Zmssiiib-1 gene for regulating total starch content of corn and dCAPS molecular marker thereof

By developing the dCAPS molecular marker and genetic engineering regulation of the ZmSSIIIb-1 gene, the complexity and inaccuracy of corn starch content identification have been solved, enabling rapid screening of corn varieties with high starch content and promoting corn germplasm improvement and breeding.

CN119709779BActive Publication Date: 2025-12-09SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411949289.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-27
Publication Date
2025-12-09
Estimated Expiration
2044-12-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate identification and regulation of corn starch content. Traditional methods are complex, time-consuming, and costly, while molecular marker technologies are not effective at the molecular genomic level.

Method used

By identifying significant variant sites in the ZmSSIIIb-1 gene, dCAPS molecular markers were developed. PCR amplification and restriction endonuclease digestion were used to identify corn starch content. Combined with genetic engineering methods, overexpression or knockout of the ZmSSIIIb-1 gene was used to regulate the total starch content of corn.

Benefits of technology

It enables rapid, efficient, and accurate screening of maize varieties with high starch content, providing new genetic resources and breeding directions, and promoting maize germplasm improvement and breeding progress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709779B_ABST
    Figure CN119709779B_ABST
Patent Text Reader

Abstract

The application discloses a ZmSSIIIb-1 gene for regulating total corn starch content and a dCAPS molecular marker thereof, belongs to the field of crop molecular genetic breeding, and obtains the ZmSSIIIb-1 gene with a significant variation site through excavation, wherein the nucleotide sequence is shown as SEQ ID NO. 1, and the regulation of the total corn starch content is realized through overexpression or knockout of the ZmSSIIIb-1 gene, thereby providing a new gene resource for corn germplasm improvement; secondly, the dCAPS molecular marker for identifying high and low starch content corn varieties is designed based on the significant variation site of the ZmSSIIIb-1 gene, and the sequences are respectively shown as SEQ ID NO. 19 and SEQ ID NO. 20; the dCAPS molecular marker can efficiently and accurately identify the high and low starch content in the corn varieties, and promotes the corn breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of crop molecular genetic breeding, and particularly relates to a ZmSSIIIb-1 gene for regulating total starch content of corn and a dCAPS molecular marker thereof. BACKGROUND

[0002] As one of the most important food crops in the world, the total starch content of corn is a key factor affecting yield and quality. 70% of the weight of corn kernels comes from starch, which is not only the main source of energy for humans and other animals, but also an important raw material for the chemical industry. Therefore, increasing the starch content of corn has important economic value and social benefits. With the clarification of the synthesis pathway and encoding genes of corn starch, more and more research has focused on the mining and analysis of starch synthesis regulatory genes. Researching and screening starch synthesis regulatory genes is of great significance for improving corn quality.

[0003] CN114149999A discloses a corn starch synthesis regulatory gene ZmSSP1 and its application. Overexpression of the gene can increase the starch content of corn kernels and the thousand-grain weight of kernels, while knockout of the gene can reduce the starch content of corn kernels and the thousand-grain weight of kernels, indicating that the ZmSSP1 gene has a positive regulatory effect on starch expression, providing a new theory for analyzing the regulation pathway of corn kernel starch.

[0004] Secondly, traditional methods for determining the starch content of corn mainly rely on chemical analysis and physical testing. Although these methods can provide accurate results to some extent, they also have some obvious disadvantages, such as complex operation, long time-consuming, high cost, etc. In contrast, molecular marker technology analyzes at the molecular genomic level, which can quickly, efficiently, and accurately identify certain traits and is not affected by the environment. Molecular markers have high polymorphism, many markers exhibit co-dominance, can distinguish homozygous and heterozygous genotypes, and provide complete genetic information. Molecular markers can also be used for predicting key genes and significant SNPs that regulate corn starch content through genome-wide association analysis (GWAS) and QTL mapping. In addition, DNA samples used for molecular markers can be stored for a long time under certain conditions, and have strong traceability and arbitrariness. Therefore, screening and identifying corn starch synthesis regulatory genes, mining significant variation sites, and developing target molecular markers are of great significance for breeding high-starch corn varieties and promoting the progress of corn molecular breeding. SUMMARY

[0005] In view of the prior art, the application provides a ZmSSIIIb-1 gene for regulating total starch content of corn and a dCAPS molecular marker thereof, overexpression or knockout of the ZmSSIIIb-1 gene realizes regulation of the total starch content of corn, and provides a new genetic resource for germplasm improvement of corn; secondly, a significant variation site of the ZmSSIIIb-1 gene is mined, and a dCAPS molecular marker for identifying the starch content of corn is developed, the marker can effectively identify the high and low starch content of corn, and can be used for assisted marker selection breeding of corn to screen high-starch quality corn varieties.

