The cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase and its application
By cloning and expressing the maize ZmCNX2 gene, the problem of early germination of maize seeds was solved, the germination of Arabidopsis seeds was delayed, and its function in regulating seed dormancy in maize was verified, providing a means of regulating seed germination and dormancy.
Patent Information
- Application Number
- CN202411900599.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-23
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-12-23
AI Technical Summary
Changes in abscisic acid content in maize seeds during the maturation stage lead to early germination, affecting seed storage and food safety. The function of the maize ZmCNX2 gene is not clear in the current technology, affecting the regulation of seed dormancy and germination.
The gene ZmCNX2, a cofactor 2 protein of maize nitrate reductase and xanthine dehydrogenase, was cloned and expressed. It was then introduced into Arabidopsis thaliana via Agrobacterium-mediated transformation to construct a plant expression vector, and its effects on seed germination and dormancy were observed.
Overexpression of the ZmCNX2 gene in Arabidopsis delayed seed germination, confirming its important role in regulating seed germination and dormancy, and verifying that its absence in maize led to a preharvest germination phenotype.
Smart Images

Figure CN119709713B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and biotechnology, and particularly relates to the cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase and its application. Background Technology
[0002] Maize (Zea mays L.) is an important food and feed crop widely cultivated globally. However, viviparity, a harmful grain trait, is prevalent in crops such as maize, wheat, and rice, potentially leading to significant yield reductions and economic losses. Particularly in maize, if the ears germinate before harvest, it results in the loss of starch, protein, and oil, and may also produce carcinogens during processing. Therefore, germinated ears of grain are prone to spoilage and pose a threat to human health. Proper seed dormancy at harvest is crucial for seed storage and food safety.
[0003] Studies have shown that changes in abscisic acid (ABA) and gibberellin levels during seed maturation are the main cause of early germination. ABA is a key plant hormone affecting seed germination, dormancy, and viviparity. A series of viviparous mutants cause the ear-germination phenotype by regulating the ABA biosynthesis pathway. In maize, these viviparous mutants are mainly divided into two categories: the first type of mutant, in addition to exhibiting the ear-germination phenotype, also shows a white or light yellow endosperm and seedling phenotype; the second type of mutant has a normal yellow endosperm and normal green leaves. The final step in ABA biosynthesis is catalyzed by abscisaldehyde oxidase 3, which oxidizes abscisaldehyde to ABA. Therefore, the activity of abscisaldehyde oxidase 3 is crucial for ABA biosynthesis. Molybdenum cofactor is essential for the production of aldehyde oxidase activity; therefore, insufficient molybdenum cofactor content leads to a decrease in ABA content. The ZmCNX2 gene in maize encodes GTP 3', 8-cyclase, which catalyzes the first step in molybdenum cofactor biosynthesis. It catalyzes the formation of a unique free radical CC bond between the initial substrate GTP and S-adenosine-L-methionine, producing a unique cyclic nucleotide 3',8-cH2GTP(38). This cyclic nucleotide is then rearranged in the mitochondria by cyclopyrazopterin monophosphate synthase to produce the pyrazopterin ring, forming the first stable intermediate, cyclopyrazopterin monophosphate. Subsequently, cyclopyrazopterin monophosphate is transported to the cytoplasm to synthesize molybdenum cofactor, thereby participating in the biosynthesis of abscisic acid.
[0004] In Arabidopsis thaliana, mutants of the AtCNX2 gene, which is homologous to ZmCNX2, exhibit significantly slowed growth on standard sucrose medium, with seedlings showing yellowing leaves and failing to expand normally. However, the mutant phenotype and specific function of ZmCNX2 in maize are still unknown. Therefore, this invention proposes the cofactor 2 protein gene ZmCNX2 for maize nitrate reductase and xanthine dehydrogenase, and its applications. Summary of the Invention
[0005] The purpose of this invention is to provide the cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase and its application, in order to solve the problems mentioned in the background art.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] The amino acid sequence of cofactor 2 protein of maize nitrate reductase and xanthine dehydrogenase is shown in SEQ ID NO:2.
