Aptamer of c-MET protein and application thereof

Abstract

The invention discloses a nucleic acid aptamer of c-MET protein and application of the nucleic acid aptamer, and belongs to the technical field of biology, the nucleic acid aptamer has a nucleotide sequence shown as METtym-4 or METtym-5, and the nucleic acid aptamer is obtained through an in-vitro screening SELEX (systematic evolution of ligands by exponential enrichment) technology. The nucleic acid aptamer is small in molecular weight, easy to synthesize and modify, stable in property and high in c-MET protein affinity, and the binding dissociation constant is smaller than 50 nM. The nucleic acid aptamer disclosed by the invention is suitable for purifying and detecting the c-MET protein and preparing a medicine for targeting the c-MET protein, has a wide application prospect, and is beneficial to development of products for detecting or purifying the c-MET protein or treatment of c-MET related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer of a c-MET protein and an application thereof. Background Art

[0002] Mesenchymal-epithelial transition factor (c-MET) is a multifunctional transmembrane tyrosine kinase belonging to the receptor tyrosine kinase (RTKs) family. It is the only known receptor for hepatocyte growth factor (HGF), so it is also called hepatocyte growth factor receptor (HGFR). After c-MET protein binds to its ligand hepatocyte growth factor (HGF), it activates multiple important signaling pathways. The activation of these signaling pathways further regulates cell growth, movement, and proliferation, and plays a vital role in embryonic development, tissue repair, wound healing, and organ homeostasis. Abnormal expression of c-MET protein can lead to abnormally active signal transduction, promote tumor growth, angiogenesis, and cancer metastasis. Abnormal expression of this protein has been detected in many types of malignant tumors, including liver cancer, lung cancer, colon cancer, breast cancer, pancreatic cancer, ovarian cancer, prostate cancer, and gastric cancer. Therefore, it is necessary to develop technologies for the identification and intervention of c-MET protein.

[0003] DNA is composed of four standard deoxynucleosides, each of which has a unique base, namely adenine (A), thymine (T), cytosine (C), and guanine (G). These four standard bases constitute the genetic code of life. In addition to the four standard bases, there are also a variety of natural base modifications in the genomes of viruses, prokaryotes, and eukaryotes. These modifications play an important role in the stability of genetic information, gene expression regulation, and adaptation to environmental changes in organisms. For example, 2,6-diaminopurine (Z) can replace the A base in traditional DNA. Compared with normal DNA, DNA in which Z completely replaces A has a higher melting temperature, stronger bending stiffness, longer persistence length, and shorter static contour length.

[0004] Aptamer, also known as nucleic acid aptamer, is a single-stranded oligonucleotide fragment that can specifically bind to a specific target molecule. It is screened by the in vitro screening technology SELEX (systematic evolution of ligands by exponential enrichment). Aptamer has strict recognition ability and high affinity for the ligand that can be bound. The recognition mechanism of nucleic acid aptamer is similar to that of protein antibody. It can be chemically synthesized in vitro and is called "chemical antibody". The binding dissociation constant of nucleic acid aptamer can reach nanomolar and picomolar levels, which is equivalent to monoclonal antibody. It can bind to a wide range of target molecules, including small molecules, ions, proteins, cells and tissues. Compared with traditional monoclonal antibodies, nucleic acid aptamer has better thermal stability, smaller molecular weight, can be chemically synthesized, small batch differences, and easy to modify. Nucleic acid aptamer can be used to prepare biosensors, diagnostic or therapeutic drugs, etc., and shows great potential in the fields of protein recognition and intervention, drug development, disease diagnosis and treatment.

[0005] Although some nucleic acid aptamers targeting c-MET protein have been developed in the prior art, such as the Chinese patent document with publication number CN117165593A discloses nucleic acid aptamers that recognize and bind to c-MET protein and their applications, the Chinese patent document with publication number CN116121255A discloses a nucleic acid aptamer that binds to HGFR protein and its application, and the Chinese patent document with publication number CN117778399A discloses the construction and application of a bispecific nucleic acid aptamer targeting c-MET, but the methods in the above inventions are all conventional cell screening methods, which are complicated to operate and time-consuming. In order to explore and discover more c-MET protein-related drugs, it is necessary to develop new nucleic acid aptamers that specifically target c-MET protein. Summary of the invention

[0006] In view of the deficiencies in the above-mentioned prior art, the present invention provides a nucleic acid aptamer of c-MET protein, which has a strong affinity with c-MET protein, is obtained by directly performing protein screening after base replacement, has a small molecular weight, and is easy to synthesize and modify.

