Fluorescent RNA probe based on hairpin structure and application thereof

Abstract

The invention discloses a fluorescent RNA (Ribonucleic Acid) probe based on a hairpin structure, the molecular stability and the detection sensitivity of the fluorescent RNA probe are improved by screening and optimizing the stem region length, the GC (Gas Chromatography) content, the free energy, the melting temperature, the loop region sequence and the thermodynamic parameters of the probe and adapting fluorescence and quenching groups, and the fluorescent RNA probe of which the sequence is 5 '-FAM-CGCUUCACUGUAUUGAGAGCG-TAMRA-3' is finally obtained. Meanwhile, a detection method and a fluorescence detection kit based on the probe are further researched and developed, and the accuracy, the reliability, the stability, the specificity and the sensitivity of RNAse A enzyme detection can be finally improved by means of a dual-wavelength ratio detection strategy, a dynamic continuous detection mode, a third-order derivative standard curve fitting algorithm and the like. The traditional Chinese medicine composition has pioneering clinical application value and wide market prospect.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to the field of RNase A fluorescence detection, and specifically relates to a fluorescent RNA probe based on a hairpin structure and an application thereof. Background Art

[0002] RNase A (Ribonuclease A) is an endoribonuclease derived from bovine pancreas that can specifically degrade cytosine (C) or uracil (U) residues on single-stranded RNA. It hydrolyzes 2',3'-cyclic phosphate to the corresponding 3'-nucleoside phosphate by cleaving the phosphodiester bond formed by the 5'-ribose on a nucleotide and the phosphate group on the 3'-ribose of the adjacent pyrimidine nucleotide.

[0003] RNase A fluorescence detection method is a detection method that uses fluorescence resonance energy transfer (FRET) technology. This method uses an RNA fluorescent probe as a substrate, with a fluorescent reporter group (such as FAM) on one end of the probe and a quencher group (such as TAMRA) on the other end. In the absence of RNase A, the fluorescent reporter group and the quencher group are close to each other and no fluorescent signal is generated. When RNase A is present in the sample, the RNA fluorescent probe is degraded, the fluorescent reporter group and the quencher group are separated, and the fluorescent reporter group emits fluorescence, and the fluorescent signal increases with time and the increase in RNase A concentration.

[0004] At present, the problems of fluorescence detection methods include: detection sensitivity and specificity need to be improved, signal-to-noise ratio, recovery rate and detection consistency are poor, etc. In view of this situation, it is urgent to provide a fluorescence detection method with high sensitivity, wide dynamic range and strong stability and a corresponding kit. Summary of the invention

[0005] To solve the above problems, the purpose of the present invention is to provide a fluorescent RNA probe based on a hairpin structure and its application. The fluorescent RNA probe and related products and methods provided in this application have the advantages of being simple, economical, wide in detection range, high in sensitivity, strong in specificity and high in stability.

[0006] The technical contents of the present invention are as follows:

[0007] In a first aspect, the present invention provides a fluorescent RNA probe based on a hairpin structure, the sequence of the probe being shown in SEQ ID NO.1: CGCUCUCACUGUAUUGAGAGCG.

[0008] Preferably, the 5' end of the fluorescent RNA probe is a fluorescent group, and the 3' end is a quenching group.

[0009] Preferably, the fluorescent group includes but is not limited to any one of FAM, HEX, TET and ROX.

[0010] Preferably, the quenching group includes but is not limited to any one of TRAMA, DABCYL, BHQ1, BHQ2, and TAMRA.

[0011] Preferably, the fluorescent group is FAM, and the quenching group is TRAMA.

[0012] Specifically, the fluorescent substrate probe of the present invention is an optimized designed hairpin structure RNA probe, and its sequence is:

[0013] 5'-FAM-CGCUCUCACUGUAUUGAGAGCG-TAMRA-3';

[0014] The fluorescent RNA probe of the present invention has the following characteristics: a. stem region length: 5 base pairs; b. loop region size: 12 nucleotides; c. stem region GC content: 80%; d. predicted melting temperature: 65°C.

[0015] Fluorescence Resonance Energy Transfer (FRET) is a physical phenomenon based on energy transfer between two fluorescent molecules, which is used to study intermolecular interactions and intramolecular conformational changes. In FRET technology, commonly used fluorescent groups (donors) and quenching groups (acceptors) include:

[0016] Fluorophores (donors): 6-FAM (6-carboxyfluorescein): commonly used to label DNA or proteins, with an emission wavelength of about 520-530nm. TET (tetramethylrhodamine): a red fluorophore, commonly used in FRET experiments, with an emission wavelength of about 550nm. JOE (4-methylumbelliferone): a fluorophore with an emission wavelength of about 530nm. HEX (6-carboxy-2',4',5',7'-tetrachlorofluorescein): a fluorophore with an emission wavelength of about 565nm. Cy3: a near-infrared fluorophore with an emission wavelength of about 570nm.

[0017] Quencher group (acceptor): DABCYL (4-(4-dimethylaminophenyl)-3-cyano-5-isothiocyanatebenzoic acid): a commonly used non-fluorescent quencher group because of its small quenching spatial range and the fact that it does not emit fluorescence itself. TAMRA (6-carboxytetramethylrhodamine): a fluorophore that can also be used as a quencher group with an emission wavelength of approximately 580nm. BHQ1 (Black Hole Quencher 1): a very effective non-fluorescent quencher group suitable for applications requiring long-distance quenching. BHQ2 (Black Hole Quencher 2): similar to BHQ1, it is also a highly efficient non-fluorescent quencher group.