[0008] The gene ZmCNX2, a cofactor 2 protein of maize nitrate reductase and xanthine dehydrogenase, has the nucleotide sequence shown in SEQ ID NO:1 and encodes the cofactor 2 protein of the aforementioned maize nitrate reductase and xanthine dehydrogenase.
[0009] Application of the cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase in regulating seed germination and dormancy.
[0010] Furthermore, the deficiency of the cofactor 2 protein gene ZmCNX2 of maize nitrate reductase and xanthine dehydrogenase causes maize seeds to lack dormancy and exhibit a pre-harvest germination phenotype.
[0011] Furthermore, overexpression of the cofactor 2 protein gene ZmCNX2 of the maize nitrate reductase and xanthine dehydrogenase can delay the germination of Arabidopsis seeds.
[0012] Furthermore, this includes the following steps:
[0013] The entry vector pDONR207, which was correctly sequenced for ZmCNX2, was recombined with the pEarleyGate101 expression vector using LR enzyme to form the ZmCNX2 plant expression vector. The ZmCNX2 plant expression vector was then transformed into Escherichia coli, positive colonies were picked, and the recombinant pEarleyGate101 plasmid was identified by PCR. This plasmid was then transformed into Agrobacterium GV3101, and the positive strain was confirmed by PCR. The plasmid was then frozen for future use.
[0014] Compared with the prior art, the beneficial effects of the present invention are:
[0015] This invention provides the ZmCNX2 gene, which is closely related to the germination and dormancy of maize seeds. This gene encodes a cofactor 2 protein for nitrate reductase and xanthine dehydrogenase. Mutants of ZmCNX2 in maize exhibit a pre-harvest germination phenotype. A plant expression vector containing the ZmCNX2 gene was constructed and successfully introduced into Arabidopsis thaliana via Agrobacterium-mediated transformation, yielding homozygous T3 generation transgenic Arabidopsis plants. Seed germination experiments conducted on 1 / 2 MS medium revealed that the germination of transgenic Arabidopsis seeds was significantly delayed compared to wild-type Arabidopsis seeds. These results not only further confirm the important role of the ZmCNX2 gene in regulating seed germination but also indicate that gene deficiency leads to maize seeds germinating directly on the ear without dormancy, while overexpression of the ZmCNX2 gene in Arabidopsis delays seed germination. This further validates the central role of this gene in the regulation of seed dormancy and germination. Attached Figure Description
[0016] Figure 1 Multiple sequence alignments at the amino acid level were performed on the maize ZmCNX2 gene in different crops (sorghum, rice, wheat) and Arabidopsis thaliana.
[0017] Figure 2 A schematic diagram of the phylogenetic tree analysis of the maize ZmCNX2 gene.
[0018] Figure 3 Phenotypic images of the maize ZmCNX2 mutant are shown below; A shows the phenotype of the heterozygous ear at 15, 30, and 45 days after pollination; B shows the phenotype of the wild-type and mutant kernels at 30 and 45 days after pollination; and C shows the phenotype of the wild-type and mutant embryos at 20, 25, 30, 35, 40, and 45 days after pollination.
[0019] Figure 4 Determination of abscisic acid content in maize ZmCNX2 mutant vpm
[0020] Figure 5 The relative expression levels of genes related to abscisic acid synthesis in the maize ZmCNX2 mutant vpm were determined.
[0021] Figure 6 The figures show the germination rates of Arabidopsis thaliana lines heterologously expressing the maize ZmCNX2 gene. Figure A shows the phenotypic diagrams of three Arabidopsis thaliana lines overexpressing ZmCNX2 after 3 and 5 days of germination on 1 / 2 MS medium. Figure B shows the germination rate of three Arabidopsis thaliana lines overexpressing ZmCNX2 after 3 days of growth on 1 / 2 MS medium. Figure C shows the total plant length of three Arabidopsis thaliana lines overexpressing ZmCNX2 after 5 days of growth on 1 / 2 MS medium. Detailed Implementation
[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0023] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.