[0007] The specific technical solutions adopted are as follows:

[0008] A nucleic acid aptamer for c-MET protein, wherein the nucleic acid aptamer has a nucleotide sequence shown in METtym-4 or METtym-5;

[0009] METtym-4 (SEQ ID NO.1):

[0010] TATGTGCGTCTGCCTCTTGCCCCC A GTGCTCGGT A G A C ATGT A GG A TGC A T A CTGGGTGCATAGGAGTCACGACGACCAG;

[0011] METtym-5 (SEQ ID NO.2):

[0012] TATGTGCGTCTGCCTCTTGCCCTCTCGTTGGGC A GCTGT A CC A G CGCTGTG A GGC A TG A GTATAGGAGTCACGACGACCAG;

[0013] Underlined nucleotides indicate that the nucleotide is 2-amino modified.

[0014] A modified with 2-amino group can be recorded as Z, and its corresponding nucleoside (2,6-diaminopurine) has the following structural formula:

[0015]

[0016] Optionally, the nucleic acid aptamer is a single-stranded METtym-4 or METtym-5 nucleic acid aptamer, or a circular single-stranded METtym-4 or METtym-5 nucleic acid aptamer obtained by cyclization treatment of the single-stranded METtym-4 or METtym-5 nucleic acid aptamer.

[0017] The present invention designs and synthesizes a random library and corresponding primers based on the in vitro screening technology SELEX technology, and directly performs protein screening after base replacement to screen nucleic acid aptamers with small molecular weight, stable chemical properties and high affinity binding to c-MET protein.

[0018] Optionally, the nucleotide sequence of the nucleic acid aptamer contains a marker.

[0019] Furthermore, the marker is an isotope marker, a biotin marker, a chemiluminescent marker, a fluorescent marker or an enzyme marker.

[0020] The present invention also provides the use of the nucleic acid aptamer in preparing a product for capturing and purifying c-MET protein.

[0021] The present invention also provides the use of the nucleic acid aptamer in preparing a product for in vitro detection of c-MET protein.

[0022] The present invention also provides the use of the nucleic acid aptamer in preparing a drug targeting c-MET protein.

[0023] The present invention also provides a product for detecting or purifying c-MET protein, and the product comprises the nucleic acid aptamer.

[0024] Furthermore, the products include but are not limited to test kits, biosensors, and detection chips.

[0025] The present invention also provides a drug targeting c-MET protein, which contains the nucleic acid aptamer.

[0026] The present invention also provides a method for screening nucleic acid aptamers of c-MET protein, comprising the following steps:

[0027] (1) Synthesizing random single-stranded DNA library and primers;

[0028] (2) Magnetic bead screening: Perform at least 2 rounds of counter-screening and screening, and replace ATCG in PCRMix with ZTCG (Z is 2-amino-modified A) in the second round of PCR amplification system.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] (1) The present invention obtains a nucleic acid aptamer that specifically targets the c-MET protein through in vitro screening technology. The nucleic acid aptamer has a high affinity for the c-MET protein, and the binding dissociation constant is less than 50nM. In addition, the nucleic acid aptamer has the advantages of small molecular weight, stable properties, good reproducibility, and low synthesis cost, which is helpful for exploring and discovering more c-MET protein-related drugs.

[0031] (2) In the process of screening nucleic acid aptamers specifically targeting c-MET protein, the present invention directly performs protein screening after base replacement, which reduces the number of screening rounds, is simple to operate, and saves time. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The protein flow cytometry diagrams of three rounds of screening;

[0033] Figure 2 The results of protein affinity tests of different samples are shown in Figure 1, where (a) is the single-stranded nucleic acid aptamer of METtym-4 and METtym-5, and (b) is the single-stranded nucleic acid aptamer of cycle-METtym-4 and cycle-METtym-5;

[0034] Figure 3Flow cytometry graphs showing the binding of METtym-4, METtym-5, cycle-METtym-4, cycle-METtym-5 to MNK-45 cells, HCT-8 cells and K562 cells. DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with the examples and accompanying drawings. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods of the following examples that do not specify specific conditions are usually performed under normal conditions or under conditions recommended by the manufacturer. The content that is not described in detail in this specification sheet belongs to the prior art known to professionals in the field. The experimental materials used in the following examples, if not otherwise specified, can be purchased by conventional biochemical reagent companies.