[0018] The combination of these groups can be selected according to the specific needs of the experiment to achieve the best FRET efficiency and signal ratio. The efficiency of FRET depends on the overlap between the emission spectrum of the donor and the excitation spectrum of the acceptor, as well as the distance and relative orientation between the donor and the acceptor. By selecting appropriate fluorescent groups and quenching groups, accurate detection of dynamic changes in biomolecules can be achieved.

[0019] During the long-term scientific research process, the applicant has carried out numerous experimental screening and verification and finally obtained a probe with the above-mentioned excellent performance, which has important practical application value.

[0020] Specifically, the inventors developed a fluorescent RNA probe based on a hairpin structure and systematically optimized its molecular stability and detection sensitivity. The core improvements in the probe design are reflected in the following aspects:

[0021] a. Sequence design: Use Primer3 and RNAfold tools for preliminary sequence screening and structure prediction:

[0022] The initial sequence (SEQ ID NO. 2: 5'-UCUCACUGUAUUGAGA-3') and design parameters (such as stem region length, GC content range) were input through Primer3 to generate multiple candidate sequences.

[0023] In the process of probe design, although the inventors used conventional software tools such as Primer3 to generate candidate sequences, they did not rely solely on the default settings of the software. After the candidate sequences were generated, they underwent rigorous manual screening and optimization, taking into account experimental requirements such as the secondary structure of the target sequence and primer annealing characteristics. These screening steps not only rely on software output, but also include specific experimental parameters, professional judgment and experimental verification.

[0024] The design parameters are specifically as follows: according to the requirements of RNA secondary structure and PCR amplification efficiency, the primer length is set to 20 bases, which can ensure binding specificity and facilitate amplification; the GC content is set to 50%, which can ensure stability and reduce the risk of secondary structure; the Tm value of the forward and reverse primers is set to 58°C, and the annealing temperature is calculated to be 53°C according to the Tm value to ensure efficient PCR reaction; the stem region length is set to 5 base pairs, while ensuring binding force and amplification efficiency, avoiding the formation of dimers caused by excessive self-complementarity; considering the influence of the secondary structure, the possible formation of hairpin structures or other secondary structures that interfere with the function of the primers is avoided.

[0025] RNAfold was used to predict the secondary structure of candidate sequences, and sequences with lower free energy (ΔG) and ideal melting temperature (Tm) were selected.

[0026] b. Thermodynamic optimization: mfold software was used to further optimize the thermodynamic parameters of the probe and simulate its stability and dynamic behavior under the detection conditions. Sequences with a ΔG between -5 and -8 kcal / mol were selected to ensure that the probe was both stable and easy to melt. The reactivity of different loop sequences was compared to ensure that RNase could effectively recognize and cut, and the sequence of this application, SEQ ID NO.1CGCUCUCACUGUAUUGAGAGCG, was finally selected.

[0027] c. Sequence verification: Check the specificity of the probe sequence using the BLAST function in NCBI to avoid nonspecific binding with non-target RNA fragments.

[0028] d. Fluorescence and quenching group labeling: Combined with the length and melting temperature of the probe sequence, select the appropriate fluorescent group (FAM) and quenching group (TAMRA). Different fluorescent groups and quenching groups differ in physicochemical properties, especially in terms of binding stability with the probe sequence, Tm matching, and signal quenching efficiency. By analyzing relevant literature and based on theoretical deduction, the inventors selected this specific group combination to provide the best signal-to-noise ratio and relatively stable signal intensity for the probe sequence and detection method.

[0029] The hairpin structure RNA fluorescent probe (sequence 5'-FAM-CGCUCUCACUGUAUUGAGAGCG-TAMRA-3') developed by the present invention is the most critical innovative component. The probe has a stem region of 5 base pairs and a loop region of 12 nucleotides through an optimized molecular structure. Among them, the stem region adopts an 80% GC content ratio to ensure an ideal melting temperature of 65°C and obtain a Gibbs free energy of -6.8 kcal / mol. The optimization of these parameters enables the probe to perform well in improving structural stability and detection specificity. Compared with traditional linear probes, this design reduces background fluorescence by more than 15%, and the signal-to-noise ratio is increased to 2 to 2.5 times.

[0030] The second invention is to provide a use of the fluorescent RNA probe as described in the first aspect in the preparation of a fluorescent detection kit.

[0031] In a third aspect, the present invention provides a kit, the kit comprising the fluorescent RNA probe described in the first aspect;

[0032] Preferably, the kit further comprises RNase AI standard and reaction buffer;

[0033] Specifically, this kit contains the following components:

[0034] 1. RNaseA standard: recombinant bovine pancreatic RNase A (G8277-500uL, P2936982, Adamas Life)

[0035] 2. Fluorescent substrate probe: Optimized hairpin RNA probe

[0036] Sequence: 5'-FAM-CGCUCUCACUGUAUUGAGAGCG-TAMRA-3' (synthesized by Qingke Biotechnology)

[0037] Features: a. Stem length: 5 base pairs; b. Loop size: 12 nucleotides c. Stem GC content: 80%; d. Predicted melting temperature: 65°C

[0038] 3. Reaction buffer (1×PBS, C8020-500 mL, P2474134, Adamas Life).

[0039] In a fourth aspect, the present invention provides a detection method, which uses the fluorescent RNA probe described in the first aspect or the kit described in the third aspect.

[0040] Preferably, the detection method adopts a dual-wavelength ratio detection strategy;

[0041] Preferably, the dual wavelength ratio detection uses 528 nm as the excitation wavelength and 560 nm as the reference wavelength;

[0042] Definition of dual-wavelength ratio detection: Dual-wavelength ratio detection is an analytical technique that reflects the concentration or activity of a target substance by measuring the ratio of the signal intensity of the same substance at two different wavelengths. This method can reduce the impact of environmental changes on the test results and improve the accuracy of the test.