[0006] In order to achieve the above-mentioned purpose, the application adopts the following technical solutions:

[0007] In a first aspect, the application provides a ZmSSIIIb-1 gene for regulating total starch content of corn; the ZmSSIIIb-1 gene is a nucleic acid molecule as shown in a) or b) below:

[0008] a) the nucleotide sequence is a nucleic acid molecule as shown in SEQ ID NO. 1;

[0009] b) a nucleic acid molecule having more than 90% identity with the nucleotide sequence of a) and expressing the same functional protein.

[0010] Further, the ZmSSIIIb-1 gene is obtained by extracting corn kernel RNA and reverse transcribing into cDNA, taking the cDNA as a template, and performing PCR cloning with ZmSSIIIb-1-PCR-F and ZmSSIIIb-1-PCR-R as primers; wherein the ZmSSIIIb-1-PCR-F and ZmSSIIIb-1-PCR-R primer sequences are as follows:

[0011] ZmSSIIIb-1-PCR-F: 5'-ATGGAGATGAATCTCCGGGCGG-3'(SEQ ID NO. 2);

[0012] ZmSSIIIb-1-PCR-R: 5'-TCAGTTTTTGCGAGCAGAATGG-3'(SEQ ID NO. 3).

[0013] Further, the significant variation site of the ZmSSIIIb-1 gene is a missense variation of G(C) to A(T) on an exon.

[0014] In a second aspect, the application provides a method for regulating total starch content of corn by the above-mentioned ZmSSIIIb-1 gene, comprising:

[0015] 1) constructing a ZmSSIIIb-1 gene overexpression vector, introducing the overexpression vector into the target maize to obtain a ZmSSIIIb-1 gene overexpression plant; or:

[0016] 2) constructing a ZmSSIIIb-1 gene knockout vector, introducing the knockout vector into the target maize to obtain a ZmSSIIIb-1 gene knockout plant.

[0017] Further, the starch content of the ZmSSIIIb-1 gene overexpression plant is higher than that of the target maize; and the starch content of the ZmSSIIIb-1 gene knockout plant is lower than that of the target maize.

[0018] Further, in the above method, the method for introducing the ZmSSIIIb-1 gene into the target maize comprises an Agrobacterium-mediated method, a polyethylene glycol method or a gene gun bombardment method.

[0019] In a third aspect of the present application, the above ZmSSIIIb-1 gene, the recombinant expression vector for overexpressing or knocking out the ZmSSIIIb-1 gene, the transgenic cell line or the genetically engineered bacteria are applied in any one of the following 1) or 2):

[0020] 1) plant breeding;

[0021] 2) regulating the starch content of plants.

[0022] In the above application, the plant is preferably maize.

[0023] In a fourth aspect of the present application, a dCAPS molecular marker for identifying the starch content of maize based on the significant variation site of the above ZmSSIIIb-1 gene is provided, the dCAPS molecular marker sequence of the high-starch-content maize variety is shown as SEQ ID NO. 19, and the dCAPS molecular marker sequence of the low-starch-content maize variety is shown as SEQ ID NO. 20.

[0024] Further, the specific primer sequence of the dCAPS molecular marker is as follows:

[0025] dCAPS-XbaI-F: 5'-ATCAGAGAATGTTCTTGAGGTCTAG-3' (SEQ ID NO. 21);

[0026] dCAPS-XbaI-R: 5'-TAATACACAGGGCTATTAGCAGGAG-3' (SEQ ID NO. 22).

[0027] In a fifth aspect of the present application, a method for identifying the starch content of maize by using the above dCAPS molecular marker is provided, which comprises the following specific steps:

[0028] 1) Extracting corn genomic DNA;

[0029] 2) Using the genomic DNA extracted in step 1) as a template, performing PCR amplification with dCAPS-Xba I-F and dCAPS-Xba I-R described above;

[0030] 3) Using restriction endonuclease Xba I to perform enzyme digestion on the PCR amplification product obtained in step 2), and performing gel electrophoresis on the enzyme digestion product;

[0031] 4) Identifying the electrophoresis result of step 3): the PCR product of the corn variety with high starch content can be cut open by Xba I, and presents two bands with sizes of 281 bp and 256 bp; the PCR product of the corn variety with low starch content cannot be cut open by Xba I, and only one band with a size of 281 bp.

