β-AS during the evolution process.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The reported substitution (Oatβ-AS S728F) may lead to the formation of a truncated tetracyclic OS cyclization product by impairing the ring expansion of the dammarene cation, thereby generating DM-II. No obvious changes in the product spectrum were observed in the F728 T and F728 S mutants, but trace amounts of DM-II were detected, suggesting that it may be related to the early quenching of the carbocation intermediate. However, these substitutions were either identified by forward genetic screening in plants or designed based on the catalytic mechanism of quenching the cationic intermediate during the cyclization process, rather than by site-directed mutagenesis of the equivalent conserved residues in DDS (Oatβ-AS S728 is conserved as Asn in DDS, while β-AS F728 is conserved as Tyr). The specific residue motifs that are critical for the functional innovation of DDS remain poorly understood. The present invention reveals through site-directed mutagenesis that the changes in the nucleotide sequence of the β-AS gene after the whole genome duplication event trigger changes in its amino acid sequence, thereby generating a new function of DDS. Reverse mutation modification is performed on these differential sites to enable DDS (PgPNA) to have the catalytic function of β-AS, and further in-depth analysis is conducted on the catalytic differences between DDS and β-AS formed during the evolutionary process. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The results of β-amyrin content detection of wild-type and mutant PgOSCPNY1; (a) is the HPLC method for β-amyrin content detection; (b)-(g) are PgPNA M8 The corresponding β-amyrin alcohol (trimethylsilane derivative), PgPNA L242M GC-MS graphs of the corresponding β-amyrinol (trimethylsilane derivative), β-amyrinol standard, and β-amyrinol (trimethylsilane derivative) obtained for wild-type PgPNA. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with embodiments.

[0026] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0027] 1 Materials and methods

[0028] 1.1 Source of OSC DNA sequence and cDNA synthesis

[0029] The DNA sequence of PgPNA (DDS gene in ginseng) (AB265170.1) is shown in SEQ ID NO. 1, downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / ), and synthesized at Universe Gene Technology (Tianjin) Co., Ltd.

[0030] 1.2 Protein characteristics and sequence analysis

[0031] The molecular weight (kDa) and isoelectric point (pI) of PgPNA were calculated online (http: / / www.detaibio.com / sms2 / protein_mw.html). DNAMA software was used to compare the protein sequences of PgPNA (DDS) and PgOSCPNY1 (β-AS, whose DNA sequences (shown in SEQ ID NO.2) were compared.

[0032] 1.3 Cloning of PgPNA and construction of expression vector

[0033] (1) PCR reaction was performed using gene-specific primers of PgPNA. The reaction system was prepared according to the instructions of Phanta-Max Super-Fidelity DNA Polymerase. The primers used in the PCR reaction are shown in Table 1, and the PCR reaction system is shown in Table 2. The PCR reaction program was as follows: pre-denaturation at 95°C for 180 s; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 100 s, for a total of 35 cycles; extension at 72°C for another 300 s, and 4°C +∞.

[0034] Table 1

[0035]

[0036] Table 2

[0037] Reagents Volume (μL) <![CDATA[Phanta 注 ]]> 12.5 Forward primer (10uM) 1.0 Reverse primer (10uM) 1.0 Each OSC gene cDNA (100-200ng / uL) 2.0 <![CDATA[ddH 2 The]]> 8.5 Overall system 25.0

[0038] Note: Phanta is the reagent in Novozymes high-fidelity PCR Phanta-Max Super-Fidelity DNA Polymerase.

[0039] (2) The PgPNA gene primer is designed with a pYES2 connection site sequence (homologous arm) to facilitate homologous recombination between the target gene and the vector.

[0040] (3) constructing expression vector primers to amplify the target gene containing the vector homology arms, and cutting and recovering the PCR product;

[0041] (4) Digest the yeast expression vector pYES2 with BamHI and recover the product to obtain the linearized vector pYES2. The enzyme digestion system is shown in Table 3. The enzyme digestion reaction conditions are: 37°C for 1h, 65°C for 15min, and 10°C+∞.