[0043] Principle of dual-wavelength ratio detection: The principle of dual-wavelength ratio detection is based on measuring the signal intensity of the same substance at two different wavelengths, and then calculating the ratio of the signal intensity at these two wavelengths. This ratio is proportional to the concentration of the target substance and can be used for quantitative analysis. In fluorescent probes, this principle can use the fluorescence intensity ratio of a fluorescent dye at two different wavelengths to reflect the concentration or activity of the target substance. In spectrophotometry, by selecting two wavelengths, the absorbance of the measured component at these two wavelengths is large enough, and the absorbance of the interfering component and the background at these two wavelengths is the same, thereby achieving accurate determination of the target substance.

[0044] Application of dual-wavelength ratio detection in fluorescent probe detection: After the fluorescent probe binds to the reactant, the excitation or emission spectrum may shift. At this time, the fluorescence intensity ratio measured at two different wavelengths can be used for measurement, which is called ratio measurement. This method can reduce data distortion caused by factors such as probe concentration, optical path length of the excitation light, excitation intensity, and detection efficiency, and improve the accuracy and reliability of detection. For example, Fura-2 is a fluorescent probe used to measure the concentration of intracellular free calcium ions. The ratio of its fluorescence intensity at two excitation wavelengths of 340nm and 380nm is directly related to the concentration of intracellular free calcium ions. By measuring the fluorescence intensity ratio at these two wavelengths, the change in calcium ion concentration can be obtained, thereby achieving accurate determination of intracellular calcium ion concentration. This technology has applications in many fields such as biological stains, living cell applications, and gene expression level determination.

[0045] Preferably, the method comprises a preheating equilibrium step;

[0046] Preferably, the preheating time is 3-10 min; for example, 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 or 10 min; the preheating equilibrium is stable at 37±0.2°C;

[0047] Preferably, the preheating time is 5 minutes.

[0048] Preferably, the method adopts a kinetic continuous monitoring mode;

[0049] Preferably, the total detection time in the kinetic continuous monitoring mode is 20-40 min, for example, 20 min, 22 min, 24 min, 26 min, 28 min, 30 min, 32 min, 34 min, 36 min, 38 min or 40 min; the sampling interval is set to 50-70 seconds; for example, 50 seconds, 52 seconds, 54 seconds, 56 seconds, 58 seconds, 60 seconds, 62 seconds, 64 seconds, 66 seconds, 68 seconds or 70 seconds.

[0050] Preferably, the total detection time is 30 minutes, and the sampling interval is set to 60 seconds.

[0051] Preferably, the method uses third-order derivative standard curve fitting to fit and analyze the standard curve;

[0052] Preferably, the third-order derivative standard curve fitting adopts the following mathematical model:

[0053] y=ax 3 +bx 2 +cx+d

[0054] Among them, a is the coefficient of the cubic term (related to the third-order derivative, controlling the curvature of the curve); b is the coefficient of the square term (affecting the curvature and turning of the curve); c is the coefficient of the linear term (related to EC50); d is the constant term (related to the asymptote)

[0055] Definition of third-order derivative standard curve fitting: Third-order derivative standard curve fitting is a curve fitting technique that involves fitting the third-order derivatives of data points. This fitting method requires not only that the fitted curve passes through the given data points, but also that the first-order derivative, second-order derivative, and third-order derivative of the fitted curve at these points match the corresponding derivatives of the data points. This method can provide a more accurate model than ordinary curve fitting, especially in situations where rate of change, acceleration, or higher-order dynamic characteristics need to be considered.

[0056] Principle of third-order derivative standard curve fitting

[0057] In third-order derivative standard curve fitting, we usually use a set of data points \((x_i, y_i)\) and their corresponding derivative values ​​\((y'_i, y”_i, y”'_i)\). The goal of fitting is to find a function \(y=f(x)\) such that:

[0058] 1.\(f(x_i)=y_i\)(function value matching)

[0059] 2.\(f'(x_i)=y'_i\)(first-order derivative matching)

[0060] 3.\(f”(x_i)=y”_i\)(Second-order derivative matching)

[0061] 4.\(f"'(x_i)=y"'_i\)(third-order derivative matching)

[0062] Such a fit can be achieved by constructing a set of equations that include these conditions and solving the set of equations. In practice, this usually involves numerical analysis and optimization algorithms, such as the least squares method.

[0063] Application of third-order derivative standard curve fitting in fluorescence detection: In fluorescence detection, third-order derivative standard curve fitting can be used to analyze the law of fluorescence signal change with concentration, especially in dose-response experiments. For example, the model can be used to estimate the EC50 value of the fluorescent probe with or without enhancer conditions, that is, the probe concentration that causes half the intensity of the maximum fluorescence signal. This is very useful for determining the sensitivity and efficacy of fluorescent probes. Through third-order derivative standard curve fitting, researchers can more accurately understand the interaction between fluorescent probes and target molecules, thereby optimizing the design and application of probes. In addition, third-order derivative standard curve fitting can also be used for baseline correction of fluorescence spectra. In fluorescence spectral analysis, baseline correction is an important step because it can remove background noise and interference, making the fluorescence signal clearer. By using third-order derivative standard curve fitting, the baseline can be determined more accurately, thereby improving the accuracy and reliability of fluorescence detection.

[0064] Specifically, the present invention provides a detection method, comprising the following steps:

[0065] (1) Sample preparation: adding a standard or a sample to be tested to a reaction buffer, and then adding a fluorescent substrate probe working solution containing the fluorescent substrate probe described in the first aspect;

[0066] (2) ELISA: The test was performed using a preheated ELISA reader with a preheating time of 5 min and a stable preheating equilibrium of 37 ± 0.2 °C.