[0036] Example 1

[0037] The screening method of the nucleic acid aptamer containing 2,6-diaminopurine (written as Z, i.e., 2-amino-modified A) targeting the c-MET protein is as follows:

[0038] c-MET protein was used as the target protein, and a random library with 20 bp fixed sequences at both ends and 40 bp random sequences in the middle was used as the initial library for SELEX screening to screen nucleic acid aptamers containing the Z base.

[0039] (1) Solution preparation

[0040] Buffer A: 1.88 g glycine + 1.46 g sodium chloride + 50 ml ddH2O;

[0041] Buffer B: 0.68 g sodium acetate trihydrate + 1.46 g sodium chloride + 50 ml ddH2O;

[0042] Wash Buffer: 2.5 ml 1 mM magnesium chloride solution + 50 μL Tween 80 + 50 ml DPBS;

[0043] Binding Buffer: 20μL HsDNA (5mg / ml) + 100μL BSA (10mg / ml) + 880μL WB;

[0044] (2) Protein screening

[0045] When screening nucleic acid aptamers, the nucleic acid library and primers used are designed as follows:

[0046] Random nucleic acid library (LibYM):

[0047] TATGTGCGTCTGCCTCTTGCNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNATAGGAGTCACGACGACCAG;

[0048] Upstream primer (SEQ ID NO.3): 5'-FAM-TATGTGCGTCTGCCTCTTGC-3'; Downstream primer (SEQ ID NO.4): 5'-biotin-CTGGTCGTCGTGACTCCTAT-3';

[0049] Among them, N represents any random base among A, T, C and G.

[0050] (2.1) First round of screening

[0051] 1) Library denaturation: Add 100 μL DPBS to the original library LibYM, incubate at 95°C for 5 minutes, then incubate on ice for 5 minutes, and finally incubate at room temperature for 15 minutes to complete the denaturation of the library.

[0052] 2) Take 10 μg of protein-coupled sugar beads in a 1.5 ml centrifuge tube, wash twice with 100 μL Wash Buffer, centrifuge, and remove the supernatant.

[0053] 3) Put all the denatured libraries into the above centrifuge tube, add 100 μL Bingding Buffer and mix well, incubate at room temperature for 60 minutes, shake once every 5 minutes, centrifuge and remove the supernatant.

[0054] 4) Add 100 μL Wash Buffer and mix well, remove the Wash Buffer by passing through a pre-prepared column, and wash twice with 100 μL Wash Buffer.

[0055] 5) Elution was performed with 160 μL ddH2O to recover the screened protein-coupled sugar beads.

[0056] 6) PCR amplification.

[0057] a) PCR1: 160 μL recovery sugar beads + 40 μL 5×Mix (ATCG), annealing temperature was set to 59°C, cycle number was 8, and PCR1 was marked as R1-PCR1.

[0058] b) Cycle number optimization PCR2: 3μL PCR1 product + 10μL 5×Mix (ATCG) + 37μL ddH2O, divided into 5 tubes, 10μL in each tube. Set the temperature range to the optimal annealing temperature, the cycle number to 8-16, with an interval of 2 cycles, and observe the bands of the nucleic acid denaturing gel to confirm the optimal cycle number.

[0059] c) PCR3: PCR3 was performed under the optimized conditions (PCR3 system: 40 μL PCR1 product + 100 μL 5×Mix (ATCG) + 360 μL ddH2O, 100 μL per tube, PCR3 was labeled as R1-PCR3.

[0060] 7) Preparation of ssDNA

[0061] a) Add 70 μL of streptavidin agarose bead suspension into an empty prefabricated column and filter the liquid under pressure to dry the beads on the top of the filter cartridge.

[0062] b) Wash the column twice with 100 μL DPBS.

[0063] c) The solution obtained from PCR3 was passed through the prefabricated column twice repeatedly.

[0064] d) Wash twice with DPBS, 100 μL each time.

[0065] e) Rinse the preformed column with 100 μL of 200 mM NaOH solution (containing 200 mM NaCl), and collect the eluate.

[0066] f) Desalting with NAP-5 desalting column (GE Healthcare, UK), pre-wash the desalting column with deionized water (not less than 15 mL).

[0067] g) Add 100 μL of eluate to the column.

[0068] h) After all the fluid has entered the column, add 400 μL of ultrapure water.