[0042] Table 3

[0043] Reagents Volume (μL) BamHI restriction endonuclease 0.5 pYES2 plasmid 10.0 CutSmart Buffer (*10) 2.0 <![CDATA[ddH 2 The]]> 7.5 Overall system 20.0

[0044] (4) Use Seamless Cloning and Assembly Kit was used to recombinate the vector and target gene fragment to obtain the recombinant plasmid pYES2. Seamless Cloning and Ass embly Kit was used to recombine the vector and target gene fragment to obtain the recombinant plasmid pYES2-PgPNA.

[0045] 0.7 μL linearized vector pYES2, 2.3 μL target gene (PgPNA), 3 μL 2×SDMM (homologous recombinase), the recombination reaction program was 50°C for 20 min, 10°C+∞.

[0046] (5) The recombinant plasmid pYES2-PgPNA was transformed into DH5a E. coli competent cells and cultured on LB solid plates containing 100 mg / L Am p (Table 4) at 37°C overnight. The specific method is as follows:

[0047] (5.1) Take 10 μL of recombinant plasmid pYES2-PgPNA and add it to 50 μL of E. coli competent cells and mix thoroughly (carefully blow with a pipette). Place the mixture on an ice box (to maintain the competent state of E. coli and facilitate the entry of the plasmid into E. coli) for 30 minutes.

[0048] (5.2) After heat shock at 42°C for 90 seconds, remove from the tube and place in an ice bath for 2 to 5 minutes.

[0049] (5.3) Add 450 μL of antibiotic-free LB medium and place in a shaking incubator at 37°C and 220 rpm for 50 min.

[0050] (5.4) After 50 min, take 100 μL of bacterial solution and spread it on LB solid medium containing 100 mg / L Amp. Incubate in a constant temperature incubator at 37°C for 8-12 h.

[0051] (5.5) When a single colony is observed to grow, perform bacterial picking and shaking (add 500 μL of LB medium containing 100 mg / L Amp to a 2 mL centrifuge tube) and shake the bacterial suspension at 220 r / min at 37°C. Bacterial picking means taking the plate with a single colony to a sterile operating table, using a special bacterial picking device to pick a single colony and put it into a centrifuge tube containing LB medium containing 100 mg / L Amp, sealing the tube, and taking it out to a shaker to shake the bacteria until the bacterial solution becomes turbid.

[0052] (6) Select a monoclonal colony for PCR. The primers used in PCR are shown in Table 5. The reaction system is shown in Table 6. The reaction procedure is as follows: pre-denaturation at 95°C for 300 s; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 100 s, for a total of 35 cycles; extension at 72°C for another 300 s, and 4°C +∞.

[0053] Table 4

[0054] Reagents volume Tryptone 10g Yeast Extract 5g NaCl 10g Solid plus agar powder 20g / L

[0055] Table 5

[0056] Primer number Primer sequences SEQ ID No. Detection of PY-F ggagaaaaaaccccggatcggactactagcag 5 Detection of PY-R aagcgtgacataactaattacatgatgcggccctc 6

[0057] Table 6

[0058] Reagents Volume (μL) 2×FastTaq Premix 12.5 Detection of PY-F (10uL) 1.0 Detection of PY-R (10uL) 1.0 Bacterial liquid 2.0 <![CDATA[ddH 2 The]]> 8.5 Overall system 25.0

[0059] After the PCR reaction program is completed, take 5uL of PCR product for agarose gel electrophoresis, the electrophoresis program is 185V, 180mA, 20min. Take out the run gel and put it into the gel imager for observation. If there is a clear band in the range of 2000-3000bp, it is a sequencing-positive bacterium, which is used for sequencing to detect the authenticity of the target gene transferred into Escherichia coli cells.