[0067] Among them, the fluorescence detection adopts a dual-wavelength detection strategy, with 528nm as the excitation wavelength and 560nm reference signal collected at the same time; the kinetic detection adopts a continuous monitoring mode, with a total detection time of 30 minutes and a sampling interval of 1 minute;

[0068] (3) Data processing: The third-order derivative standard curve fitting was used to fit and analyze the standard curve.

[0069] Among them, the inventors' core improvements to the process (operation steps) include: the present invention innovatively adopts a kinetic continuous monitoring mode, combined with a dual-wavelength ratio detection strategy. Specifically, under 37±0.2°C conditions, data is collected every 1 minute within 30 minutes using an enzyme reader, while 528nm is used as the main detection wavelength and 560nm is used as the reference wavelength. This detection strategy reduces environmental interference by more than 60% and significantly improves the repeatability of the test results. Compared with the traditional single time point, single wavelength detection method, this process greatly improves the accuracy and reliability of the detection.

[0070] (3) Core improvement of data processing method: The present invention innovatively adopts the third-order derivative standard curve fitting algorithm to replace the traditional two-parameter linear fitting method. The algorithm uses the equation y=ax 3 +bx 2 +cx+d performed fitting analysis on the test data, and the fitting accuracy was significantly improved. The R2 value of the standard curve reached above 0.995, and the coefficient of variation (CV) between batches was controlled between 4.2% and 6.8%, especially in the detection of high-concentration samples, showing higher accuracy and stability. This improvement solved the linear deviation problem of traditional methods in high-concentration areas and greatly improved the accuracy of quantification.

[0071] These three core improvements work together to build a significantly improved RNase fluorescence detection system. Among them, the innovative design of the hairpin structure probe is the basis of the product, the kinetic continuous monitoring mode is the guarantee of application, and the third-order derivative fitting ensures the reliability of the data. These improvements not only overcome the limitations of traditional methods, but also provide a more complete solution for RNase activity detection.

[0072] Beneficial effects:

[0073] The invention discloses a fluorescent RNA probe based on a hairpin structure, which improves its molecular stability and detection sensitivity by screening and optimizing the stem region length, GC content, free energy and melting temperature, loop region sequence, and thermodynamic parameters of the probe and adapting fluorescent and quenching groups. At the same time, the present invention also develops a detection method and a fluorescence detection kit based on the probe, and adopts a dual-wavelength ratio detection strategy, a kinetic continuous detection mode, a third-order derivative standard curve fitting algorithm and the like, which can ultimately improve the accuracy, reliability, stability and specificity of RNAse A enzyme detection, and the signal-to-noise ratio is increased by 2-2.5 times. The R2 value of the standard curve reaches above 0.995, the inter-batch coefficient of variation (CV) is controlled between 4.2% and 6.8%, the relative standard deviation (RSD) of the data is controlled between 5.5-6.8%, the recovery rate is maintained between 94.2-101.5%, and the detection limits in PBS and fetal bovine serum are 0.01 pg / μl and 0.02 pg / μl, respectively, which are reduced by about 50-66% compared with the detection limit of traditional probes, the detection sensitivity is increased by 1.8 times, the environmental interference is reduced by more than 60%, and the detection range is expanded to 0-4 pg / μl, which has pioneering clinical application value and broad market prospects. DETAILED DESCRIPTION

[0074] The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention. The raw materials and reagents used in the present invention are all commercially available.

[0075] Unless otherwise specified, the reagents and instruments used in this experiment are from the following sources:

[0076]

[0077]

[0078] Example 1 Test method

[0079] 1. This kit contains the following components:

[0080] RNaseA standard: recombinant bovine pancreatic RNase A (G8277-500uL, P2936982, Adamas Life)

[0081] Fluorescent substrate probe: Optimized design of hairpin RNA probe

[0082] Sequence: 5'-FAM-CGCUCUCACUGUAUUGAGAGCG-TAMRA-3' (synthesized by Qingke Biotechnology)

[0083] Features: a. Stem length: 5 base pairs; b. Loop size: 12 nucleotides c. Stem GC content: 80%; d. Predicted melting temperature: 65°C

[0084] Reaction buffer (1×PBS, C8020-500mL, P2474134, Adamas Life)

[0085] 2. Specific steps of detection

[0086] The detection method of this kit has been strictly optimized and verified, and a standardized operating procedure has been established. Before testing, ensure that all reagents return to room temperature (20-25°C).

[0087] 1. Preparation of standard series Use 1× reaction buffer to dilute the 10mg / ml RNase standard stock solution in sequence to prepare a standard series with a concentration gradient of 0, 0.0625, 0.125, 0.25, 0.5, 1, 2, and 4pg / μl. Set up three parallel wells for each concentration point.

[0088] 2. Establishment of the reaction system This experiment was carried out in a 96-well black flat-bottom microplate. The black microplate wall can effectively absorb stray light, minimize cross-talk between wells, and reduce background interference. At the same time, the flat-bottom design can ensure the consistency of the optical path and improve the uniformity and repeatability of the detection signal. Experiments have confirmed that compared with transparent or white microplates, black flat-bottom microplates can reduce background signals by 30-40% and increase the signal-to-noise ratio by 15-20%. Add the reaction components in strict accordance with the following order and volume: a. First add 80μL 1× reaction buffer (pH 7.5) b. Then add 10μL of standard or sample to be tested and mix gently c. Finally, add 10μL of fluorescent substrate probe working solution (10μM, fluorescent substrate lyophilized powder + DEPC water to 10μmol / L) to a final concentration of 1μM