[0069] i) After all the DNA has entered the column, add 600 μL of ultrapure water to elute the ssDNA (keep the desalting column moist).

[0070] j) Use a 1.5 mL EP tube to collect the effluent, the volume is about 600 μL.

[0071] k) Use NanoDrop to measure the product concentration according to OD 260 The single-stranded DNA yield was calculated.

[0072] l) Vacuum dry at 55℃ and freeze at -20℃.

[0073] m) The prepared single-stranded DNA is labeled as R1-ssDNA for use in the next round of screening.

[0074] (2.2) Second round of screening

[0075] 8) The single-chain DNA obtained in the first round was dissolved in DPBS and renatured.

[0076] 9) Take 8 μg of protein-coupled sugar beads in a 1.5 ml centrifuge tube, wash twice with 100 μL Wash Buffer, centrifuge, and remove the supernatant.

[0077] 10) Add 60 pmol of the single-stranded protein from 8) into the above centrifuge tube, add 200 μL of Bingding Buffer to make up the mixture, incubate at room temperature for 40 minutes, shake every 5 minutes, centrifuge, and remove the supernatant.

[0078] 11) The above product was passed through a prefabricated column, washed three times with 100 μL Wash Buffer, centrifuged, and the supernatant was removed.

[0079] 12) Elute with 160 μL ddH2O to recover the screened protein-coupled sugar beads.

[0080] 13) Repeat steps 6)-7) of the first round of screening, replace 5×Mix (ATCG) with 5×Mix (ZTCG), label PCR1 product R2-PCR1, PCR3 product R2-PCR2, and single-stranded R2-ssDNA.

[0081] (2.3) Third round of screening

[0082] 14) The single-chain DNA obtained in the first round was dissolved in DPBS and renatured.

[0083] 15) Take 3 μg of the reverse screening protein in a 1.5 ml centrifuge tube, add 50 pmol of R2-ssDNA, and then add 200 μL of BingdingBuffer to make up and mix well. Incubate at room temperature for 30 minutes, shake once every 5 minutes, centrifuge, and recover the supernatant.

[0084] 16) Take 6 μg of protein-coupled sugar beads and put them into a new 1.5 ml centrifuge tube. Wash them twice with 100 μL Wash Buffer, centrifuge and remove the supernatant.

[0085] 17) Add the supernatant recovery solution of 15) to the above centrifuge tube, mix well, incubate at room temperature for 30 minutes, shake once every 5 minutes, centrifuge, and remove the supernatant.

[0086] 18) The above product was passed through a pre-prepared column, washed 4 times with 100 μL Wash Buffer, centrifuged, and the supernatant was removed.

[0087] 19) Elute with 160 μL ddH2O to recover the screened protein-coupled sugar beads.

[0088] 20) Repeat steps 6)-7) of the first round of screening, replace 5×Mix (ATCG) with 5×Mix (ZTCG), label PCR1 product R3-PCR1, PCR3 product R3-PCR2, and single-stranded R3-ssDNA.

[0089] Through screening, an enriched library of Z-containing bases (A modified with 2-amino group) that can bind to the target c-MET protein was selected as nucleic acid aptamer candidates.

[0090] (3) Protein flow cytometry analysis

[0091] 1) Library preparation: The prepared single-stranded DNA library nucleic acid aptamer candidates were heated to 95°C for 5 min, cooled on ice for 5 min, and renatured at room temperature for 15 min for use.

[0092] 2) Take 3 μg of c-MET protein-coupled sugar beads and wash them twice with Wash Buffer, add Binding Buffer to make up to 200 μL, mix well, and divide equally into 5 tubes.

[0093] 3) Add 10 pmol of the single strands obtained in the first, second and third rounds to tubes 1-3 respectively, add 10 pmol of the negative control to tube 4, and keep tube 5 as a blank control. Incubate at room temperature for 30 min in a volume of 50 μL.

[0094] 4) Wash twice with 200 μL Wash Buffer and resuspend in 150 μL Wash Buffer.

[0095] 5) Flow cytometry: experimental data were processed using FlowJo software.

[0096] Analysis of screening results: The present invention uses c-MET protein as a positive screening protein and EGF protein as a counter screening protein, and uses flow cytometry to monitor the binding of the library obtained during the screening process. Figure 1 As shown in the figure, as the screening pressure increases, the binding of the enriched single-stranded library to the target protein c-MET gradually becomes stronger. Therefore, we selected the single-stranded DNA library obtained in the second and third rounds of screening.