[0024] Example 1: Cloning of the ZmCNX2 gene, a cofactor 2 protein of maize nitrate reductase and xanthine dehydrogenase;
[0025] 1. RNA extraction;
[0026] Total RNA was extracted from the embryos of mature maize inbred line B73 using the Kangwei Century Ultrapure RNA Extraction Kit (CW0581). The specific steps are as follows:
[0027] (1) Take the soaked seed embryo, grind it thoroughly in liquid nitrogen, add 1 ml of TRIzonReagent for every 30-50 mg of tissue, and mix well.
[0028] (2) Gently invert the sample several times to allow for complete lysis of the sample. Incubate at room temperature for 5 minutes to allow the protein-nucleic acid complex to be completely separated.
[0029] (3) Add 200 μl of chloroform, cover the centrifuge tube, shake vigorously for 15 seconds, and let stand at room temperature for 2 minutes.
[0030] (4) Centrifuge at 12,000 rpm for 10 min at 4℃, aspirate 550 μl of the upper aqueous phase, and transfer the upper aqueous phase to a new RNase-Free centrifuge tube.
[0031] (5) Add 550 μl of 70% ethanol (prepared with RNase-Free Water) to the aqueous solution and mix by inverting.
[0032] (6) Add all the solution obtained in the previous step to the adsorption column (Spin Columns RM) that has been loaded into the collection tube. If the solution cannot be added all at once, it can be added in multiple batches. Centrifuge at 12,000 rpm for 20 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0033] (7) Add 700 μl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 20 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0034] (8) Add 500 μl of Buffer RW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 20 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0035] (9) Repeat step (8).
[0036] (10) Centrifuge at 12,000 rpm for 2 min and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to dry completely.
[0037] (11) Place the adsorption column in a new RNase-Free centrifuge tube, add 30-50 μl of RNase-Free Water to the middle of the adsorption column, incubate at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, collect the RNA solution, and store at -80℃ to prevent degradation.
[0038] 2. Reverse transcription;
[0039] The extracted RNA was reverse transcribed using US EVERBRIGHT RT mix with DNase (All-in-One). The system is as follows:
[0040] Table 1 Reverse Transcription System
[0041] Reagents volume 5×RTAll-in-OneMix 4 μl DNase 1 μl Template RNA 1 μl RNaseFreeWater 14μl 20 μl (total volume)
[0042] Place the entire system into the PCR instrument and set the program as follows: 37℃, 2 min; 55℃, 15 min; 85℃, 5 min.
[0043] 3. Amplification of the full-length open reading frame (ORF) of the ZmCNX2 gene;
[0044] Based on the coding sequence of maize ZmCNX2 published in the Ensembl plant database, specific cloning primers for this gene were designed as follows:
[0045] ZmCNX2-F:ATGATGCGACGCTGCGTC (as shown in SEQ ID NO:3)
[0046] ZmCNX2-R:TCAGCCACCTATATGTATCATGGG (as shown in SEQ ID NO:4)
[0047] Using cDNA obtained from reverse transcription as a template, ZmCNX2 was cloned using the high-fidelity, thermostable DNA polymerase PrimeSTAR GXL. The reaction system is as follows:
[0048] Table 2 Reaction System
[0049] Components volume 5×PrimeSTARGXLBuffer 10 μl dNTPMixture 4 μl ZmCNX2-F 1.5μl ZmCNX2-R 1.5μl cDNA 2μl PrimeSTARGXL DNA Polymerase 1 μl Sterile distilled water 30μl
[0050] The PCR reaction program was 98℃ for 10s; 60℃ for 15s; 68℃ for 1min and 10s; 35 cycles; 68℃ for 7min; 16℃ for 1min.
[0051] Electrophoresis of the amplified product revealed an amplified band at approximately 1179 bp (3 bp of which have been removed from the stop codon), consistent with the expected size of the target gene.
[0052] 4. ZmCNX2 connects to pDONR207 vector;
[0053] The target fragment ZmCNX2 was ligated to the pDONR207 vector using the Ready-to-Use Seamless Cloning Kit to obtain the recombinant vector.
[0054] The connection reaction system is as follows:
[0055] Table 3 Connection Reaction System
[0056] Reagents Dosage Target gene fragment 1.5μl pDONR207 vector 1 μl Mix 2.5μl
[0057] 5. Transformation of DH5α Escherichia coli competent cells and detection by PCR in bacterial culture;
[0058] (1) Place 50 μl of DH5α Escherichia coli competent cells on ice to thaw.