[0089] 3. Instrument parameter setting and data acquisition A microplate reader (Thermo Fisher fluorescence microplate reader LUX) with temperature control and kinetic detection functions was used for detection. The key parameter settings are as follows: a) Temperature control: 37±0.2℃, preheating for 5 minutes b) Oscillation parameters: medium speed oscillation for 3 seconds, amplitude 2mm c) Fluorescence detection parameters:

[0090] Main wavelength: excitation 485nm, emission 528nm

[0091] Reference wavelength: excitation 485nm, emission 560nm

[0092] Gain value setting: The gain value is automatically adjusted according to the baseline level of the background fluorescence signal and the maximum signal intensity of the test sample, ranging from 80-90. Before the test, the microplate reader pre-scans the background signal and the target signal through the built-in calibration program, and automatically selects the appropriate gain value to ensure the best sensitivity within the linear range of signal acquisition. If manual setting is required, it is recommended to select a range of 80-90 to obtain a reliable signal amplitude. d) Kinetic detection: The detection process is in continuous monitoring mode, the total experimental time is set to 30 minutes, and the sampling interval is 1 minute. This design can dynamically capture the changes in the fluorescence signal during the reaction, especially the trend of the initial rate, to improve the stability and sensitivity of the detection data. e) Data acquisition: The fluorescence values ​​of 528nm (target signal) and 560nm (reference signal) are recorded at each sampling time point. The wavelength of 528nm is used to reflect the fluorescence enhancement signal after the substrate is unzipped, and the wavelength of 560nm is used as an internal reference to provide correction capabilities for possible environmental interference (such as signal drift and light source fluctuations) in the experiment. The final test results are standardized by the ratio (528nm / 560nm) to further reduce the impact of external conditions on the test.

[0093] 3. Performance Verification Data

[0094] To support the expansion of the detection range, the detection range of the present invention was systematically verified by a series of standard gradient experiments. The linearity and detection accuracy of the standards in the range of 0-4 pg / μl were evaluated using a third-order derivative standard curve fitting algorithm.

[0095] (1) To construct a standard curve and verify the linear range and sensitivity of the method, a 0–4 pg / μl RNase concentration gradient (0, 0.0625, 0.125, 0.25, 0.5, 1, 2, 4 pg / μl) was used, and three sets of parallel samples were set at each concentration point. The reaction system was established in a 96-well black flat-bottom microplate. 10 μL of RNase standard sample and 10 μL of fluorescent substrate probe working solution were added to each well, and the final reaction volume was 100 μL. The fluorescence signal was continuously monitored by a microplate reader at 37±0.2°C for 30 minutes, and the target signal at 528 nm and the reference signal at 560 nm were recorded. The data were analyzed using the third-order derivative fitting method, and the goodness of fit R 2 As an evaluation indicator.

[0096] The third-order derivative standard curve fitting adopts the following mathematical model:

[0097] y=ax 3 +bx 2 +cx+d

[0098] Among them, a is the coefficient of the cubic term (related to the third-order derivative, controlling the curvature of the curve); b is the coefficient of the square term (affecting the curvature and turning of the curve); c is the coefficient of the linear term (related to EC50); d is the constant term (related to the asymptote)

[0099] Table 1. Standard curve fitting data

[0100] Concentration (pg / μl) RFU (mean ± SD) 0 10.2±0.8 0.0625 14.8±1.2 0.125 19.6±1.5 0.25 28.4±2.1 0.5 42.5±2.8 1 60.3±3.4 2 87.2±4.1 4 120.6±5.3

[0101] In the concentration range of 0–4pg / μl, the fluorescence signal (RFU) showed a good linear dependence growth trend, reflecting the high sensitivity of the standard curve. In the low concentration range (0–0.25pg / μl), the RFU value increased from 10.2 to 28.4, and the signal difference was obvious, and each concentration point could be clearly distinguished. The relative standard deviation (RSD) of the data was controlled between 5.5–6.8%, showing good precision and repeatability.

[0102] In the middle concentration range of 0.25–1 pg / μl, the RFU value further increased to 60.3, and the correlation between concentration and fluorescence signal remained good. The goodness of fit of the standard curve (R 2 The value) reached ≥0.995, and linear regression analysis verified its accuracy within the detection range.

[0103] For the high concentration range (1–4 pg / μl), the RFU value increased from 60.3 to 120.6, and the signal growth trend slowed down, but the detection accuracy and sensitivity remained within the ideal range. The RSD in this range was stable at 3.7–4.1%, reflecting the excellent performance of the method in high concentration detection, especially in the application scenario of complex samples.

[0104] (2) The recovery rate was evaluated using a gradient dilution of RNase standard (0.0625, 0.25, 0.5, 1, 2, 4 pg / μl). In the experiment, RNase standard of known concentration was added to the reaction system. After the fluorescence signal was collected, the actual concentration was calculated using the standard curve. The recovery rate was defined as the ratio of the actual measured concentration to the theoretical concentration. Three sets of repeated measurements were set for each concentration point, and the average and standard deviation were calculated respectively.

[0105] Table 2. Recovery evaluation

[0106] Concentration level (pg / μl) Recovery rate (%) (mean ± SD) 0.0625 96.8±6.7 0.25 99.3±5.4 0.5 101.5±5.1 1 95.6±4.6 2 97.8±4.3 4 94.2±3.8

[0107] The recovery data showed that within the concentration range of 0.0625–4pg / μl, the recovery rate remained between 94.2–101.5%, demonstrating high detection accuracy and reliability. At low concentrations (0.0625pg / μl), the standard deviation was relatively large at 6.7%, but the recovery rate was still close to 96.8%. At medium concentrations (0.5–2pg / μl), the recovery rate was between 95.6–101.5%, the standard deviation gradually decreased, and the stability improved. At high concentrations (4pg / μl), the recovery rate decreased slightly, but still remained above 94.2%, indicating that the method has good quantitative ability over the entire concentration range.