[0032] Further, the enzyme digestion temperature in step 3) is 37℃, and the time is 14-16 min.

[0033] Beneficial effects:

[0034] (1) The present application screens and clones the corn total starch related response gene ZmSSIIIb-1 gene through systematic research, and transfers the gene into corn through the Agrobacterium-mediated method, and analysis shows that the corn starch content of the overexpressed ZmSSIIIb-1 gene is obviously improved, which provides a new direction and excellent gene resource for the germplasm improvement of corn, and provides a research basis for cultivating excellent new germplasm of corn with high starch content.

[0035] (2) The present application provides a dCAPS molecular marker for identifying the starch content of corn based on the significant variation site of the ZmSSIIIb-1 gene, which can quickly, efficiently and accurately screen the corn variety with high starch content in a natural population, effectively save costs, and promote the breeding process of corn. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 It is a diagram for analyzing the starch content of corn B73 and Mo17; wherein ** represents a significant level of P<0.01;

[0037] Figure 2 It is a diagram for the chromosomal distribution of the starch content related QTL of the corn IBM population in multiple environments and BLUP; wherein 1-9 represents the 1st-9th chromosomes; 2020XSBN, 2021CZ, 2021YA and 2021XSBN respectively represent the 2020 Xishuangbanna, 2021 Chongzhou, 2021 Ya'an and 2021 Xishuangbanna environments; and STA represents the starch content;

[0038] Figure 3 Figure 8 is a Manhattan plot of significant SNPs affecting starch content detected in four environments and BLUP, wherein a is a Manhattan plot of SNPs significantly associated with total starch content; b is a Q-Q plot of SNPs significantly associated with total starch content;

[0039] Figure 4 Figure 9 is a plot of ZmSSIIIb-1 candidate gene association analysis, wherein a is a variant site significantly associated with starch content, wherein the red horizontal line represents the threshold value (P = 3.01) of ZmSSIIIb-1 association analysis, the black dotted line represents the position of significant variation, and the significant variation above the threshold value is marked with an enlarged dot; b is LD between SNPs; c-f are, in turn, comparative analysis of total starch content of materials containing allelic variation C and allelic variation T in 2021CZ, 2021YA, 2021XSBN, and BLUP, and ** represents significant difference at P < 0.01;

[0040] Figure 5 Figure 10 is a map of the overexpression vector pEGOEPubi-ZmSSIIIb-1;

[0041] Figure 6 Figure 11 is a map of the knockout vector pEGOsCas9Pubi-ZmSSIIIb-1;

[0042] Figure 7 Figure 12 is a positive detection result of ZmSSIIIb-1-OE strain, wherein a is a PCR electrophoretogram of the overexpression strain; b is a comparison chart of relative expression levels in the overexpression strain ZmSSIIIb-1-OE and B104;

[0043] Figure 8 Figure 13 is a plot of gene structure and target positive detection sequencing results of ZmSSIIIb-1-KO strain, a is a schematic diagram of ZmSSIIIb-1 gene structure; b-c respectively represent the sequencing peak chart and sequence schematic diagram of ZmSSIIIb-1-KO#1, ZmSSIIIb-1-KO#2, and ZmSSIIIb-1-KO#3 knockout materials;

[0044] Figure 9Figure 1 is a chloroplast morphological structure of mesophyll cells of B104, ZmSSIIIb-l-OE and ZmSSIIIb-l-KO materials; wherein (a-c), (g-i) and (m-o) represent the panoramic view of chloroplasts of mesophyll cells of B104, ZmSSIIIb-l-OE, ZmSSIIIb-l-KO at 6DAP, 12DAP and 18DAP, respectively, with a scale of 10 μm; (d-f), (j-l) and (p-r) represent the enlarged view of chloroplasts of mesophyll cells of B104, ZmSSIIIb-l-OE, ZmSSIIIb-l-KO at 6DAP, 12DAP and 18DAP, respectively, with a scale of 2 μm; wherein M represents chloroplast of mesophyll cells, and SG represents starch granule;