[0059] (2) Use a pipette to take 5 μl of the ligation product or recombinant plasmid and add it to 50 μl of DH5α Escherichia coli competent cells.
[0060] (3) After an ice bath for 30 min, heat shock at 42℃ for 90 s, followed by an ice bath for 5 min. Then add 800 μl of LB liquid culture medium.
[0061] (4) Incubate at 37°C with shaking for 1 h, then centrifuge at 8000 rpm for 5 min. Discard the supernatant and retain about 50 μl of culture medium in the centrifuge tube. Mix well with a pipette and spread it on LB solid medium containing the corresponding antibiotic. Incubate at 37°C inverted for 12-16 h.
[0062] (5) Pick a single colony and put it into 800 μl of LB liquid medium containing the corresponding antibiotic. Place the centrifuge tube in a shaker and incubate at 37°C with shaking at 180 rpm for about 10 h.
[0063] (6) PCR molecular detection of bacterial culture was performed using Ex Taq enzyme. The bacterial culture with positive PCR results was amplified and shaken, and 15% glycerol was added to the bacterial culture. The culture was then sent to Sangon Biotech for sequencing. The original bacterial culture was stored at -80°C.
[0064] Example 2: Bioinformatics analysis of the maize ZmCNX2 gene;
[0065] like Figure 1 and Figure 2 As shown, we performed multiple sequence alignment and phylogenetic analysis at the amino acid level for the ZmCNX2 gene in different crops (sorghum, rice, wheat) and Arabidopsis thaliana. The results showed that ZmCNX2 is highly conserved among different species, and it has the highest homology with the homologous gene in sorghum, and the homology with the homologous protein AtCNX2 in Arabidopsis thaliana is 79.85%.
[0066] Example 3: Phenotypic observation of maize ZmCNX2 gene mutants;
[0067] Phenotypic observation was performed on the EMS mutant vpm of the ZmCNX2 gene in maize. Compared with the B73 inbred line, this mutant did not exhibit normal seed dormancy, and viviparous seeds could be observed before harvest. Figure 3 As shown in Figures A and B, there was no significant difference between mutant and normal seeds 15 days after pollination. However, at 30 days post-pollination, the two could be distinguished in heterozygous ears, at which point the mutant had begun to show germination phenotypes, but the buds did not break the seed coat. Until 45 days post-pollination, the roots and buds in the mutant grains showed significant elongation. We obtained wild-type and mutant embryos at different pollination times and observed their growth. Figure 3 As shown in Figure C, during seed development and maturation, starting approximately 25 days after pollination, the mutant embryos begin to germinate and grow, compared to the dormant wild type. These results indicate that in maize, mutations in the ZmCNX2 gene prevent normal seed dormancy, resulting in a pre-harvest germination phenotype.
[0068] Example 4: Determination of abscisic acid content in maize ZmCNX2 mutant vpm;
[0069] Previous studies have shown that viviparous mutants of maize exhibit abscisic acid (abscisic acid) biosynthesis defects, and ZmCNX2 is indirectly involved in abscisic acid biosynthesis. To examine whether the pre-harvest germination morphology of the mutants is related to abscisic acid deficiency, we determined the abscisic acid content in wild-type (WT) and mutant (vpm) embryos 30 days post-pollination using LC-MS / MS. Figure 4 As shown, the results indicate that the abscisic acid content in mutant embryos is significantly lower than that in wild-type embryos, approximately 1 / 15 of that in wild-type embryos.
[0070] Example 5: Determination of the expression levels of abscisic acid synthesis-related genes in the maize ZmCNX2 mutant vpm;
[0071] For gene expression analysis, embryos were isolated from immature seeds 30 days post-pollination and stored at -80°C. Total RNA was extracted from the samples, and first-strand cDNA was synthesized using an ultrapure RNA kit and a UEIris II first-strand cDNA synthesis kit. Quantitative real-time PCR was performed using 2x SYBR Green qPCR Master Mix to quantify the expression levels of ZEP, NCED9, VP14, AO3, ABH4, and ABH5. The maize ZmGAPDH gene was used as an internal control. Figure 5 As shown, compared with the wild type, the mutants exhibited higher expression levels of ZEP and NCED9, which are involved in abscisic acid biosynthesis, while the expression levels of VP14 and AO3 were lower. Furthermore, we found decreased expression levels of ABHD4 and ABHD5, which are involved in abscisic acid metabolism, in the mutants.