[0108] (3) The limit of detection (LOD), limit of quantification (LOQ), and linear range of the method were evaluated by repeated testing with a standard gradient series and low concentration samples (e.g., 0.01 pg / μl). LOD was defined as the lowest concentration corresponding to a signal-to-noise ratio ≥ 3, and LOQ was defined as the lowest concentration with a signal-to-noise ratio ≥ 10 and RSD ≤ 10%. The test included samples from different batches, with three parallel samples in each batch to ensure the reproducibility of the results.

[0109] Table 3. Detection performance indicators

[0110]

[0111] The evaluation results of the detection performance parameters meet the technical requirements of the national standard "Evaluation of Detection Limit and Quantification Limit of Analytical Methods" (GB / T27415-2013), among which the detection limit (LOD) is defined as the signal-to-noise ratio (S / N) ≥ 3. Under the optimized experimental conditions, this method achieved a minimum detection concentration of 0.01pg / μl. This shows that the method has a very high detection sensitivity for trace RNase, which is suitable for the analysis of ultra-low concentration samples and meets the needs of high-sensitivity analysis; the limit of quantification (LOQ) is defined as the signal-to-noise ratio (S / N) ≥ 10, and the relative standard deviation (RSD) ≤ 10%. The LOQ of this method was determined to be 0.05pg / μl, ensuring high-precision quantitative capability in the low concentration range. This standard value is derived from experimental verification and meets the requirements of the national standard, ensuring the reliability and repeatability of the results; in the concentration range of 0–4pg / μl, the goodness of fit of the standard curve reaches R 2 ≥0.995, indicating that the detection method has good linear response performance and can cover the application requirements from trace to higher concentrations. The setting of these parameters not only improves the practicality of the method, but also meets the key indicators in the evaluation of analytical methods, ensuring that it can achieve ideal detection results in practical applications. This provides a reliable technical basis for the sensitive detection of RNase and has certain industry promotion value. Reference sources include GB / T 27415-2013 and actual experimental verification.

[0112] 4. Precision Verification

[0113] Precision evaluation was performed using quality control products at multiple concentration levels:

[0114] To verify the intra- and inter-batch precision of the method, quality control samples of 0.0625, 0.25, 0.5, 1, 2, and 4 pg / μl were selected, and each concentration point was repeated 6 times and the intra-batch coefficient of variation (CV) was calculated. The experiments of different batches were performed 3 days apart, and the inter-batch CV was evaluated by comparing the consistency of the results between multiple batches.

[0115] Table 4. Precision verification results

[0116] Concentration (pg / μl) Intra-assay CV (%) Inter-assay CV (%) 0.0625 6.9 7.8 0.25 5.6 6.2 0.5 4.9 5.5 1 4.3 4.9 2 3.8 4.4 4 3.5 4.0

[0117] In the concentration range of 0.0625–4pg / μl, the intra-assay coefficient of variation (CV) remained between 3.5–6.9%, and the inter-assay CV was between 4.0–7.8%. The CV was higher at low concentrations (0.0625pg / μl), but still within an acceptable range; the CV values ​​in the medium and high concentration ranges gradually decreased, and at 4pg / μl, the intra-assay CV was 3.5%, with particularly good accuracy. The results showed that this method has good repeatability and stability within the concentration range and is suitable for high-sensitivity RNase detection.

[0118] V. Stability Study The stability of the kit under different conditions was systematically evaluated:

[0119] The stability of the probe and the kit was tested under different storage conditions (-20°C, 4°C, room temperature). The storage time was 1 week, 2 weeks, 1 month and longer. The fluorescence signal intensity, sensitivity retention rate and background signal change were measured respectively. For the repeated freeze-thaw experiment, the reagents were subjected to 3 freeze-thaw cycles and the changes in key parameters were measured.

[0120] Table 5. Stability test results

[0121] Storage conditions time Activity retention rate (%) 2–8℃ 3 months ≥95 Room temperature (25℃) 4 hours ≥97 Repeated freeze-thaw (3 times) - 84–89

[0122] The results of the stability test showed that after 3 months of storage at 2–8°C, the activity retention rate of the kit remained above 95%, which is suitable for long-term storage. After 4 hours of storage at room temperature, the activity retention rate was 97%, reflecting excellent short-term stability. After three repeated freeze-thaw cycles, the activity decreased, but it was still maintained in the range of 84–89%. This shows that this kit has good tolerance to environmental and operating conditions and is suitable for routine laboratory use.

[0123] Table 6. Probe stability study results

[0124]

[0125] Note: Data are the mean ± standard deviation of 6 repeated experiments

[0126] When the probe is stored at -20°C for 6 months, the fluorescence signal and sensitivity retention rates remain above 84.2% and 80.9%, respectively, and the background signal change is controlled below +13.8%, showing good long-term stability. When stored at 4°C for 2 weeks, the main performance indicators are still above 83%, but the recommended service life is within 1 week. After storage at room temperature for 48 hours, the probe performance decreases slightly, but it is still suitable for short-term experiments. It is recommended to store at -20°C to ensure optimal performance.

[0127] Comparative Example 1 Probe Performance Comparison

[0128] (1) In the Thermo Fisher fluorescence microplate reader LUX, constant reaction conditions (37±0.2℃, PBS pH 7.5) were set to measure the background RFU and target signal (RFU) of the two probes. The background signal was determined by the control sample without target RNase, and the target signal was determined by the fluorescence value after the reaction of 3-4pg / μl RNase sample (the fluorescence signal change within this range is more significant and close to the detection limit of the probe, which can fully reflect the response ability and signal intensity of the probe). The signal-to-noise ratio (S / N) is the ratio of the target signal to the background signal.