[0045] Figure 10 Figure 2 is a chloroplast morphological structure of bundle sheath of B104, ZmSSIIIb-l-OE and ZmSSIIIb-l-KO materials; wherein (a-c), (g-i) and (m-o) represent the panoramic view of chloroplasts of mesophyll cells of B104, ZmSSIIIb-l-OE, ZmSSIIIb-l-KO at 6DAP, 12DAP and 18DAP, respectively, with a scale of 10 μm; (d-f), (j-l) and (p-r) represent the enlarged view of chloroplasts of mesophyll cells of B104, ZmSSIIIb-l-OE, ZmSSIIIb-l-KO at 6DAP, 12DAP and 18DAP, respectively, with a scale of 2 μm; BS represents bundle sheath cells, and SG represents starch granule;

[0046] Figure 11 Figure 3 is a comparison chart of starch content of leaves of ZmSSIIIb-l-OE, ZmSSIIIb-l-KO and B104 materials at 15DAP; wherein ** represents P<0.01;

[0047] Figure 12 Figure 4 is a starch granule observation of grains of ZmSSIIIb-l-OE, ZmSSIIIb-l-KO and B104 materials at 16DAP; wherein a, c and e represent the panoramic view of starch granules of grains of B104, ZmSSIIIb-l-OE and ZmSSIIIb-l-KO, respectively; wherein b, d and f represent the enlarged view of starch granules of grains of B104, ZmSSIIIb-l-OE and ZmSSIIIb-l-KO, respectively; with a scale of 200 μm;

[0048] Figure 13Figure 4 is a comparison chart of the phenotype, 100-grain weight and starch content of mature kernels of ZmSSIIIb-1 -OE, ZmSSIIIb-1 -KO and B104; wherein a-c are respectively a comparison chart of the phenotype, 100-grain weight and starch content of mature kernels of B104, ZmSSIIIb-1 -OE, ZmSSIIIb-1 -KO; wherein ** represents P<0.01, and * represents P<0.05;

[0049] Figure 14 Figure 5 is a comparison chart of the kernel length of mature kernels of ZmSSIIIb-1 -OE, ZmSSIIIb-1 -KO and B104; wherein a and b are the 10-kernel length of mature kernels of B104, ZmSSIIIb-1 -OE and ZmSSIIIb-1 -KO; c and d are the kernel width; e and f are the kernel thickness; wherein ** and * respectively represent P<0.01 and P<0.05;

[0050] Figure 15 Figure 6 is an electrophoresis chart of genomic PCR amplification of extracted population materials; wherein lanes 1-6 are elite maize varieties with high starch content; lanes 7-12 are non-elite maize varieties with low starch content;

[0051] Figure 16 Figure 7 is an electrophoresis chart of PCR product digestion; wherein lanes 1-6 are elite maize varieties with high starch content; lanes 7-12 are non-elite maize varieties with low starch content. DETAILED DESCRIPTION

[0052] The technical solutions in the embodiments of the present application will be clearly and completely described below in conjunction with the contents in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0053] Example 1: Mining of ZmSSIIIb-1 gene for regulating total starch content of maize

[0054] The starch content of two parents B73 and Mo17 of the maize IBM population was measured, and the results showed that the total starch content of B73 was significantly higher than that of Mo17 Figure 1 , indicating that the IBM population is suitable for analyzing the genetic basis of total starch content.

[0055] Firstly, the CIM method in Windows QTL Cartographer was used to perform linkage analysis on the phenotypes and BLUP values of the maize genetic map and IBM population constructed by the predecessors (Liu H, Niu Y, Gonzalez-Portilla PJ, et al. An Ultra-High-Density Map as a Community Resource for Discerning the Genetic Basis of Quantitative Traits in Maize [J]. BMC genomics, 2015, 16(1): 1-16.) in four environments (2020 Xishuangbanna, 2021 Chongzhou, 2021 Ya'an, 2021 Xishuangbanna environment), and 22 QTLs controlling total starch content were detected Figure 2 ). Then, the FarmCPU model in rMVP was used to perform whole-genome association analysis on the filtered 969,439 high-quality markers and the phenotypic values and BLUP values of starch content in four environments, and a total of 72 significant SNPs associated with total starch content were detected Figure 3 . By searching for genes within the 220 kb segment flanking the co-localized genetic loci of the B73 and Mo17 populations, a total of 32 candidate genes affecting total starch synthesis were identified; KEGG gene function enrichment analysis method was used to analyze the function of the candidate genes, and a total of 9 genes involved in starch synthesis were detected. Candidate gene association analysis was performed on the above 9 important candidate genes, and further analysis of whether the variation sites within the candidate genes would affect starch content showed that there was a significant variation site in the ZmSSIIIb-1 gene, which significantly affected starch content. The annotation of the variation was a missense variation from G(C) to A(T) on the exon, which caused the 977th amino acid to change from serine (Ser: AGT) to glycine (Gly: GGT) Figure 4 ). The nucleotide sequence of the ZmSSIIIb-1 gene is shown in SEQ ID NO. 1.