[0060] 1.4 Site-directed mutagenesis of amino acid sites

[0061] By replacing each predicted candidate amino acid residue of DDS (PgPNA) with alanine, and then mutating these clear amino acid residues to the corresponding β-AS (PgOSCPNY1) (β-amyrin synthase in ginseng) sites, mutation primers were designed to perform PCR-based site-directed mutagenesis on the expression plasmid of DDS (PgPNA). The primers are shown in Table 7 and the reaction program is shown in Table 8.

[0062] Table 7

[0063]

[0064]

[0065] Table 8

[0066]

[0067] 1.5 Products extracted from BY4742 strain

[0068] The pYES2-PgPNA and its mutant expression plasmids were transformed into BY4742 yeast expression strain by lithium acetate transformation. The transformation system is shown in Table 9.

[0069] Table 9

[0070] Reagents volume PEG4000 (50% aqueous solution) 240ul LiAC (1.0 mol / L) 36ul Salmon sperm DNA (2.0 mg / ml) 10ul pYES2-PgPNA plasmid and water 74ul

[0071] Note: Add 400ng pYES2-PgPNA plasmid and mix well.

[0072] In order to screen the BY4742 transformants of the pYES2-PgPNA expression plasmid, a solid synthetic complete medium (SC-Ura) without uracil was used (see Table 10), and 2% glucose by mass was added to the medium. After culturing in a 30°C incubator for 4-5 days, single colonies were selected, and then the positive single colonies were placed in SC-Ura medium supplemented with 2% glucose by mass, and cultured at 30°C at a rotation speed of 220 rpm for 2 days.

[0073] Table 10

[0074]

[0075]

[0076] The yeast cells were collected and induced with 100 mL SC-Ura medium containing 2% galactose by mass, and cultured at 30° C. with shaking at 220 rpm for 5 days.

[0077] The cultured cells were resuspended in 0.1M potassium dihydrogen phosphate buffer (pH 7.0) containing 2% glucose by mass, and stirred at 220 rpm for 1 day at 30°C. After the yeast cells were collected, the lysate was prepared by ultrasonic extraction with analytical methanol for 1 hour. The ultrasonic crusher used for ultrasonic extraction had an output power of 500W and an operating frequency of 20KHz.

[0078] The lysed yeast solution was centrifuged at 3900 rpm for 20 min, and the supernatant was extracted three times with n-hexane. The three n-hexane extraction solutions were combined and evaporated by rotary evaporation at 50°C.

[0079] The evaporated solid extract was dissolved in 200 ml of analytical methanol solution. The obtained sample was filtered through a 0.22 mm organic phase filter membrane and detected by Agilent 1260 high performance liquid chromatograph. The elution program of HPLC is shown in Table 11. (HPLC was identified using an Agilent Zorbax Eclipse XDB-C18 column (4.6×250 mm, 5 μm; Agilent Technologies, Santa Clara, CA, USA))

[0080] Table 11 Product HPLC Procedure

[0081]

[0082] 2 Results

[0083] 2.1 Characterization of PgPNA and PgOSCPNY1 gene functions

[0084] The recombinant plasmid pYES2-PgOSCPNY1 was transformed into the GIL77 strain and the product was extracted after fermentation. The product was then tested by GC-MS. The results showed that the PgOSCPNY1 enzyme gene has the function of expressing the catalytic enzyme ( Figure 1 ).

[0085] 2.2 Protein sequence alignment

[0086] In the early stage, we completed the mutant of β-amyrin synthase and its application in the preparation of dammarenediol. By comparing the sequence differences of DDS (PgPNA) and β-AS (PgOSCPNY1), the key amino acid residues (PgPNA T128 , PgPNA L 242 , PgPNA F253 , PgPNA F255 , PgPNA V327 , PgPNA A377 , PgPNA V485 , PgPNA A493 ), the above-mentioned site of DDS (PgPNA) was reversely mutated to the site of β-AS (PgOSCPNY1) (Table 11).