[0129] Table 7. Probe specificity studies

[0130] Probe Type Background RFU Target signal (RFU) Signal-to-Noise Ratio (S / N) Traditional card issuing probe 48.3±2.1 85.4±3.7 1.8 This application probe 41.7±1.8 96.2±3.9 2.3

[0131] From the perspective of background signal, the background RFU of the optimized probe is about 13.7% lower than that of the traditional probe, while the target signal is enhanced by 12.6%. The signal-to-noise ratio of the optimized probe is increased to 2.3, which is about 28% higher than the 1.8 of the traditional probe. This improvement is due to the optimized design that reduces background fluorescence and enhances the release efficiency of the target signal.

[0132] (2) The recoveries of the conventional and optimized probes were evaluated by preparing a series of standard samples with gradient concentrations (0.0625–0.5 pg / μl). Each concentration point was measured at least three times, and the mean and standard deviation were calculated.

[0133] Table 8. Probe recovery study

[0134]

[0135] In the concentration range of 0.0625–0.5 pg / μl, the recovery rate of the optimized probe was between 96.8–99.3%, and the standard deviation was significantly lower than that of the traditional probe, showing higher detection stability and reliability. However, the recovery rate of the traditional probe was relatively low, and the standard deviation in the high concentration range was large, indicating that its consistency in high-sensitivity detection was poor.

[0136] (3) The limits of detection (LOD) of the conventional and optimized probes were tested in two common sample matrices (PBS and fetal bovine serum). LOD was defined as the lowest detection concentration corresponding to a signal-to-noise ratio ≥ 3.

[0137] Table 9. Comparison of probe application scenarios

[0138]

[0139]

[0140] The detection limits of the optimized probe in PBS and fetal bovine serum were 0.01pg / μl and 0.02pg / μl, respectively, which were about 50-66% lower than the detection limit of the traditional probe. This shows that the sensitivity of the optimized probe in different matrices is significantly better than that of the traditional probe, and can meet the detection needs of samples with lower concentrations.

[0141] Comparative Example 2 Comparison of commercially available probes

[0142] In order to comprehensively evaluate the technical advantages of this product, we selected representative linear probe products on the market (respectively denoted as L1, L2, and L3), which are mature technical solutions widely used in related fields. Under standard experimental conditions (37°C, pH 7.5), we systematically evaluated their performance through a unified experimental scheme and the same batch of quality control products. The results are as follows:

[0143] Table 10. Comparison of linear probe performance parameters (n=6)

[0144]

[0145] Experimental data show that all tested products have significant background signal problems, and the signal attenuation rate is nearly twice the industry standard. This systematic defect directly leads to insufficient detection sensitivity, limiting the application of products in low-concentration sample detection.

[0146] Comparative Example 3 Comparison of Data Processing Methods

[0147] In order to evaluate the limitations of the traditional two-parameter fitting method, a systematic comparative experiment was designed. The same standard series (0.0625-1pg / μl, 5 concentration gradients) was used to evaluate three mainstream data processing methods:

[0148] Table 11. Comparison of quantitative accuracy of different data processing methods

[0149]

[0150]

[0151] *Note: Data represent recovery rate ± standard deviation (n = 10)

[0152] The two-parameter linear fitting method showed significant deviations in the low concentration region (0.0625–0.25 pg / μl), with a recovery rate of up to 138.5% ± 10.3% and a large error range, especially at the lowest concentration point (0.0625 pg / μl), which significantly overestimated the sample concentration. As the concentration increased (0.5–1 pg / μl), the recovery rate gradually approached 100%, but still deviated from the ideal value. This shows that the method is not sensitive enough in trace samples and has significant nonlinear errors. The four-parameter fitting performed significantly better than the two-parameter linear fitting in the low concentration range (0.0625–0.25 pg / μl), with a recovery rate ranging from 115.7% ± 7.2% to 106.2% ± 5.7%, and a relatively small deviation range. However, in higher concentrations (0.5–1 pg / μl), the recovery rate gradually approached 100%, showing a higher fitting ability. But the overall error is still greater than the third-order derivative method. The third-order derivative fitting method of this product performs best in the entire concentration range, with a recovery rate close to 100% and a minimum error range (98.8% ± 3.1% to 99.2% ± 2.2%). This method can take into account the quantitative accuracy of low-concentration and high-concentration samples at the same time, effectively overcome the shortcomings of traditional fitting methods in trace detection, and perform well in repeatability. It can be seen that the third-order derivative method shows excellent sensitivity and accuracy in the low concentration range (0.0625–0.25pg / μl). Compared with traditional methods, the error is reduced by more than 20%, which improves the detection accuracy of trace RNase. By analyzing the data in the key concentration range of 0.0625–1pg / μl, it can be confirmed that this method can maintain high precision and stability (RSD <3%), which is particularly suitable for application scenarios requiring high sensitivity. Therefore, the fitting curve R of the third-order derivative method 2 >0.995, which is significantly better than two-parameter and four-parameter fitting, providing a reliable basis for further promotion of this technology.

[0153] Table 12. Method reproducibility evaluation

[0154]

[0155] *Note: Data range is from comprehensive evaluation of three concentration levels (low, medium, and high) (n=20)

[0156] To verify the accuracy of the method, we used high performance liquid chromatography (HPLC) as a control method to perform parallel tests on 33 samples. The HPLC method uses a C18 reverse phase column and a fluorescence detector to detect RNase hydrolysis products. This method has the characteristics of high accuracy and good repeatability and can be used as a reliable reference method.