[0056] Example 2 Cloning of ZmSSIIIb-1 gene

[0057] The corn B73 grains were taken 18 days after pollination, and the RNA of the grains was extracted by Guangzhou Meiji Biological Plant Total RNA Extraction Kit. The extracted RNA was reversely transcribed into cDNA by using the All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) reverse transcription kit of Suzhou Jinan Protein Company. The specific operation steps are shown in the kit instruction. The cDNA was used as a template to perform PCR reaction by using Phanta Max Super-Fidelity DNA Polymerase, and the PCR amplification product was obtained.

[0058] The primer sequence is:

[0059] ZmSSIIIb-1-PCR-F: 5'-ATGGAGATGAATCTCCGGGCGG-3' (SEQ ID NO. 2);

[0060] ZmSSIIIb-1-PCR-R: 5'-TCAGTTTTTGCGAGCAGAATGG-3' (SEQ ID NO. 3);

[0061] The PCR amplification system (50 μL) was as follows: Phanta Max Super-Fidelity DNA Polymerase 1 μL, dNTP 1 μL, buffer 25 μL, forward primer ZmSSIIIb-1-PCR-F 2 μL, reverse primer ZmSSIIIb-1-PCR-R 2 μL, cDNA 1 μL, and ddH2O 18 μL.

[0062] The PCR amplification program was as follows: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s; 60 ℃ annealing for 15 s; 72 ℃ extension for 4 min; 32 cycles; 72 ℃ recombination for 5 min; and 12 ℃ preservation.

[0063] 8 μL of the PCR product was taken and subjected to 2% polyacrylamide gel electrophoresis for 30 min. The amplified target band was 3576 bp in size, and the target band was recovered. The purified product was sent to Beijing Qikang Biological Technology Co., Ltd. for sequencing. The sequence of the target gene sample was compared and saved after the sequence was correct.

[0064] Example 3 Construction of overexpression vector pEGOEPubi-ZmSSIIIb-1 and knockout vector pEGOsCas9Pubi-ZmSSIIIb-1

[0065] The method of homologous recombination was used to link the target gene fragment obtained in Example 2 and the linearized vector pEGOEPubi-B-HIS by using the 2xUniclone Seamless Cloning Mix homologous recombination enzyme of Jinsha Biology based on the vector pEGOEPubi-B-HIS, to construct the overexpression pEGOEPubi-ZmSSIIIb-1 recombinant vector, and the recombinant vector construction map is shown in Figure 5 .

[0066] The connection system is as follows: linearized vector 2 μL, target gene fragment 2 μL, 2xUniclone Seamless Cloning Mix 5 μL, ddH2O 1 μL; reaction procedure: 50°C for 1 h, 12°C storage.

[0067] The connected recombinant vector plasmid was heat-shocked to transform the DH5a E. coli competent cells, and plated at 37°C for overnight culture. When the colonies grew, a single colony was picked and colony PCR was performed using primers Transgene-F and Transgene-R. If the band size was 3678 bp, it was positive. The bacterial solution was sent to Beijing Qikong Biological Technology Co., Ltd. for sequencing, and the plasmid was extracted from the strain with correct sequencing using the Guangzhou Meiji Biological Plasmid Extraction Kit to obtain the pEGOEPubi-ZmSSIIIb-1 recombinant plasmid.

[0068] The primer sequences are as follows:

[0069] Transgene-F: 5'-ATATGTGGATTTTTTTAGCCCT-3' (SEQ ID NO. 4);

[0070] Transgene-R: 5'-GTTTTTGCGAGCAGAATGGTAC-3' (SEQ ID NO. 5);

[0071] The PCR amplification system is (25 μL): 2xRapid Taq Master Mix 12.5 μL, forward primer Transgene-F 1 μL, reverse primer Transgene-R 1 μL, the above bacterial solution template 1 μL, ddH2O 9.5 μL;

[0072] The PCR amplification procedure is: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 60 s, 34x cycles, 72°C extension for 5 min, 12°C storage.