[0087] We designed single-site PgPNA for the above 8 sites T128L and iterative mutation of 8 sites PgPNA M8 (See Table 13) The amino acid abbreviations and codons and their characteristics are shown in Table 14.

[0088] Table 12 Amino acid mutation sites

[0089]

[0090] Note: T128L: Threonine at position 128 mutated to leucine; L242M: Leucine at position 242 mutated to methionine; F253L: Phenylalanine at position 253 mutated to leucine; F255M: Phenylalanine at position 255 mutated to methionine; V327L: Valine at position 327 mutated to leucine; A377V: Alanine at position 377 mutated to Valine; V485Q: Valine at position 485 mutated to glutamine; A493G: Alanine at position 493 mutated to glycine.

[0091] Table 13 Mutant design

[0092] Mutant number Mutant site <![CDATA[PgPNA M1 ]]> <![CDATA[PgOSCPNY1 L242M ]]> <![CDATA[PgPNA M8 ]]> <![CDATA[PgOSCPNY1 T128L+L242M+F253L+F255M+V327L+A377V+V485Q+A493G ]]>

[0093] Note: PgPNA M8 Indicates that all 8 sites are iteratively mutated.

[0094] Table 14 Amino acid abbreviations and codons and their characteristics

[0095]

[0096]

[0097] 2.3 Directed mutagenesis results

[0098] Site-directed mutagenesis was performed on the differential sites in the sequence alignment, and the results are shown in Table 15.

[0099] Table 15 mutant product content

[0100]

[0101] The results show that mutation design can manipulate the specific cyclization process of the product to improve the selectivity of new triterpenoid compounds. This mutation experiment is a reverse mutation experiment of the study "β-amyrin synthase mutants and their application in the preparation of dammarene diol". L242M The single site and PgPNA M8 The multi-site mutation not only reversed the function of DDS and made it have the catalytic function of β-AS, but also confirmed that this mutation experiment further explained the source of the difference in catalytic function between DDS and β-AS.

[0102] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A dammarene diol synthase mutant, characterized in that The dammarene diol synthase mutant is subjected to the following amino acid mutation based on the sequence shown in SEQ ID NO.1: T128L, while keeping the other amino acid sequences unchanged; Alternatively, the dammarene diol synthase mutant is subjected to the following amino acid mutations based on the sequence shown in SEQ ID NO. 1: T128L, L242M, F253L, F255M, V327L, A377V, V485Q and A493G, while keeping the other amino acid sequences unchanged.

2. An isolated polynucleotide, characterized in that The polynucleotide encodes the dammarene diol synthase mutant according to claim 1.

3. A carrier, characterized in that The vector contains the polynucleotide according to claim 2.

4. A host cell, characterized in that The host cell contains the vector as claimed in claim 3, or the polynucleotide as claimed in claim 2 is integrated into its genome.

5. A method for producing the dammarenediol synthase mutant according to claim 1, characterized in that: The method comprises the steps of: culturing the host cell according to claim 6 under suitable conditions to express the dammarene diol synthase mutant; and / or isolating the dammarene diol synthase mutant.

6. Use of a dammarenediol synthase mutant in the preparation of β-amyrin, characterized in that: The dammarenediol synthase mutant is used for catalyzing 2,3-oxidized squalene to generate β-amyrin alcohol.

7. A method for preparing β-amyrin alcohol, characterized in that: The method comprises the following steps: contacting the dammarenediol synthase mutant of claim 1 with a reaction substrate 2,3-oxidosqualene to carry out a catalytic reaction, thereby obtaining β-amyrin alcohol.

8. The method for preparing dammarene diol according to claim 7, characterized in that: The catalytic reaction is specifically as follows: a dammarene diol synthase mutant is constructed on a pYES2 expression vector, transformed into BY4742 yeast cells for fermentation, and β-amyrin alcohol is obtained.

9. The method for preparing dammarene diol according to claim 8, characterized in that: The fermentation time is 7 days.

Images