[0097] After protein flow cytometry comparison, METtym-4 and METtym-5 had the most obvious displacement and high binding affinity with proteins, so these two nucleic acid aptamers were selected for subsequent experiments. The nucleotide sequences of METtym-4 and METtym-5 are as follows:

[0098] METtym-4 (SEQ ID NO.1):

[0099] TATGTGCGTCTGCCTCTTGCCCCC A GTGCTCGGTA G A C A TGT A GG A TGC A T A CTGGGTGCATAGGAGTCACGACGACCAG;

[0100] METtym-5 (SEQ ID NO.2):

[0101] TATGTGCGTCTGCCTCTTGCCCTCTCGTTGGGC A GCTGT A CC A G CGCTGTG A GGC A TG A GTATAGGAGTCACGACGACCAG;

[0102] Underlined nucleotides indicate that the nucleotide is 2-amino modified.

[0103] 6) Cyclization: Take 70 pmol of the screened METtym-4 or METtym-5, add 4 μL Buffer and 1 μL PNK enzyme, and react at 37°C for 1 h; add 1 μL LK-C (SEQ ID NO.5: GCAAGAGGCAGACGCACATACTGGTCGTCGTGACTCCTAT), react at 95°C for 5 min, and anneal at 70°C-25°C; add 1 μL T4 enzyme, react at 37°C for 16 h; finally, add 1 μL exonuclease I and III, react at 37°C for 3 h, and 80°C for 10 min.

[0104] (4) Aptamer affinity determination

[0105] The affinity of the screened aptamers METtym-4 and METtym-5 to c-MET protein was characterized. Figure 2 As shown in (a), their apparent equilibrium dissociation constants (Kd values) were 18.5 nM and 37.3 nM, respectively, indicating that they have strong affinity with the target protein. The affinity of cycle-METtym-4 and cycle-METtym-5 obtained by cyclization of nucleic acid aptamers METtym-4 and METtym-5 was characterized, as shown in Figure 2. Figure 2 As shown in (b), their apparent equilibrium dissociation constants (Kd values) were detected to be 21.7 nM and 32.3 nM, respectively. The lines of different colors in the figure represent different dilution concentrations.

[0106] (5) Binding of nucleic acid aptamers to different cell lines

[0107] Based on the enrichment of high-throughput sequencing, we obtained potential aptamer sequences. We determined their binding to different cells by flow cytometry. Figure 3 As shown, METtym-4 and METtym-5 have strong displacement with the MNK-45 cell line, indicating that they are potential nucleic acid aptamers. However, these four sequences bind weakly to HCT-8 cells and have no binding to K562 cells. This indicates that the aptamers METtym-4 and METtym-5 obtained by screening are nucleic acid aptamers that can specifically recognize c-MET protein.

[0108] The embodiments described above provide a detailed description of the technical solutions of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A nucleic acid aptamer for c-MET protein, characterized in that: The nucleic acid aptamer has a nucleotide sequence shown in METtym-4 or METtym-5; METtym-4: TATGTGCGTCTGCCTCTTGCCCCC A GTGCTCGGT A G A C A TGT A G G A TGC A T A CTGGGTGCATAGGAGTCACGACGACCAG; METtym-5: TATGTGCGTCTGCCTCTTGCCCTCTCGTTGGGC A GCTGT A CC A G CGCTGTG A GGC A TG A GTATAGGAGTCACGACGACCAG; Underlined nucleotides indicate that the nucleotide is 2-amino modified.

2. The nucleic acid aptamer according to claim 1, characterized in that The nucleotide sequence of the nucleic acid aptamer contains a marker.

3. The nucleic acid aptamer according to claim 2, characterized in that The marker is an isotope marker, a biotin marker, a chemiluminescent marker, a fluorescent marker or an enzyme marker.

4. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in preparing a product for capturing and purifying c-MET protein.

5. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in preparing a product for in vitro detection of c-MET protein.

6. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a drug targeting c-MET protein.

7. A product for detecting or purifying c-MET protein, characterized in that: The method comprises the nucleic acid aptamer according to any one of claims 1 to 3.

8. The product according to claim 7, characterized in that The products include test kits, biosensors or detection chips.

9. A drug targeting c-MET protein, characterized in that: The method comprises the nucleic acid aptamer according to any one of claims 1 to 3.

Images