[0157] Table 13. Correlation analysis with HPLC method (n=33)

[0158] Deviation range Two-parameter linear fitting Four parameter fitting This product's third-order derivative method <10％ 45.5％(15 / 33) 63.6％(21 / 33) 87.9％(29 / 33) 10-20％ 18.2％(6 / 33) 24.2％(8 / 33) 12.1％(4 / 33) >20％ 36.4％(12 / 33) 12.1％(4 / 33) 0％(0 / 33)

[0159] Through systematic comparison with the HPLC method, we found that the traditional two-parameter linear fitting method has significant deviations in sample detection, especially in the high concentration area. More than 36% of the sample test results deviate from the HPLC method by more than 20%. This systematic error seriously affects the reliability of the test results. In contrast, the third-order derivative method used in this product shows excellent accuracy, and 87.9% of the samples have deviations from the HPLC method within 10%, which fully confirms the reliability of this method.

[0160] These data fully demonstrate the limitations of existing technologies in practical applications and verify the innovative value of this product in methodology. In particular, this product demonstrates obvious technical advantages when dealing with high-concentration samples and testing scenarios requiring high precision.

[0161] In summary, the present invention improves the molecular stability and detection sensitivity of the probe by screening and optimizing the stem region length, GC content, free energy and melting temperature, loop region sequence, thermodynamic parameters and adapting the fluorescent and quenching groups, and finally obtains a fluorescent RNA probe with the sequence: 5'-FAM-CGCUCUCACUGUAUUGAGAGCG-TAMRA-3'. At the same time, the present invention also develops a detection method and a fluorescent detection kit based on the probe, adopts a dual-wavelength ratio detection strategy, a kinetic continuous detection mode, a third-order derivative standard curve fitting algorithm and other means, and can ultimately improve the accuracy, reliability, stability and specificity of RNAse A enzyme detection, and has pioneering clinical application value and broad market prospects.

[0162] In terms of technical effects, the design of the hairpin structure probe reduces background fluorescence by more than 15%, increases the signal-to-noise ratio by 2-2.5 times, and increases the detection sensitivity by 1.8 times. The optimization of the detection method, especially the introduction of the dual-wavelength ratio method, reduces environmental interference by more than 60%, significantly improving the repeatability of the detection. The innovative third-order derivative fitting method expands the detection range to 0-4pg / μl, greatly improving the practicality of the detection.

[0163] This kit is not only suitable for the detection of various sample types, but also easy to operate, short detection time, good reagent stability, and mild storage conditions. These advantages make it have significant technical innovation and broad application prospects in the field of RNase activity detection, providing a more reliable and practical solution for RNase activity detection.

[0164] After the preferred embodiments are described in detail, those familiar with the technology can clearly understand that various changes and modifications can be made without departing from the scope and spirit of the above patent application, and any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention are within the scope of the technical solution of the present invention. The present invention is not limited to the example implementation methods given in the specification.

Claims

1. A fluorescent RNA probe based on a hairpin structure, characterized in that: The sequence of the probe is shown in SEQ ID NO.

1.

2. The fluorescent RNA probe according to claim 1, characterized in that The 5' end of the fluorescent RNA probe is a fluorescent group, and the 3' end is a quenching group; Preferably, the fluorescent group includes: any one of FAM, HEX, TET, and ROX; Preferably, the quenching group includes any one of TAMRA, DABCYL, BHQ1, BHQ2, and TAMRA; Preferably, the fluorescent group is FAM, and the quenching group is TAMRA.

3. Use of the fluorescent RNA probe as claimed in claim 1 or 2 in the preparation of a fluorescence detection kit.

4. A kit, characterized in that: The kit comprises the fluorescent RNA probe according to claim 1 or 2; Preferably, the kit further comprises RNaseA standard and reaction buffer.

5. A detection method, characterized in that: The method adopts the fluorescent RNA probe described in claim 1 or 2 or the kit described in claim 4.

6. The detection method according to claim 5, characterized in that: The detection method adopts a dual-wavelength ratio detection strategy; Preferably, the dual-wavelength ratio detection uses 528 nm as the excitation wavelength and 560 nm as the reference wavelength.

7. The method according to claim 5 or 6, characterized in that: The method includes a preheating equilibrium step; Preferably, the preheating time is 3-10 minutes; the preheating equilibrium is stable at 37±0.2°C; Preferably, the preheating time is 5 minutes.

8. The method according to any one of claims 5 to 7, characterized in that: The method adopts a kinetic continuous monitoring mode; Preferably, the total detection time of the kinetic continuous monitoring mode is 20-40 minutes, and the sampling interval is set to 50-70 seconds; Preferably, the total detection time is 30 minutes, and the sampling interval is set to 60 seconds.

9. The method according to any one of claims 5 to 8, characterized in that: The method adopts a third-order derivative standard curve fitting algorithm to fit and analyze the standard curve; Preferably, the third-order derivative standard curve fitting algorithm adopts the following mathematical model: y=ax 3 +bx 2 +cx+d Among them, a is the coefficient of the cubic term; b is the coefficient of the square term; c is the coefficient of the linear term; and d is the constant term.

10. A detection method, characterized in that: The steps include: (1) Sample preparation: adding a standard or a sample to be tested to a reaction buffer, and then adding a fluorescent substrate probe working solution containing the fluorescent substrate probe according to claim 1 or 2; (2) ELISA: The test was performed using a preheated ELISA reader with a preheating time of 5 min and a stable preheating equilibrium of 37 ± 0.2 °C. Among them, the fluorescence detection adopts a dual-wavelength detection strategy, with 528nm as the excitation wavelength and 560nm reference signal collected at the same time; the kinetic detection adopts a continuous monitoring mode, with a total detection time of 30 minutes and a sampling interval of 1 minute; (3) Data processing: The third-order derivative standard curve fitting was used to fit and analyze the standard curve.

Images