[0072] Example 6: Construction of ZmCNX2 plant expression vector;
[0073] The recombinant pDONR207 plasmid containing the ZmCNX2 gene fragment, which was correctly sequenced, was processed and analyzed using Gateway. TM LR Clonase TM ∥Enzyme mix ligates the target gene fragment into the plant expression vector pEarleyGate101 via recombination exchange. The reaction system is as follows:
[0074] Reagents Dosage pEarleyGate101 2μl pDNOR207-ZmCNX2 2.5μl LREnzyme 0.5μl
[0075] The reaction system was placed in a ligation apparatus and reacted at 25°C for 3 hours for the transformation of *E. coli*. Positive colonies were picked, and the recombinant pEarleyGate101 plasmid was identified by PCR. This plasmid was then transformed into *Agrobacterium* GV3101, and the positive strain was confirmed by PCR. The strain was then frozen for future use.
[0076] Example 7: Obtaining and molecularly detecting Arabidopsis thaliana transgenic with the ZmCNX2 gene;
[0077] Gene transformation of Arabidopsis thaliana was performed using the flower-dipping method. The specific procedures are as follows:
[0078] (1) Invert the flowering Arabidopsis thaliana so that the flower buds face down and immerse it in Agrobacterium tumefaciens solution for 2 minutes.
[0079] (2) The transformed Arabidopsis plants were laid flat, covered with plastic wrap, and grown under low light intensity for 24 hours. Then they were placed under normal light conditions for further growth. One week later, the plants were infected again using the same method.
[0080] (3) The transformed plants can flower and grow normally. When the siliques are completely withered and about to crack, the seeds can be harvested.
[0081] (4) Some of the harvested T0 generation seeds were screened by Basta and identified by PCR to obtain T1 generation transgenic plants. After two generations and screening, T3 generation Arabidopsis plants were obtained, which can be used for subsequent phenotypic identification.
[0082] Example 8: Germination rate statistics of T3 generation Arabidopsis thaliana transgenic with ZmCNX2 gene;
[0083] Wild-type (WT) and ZmCNX2 transgenic Arabidopsis T3 generation seeds (OE1, OE2, OE3) were sterilized and sown in solid 1 / 2 MS medium. After vernalization at low temperature for 3 days, they were transferred to an Arabidopsis culture room to continue germination. Starting 12 hours after seed placement, germination was observed and recorded every 12 hours. Figure 6 As shown in Figure AC, the results indicate that the germination rate of Arabidopsis seeds overexpressing the ZmCNX2 gene was significantly slower compared to wild-type seeds, suggesting that overexpression of the ZmCNX2 gene can delay the germination of Arabidopsis seeds.
[0084] In summary, this invention successfully obtained a cofactor 2 protein gene, ZmCNX2, for maize nitrate reductase and xanthine dehydrogenase from the maize inbred line B73. Using Agrobacterium-mediated transformation, the plant expression vector containing the ZmCNX2 gene was successfully introduced into Arabidopsis thaliana, resulting in homozygous T3 generation transgenic Arabidopsis plants. Germination experiments showed that the germination of transgenic Arabidopsis seeds was significantly delayed compared to wild-type Arabidopsis seeds. These results indicate that the ZmCNX2 cofactor 2 protein gene for maize nitrate reductase and xanthine dehydrogenase affects ABA synthesis, and mutations in this gene lead to premature germination of maize ears before harvest. Furthermore, ectopic expression of ZmCNX2 in Arabidopsis can delay seed germination.
[0085] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent.
Claims
1. Overexpression of the cofactor 2 protein gene of maize nitrate reductase and xanthine dehydrogenase ZmCNX2 Its application in delaying Arabidopsis seed germination is characterized by, The gene ZmCNX2 The nucleotide sequence is shown in SEQ ID NO:1.