[0073] (2) Construction of knock-out vector pEGOsCas9Pubi-ZmSSIIIb-1

[0074] The knockout vector pEGOsCas9Pubi-ZmSSIIIb-1 was constructed by CRISPR-Cas9 technology. First, sgRNA (target 1, target 2, target 3) was designed using the E-CRISR (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) website, and then sgRNA was cloned into the plasmid vector expressing Cas9 protein based on the pEGOEPubi-B-HIS vector to construct the knockout vector pEGOsCas9Pubi-ZmSSIIIb-1. The recombinant vector map is shown in Figure 6 The sequence information of sgRNA is as follows:

[0075] Target 1: AGCGTTGCCTTCCGCGTCCATGG (SEQ ID NO. 6);

[0076] Target 2: AACGTCGGACTCACTAGCTAAGG (SEQ ID NO. 7);

[0077] Target 3: CAGGGCACAAGCAAGGTCTGAGG (SEQ ID NO. 8);

[0078] The ligated knockout recombinant vector plasmid was heat-shocked to transform DH5a E. coli competent cells, and plated at 37°C overnight culture. When the colonies grew, single colonies were picked and colony PCR was performed using detection primers SP-F and SP-R. If the PCR amplification band size is about 1800 bp, it is identified as positive, and the bacterial liquid is sent to Beijing Qikong Biotechnology Co., Ltd. for sequencing. The plasmid was extracted from the strain with correct sequencing using the Guangzhou Meiji Biological Plasmid Extraction Kit to obtain the pEGOsCas9Pubi-ZmSSIIIb-1 recombinant plasmid.

[0079] The primer sequences are as follows:

[0080] SP-F: 5'-GCGGTGTCATCTATGTTACTAG-3' (SEQ ID NO. 9);

[0081] SP-R: 5'-TGCAATAACTTCGTATAGGC-3' (SEQ ID NO. 10);

[0082] The PCR amplification system (25 μL) was as follows: 2 x Rapid Taq Master Mix 12.5 μL, forward primer SP-F 1 μL, reverse primer SP-R 1 μL, the above bacterial liquid template 1 μL, and ddH2O 9.5 μL;

[0083] PCR amplification procedure: 95℃ pre-denaturation 3 min, 95℃ denaturation 15 s, 55℃ annealing 15 s, 72℃ extension 40 s, cycle 34 x, 72℃ extension 5 min, 12℃ preservation.

[0084] Example 4 Agrobacterium-mediated transformation of pEGOEPubi-ZmSSIIIb-1, pEGOsCas9Pubi-ZmSSIIIb-1 recombinant vectors in maize

[0085] 1. Introduction of recombinant vector

[0086] (1) Introduction of pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 recombinant vectors

[0087] S1 pick up the pre-activated Agrobacterium EHA105 monoclonal colonies in 3 mL YEP liquid medium containing 50 mg / L rifampicin resistance, 28℃, 200 r / min overnight culture;

[0088] S2 take 1 mL of the overnight culture to 50 mL YEP medium, 28℃, 200 r / min culture to OD 600 0.5;

[0089] S3 The above bacterial solution was divided into 50 mL centrifuge tubes and ice-bathed for 30 min, then centrifuged at 5000 r / min, 4℃ for 5 min, the supernatant was discarded and the bacterial pellet was resuspended with pre-cooled 100 mM CaCl2 solution, the resuspension was divided into 1.5 mL centrifuge tubes, glycerol was added, and the sample was quickly frozen with liquid nitrogen and stored at -80℃ for later use;

[0090] S4 Take 6 μL of pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 recombinant plasmids prepared in Example 3 and add them to the prepared Agrobacterium competent cells, ice-bath for 5 min, put into liquid nitrogen for 5 min, 37℃ heat shock for 5 min, add 1 mL of YEP liquid medium without antibiotics, and recover at 28℃ for 3 h;

[0091] S4 After recovery, centrifuge at 4500 r / min for 2 min, discard 800 μL of supernatant, resuspend the remaining bacterial cells, and spread on the previously prepared YEP solid medium containing 50 mg / L Kan and Rif resistance, and incubate at 28℃ for 48 h;

[0092] S5 respectively pick pEGOEPubi-ZmSSIIIb-1 and pEGOsCas9Pubi-ZmSSIIIb-1 group plate in single colony colony in YEP culture containing Kan and Rif resistance after colony PCR amplification, finally take PCR product for polyacrylamide gel electrophoresis to screen the colonies. If the overexpression colony PCR product band size is 3678bp, it is identified as positive; if the knockout colony PCR product band size is about 1800bp, it is identified as positive;

[0093] Overexpression colony PCR amplification system (25 μL): 2 x Rapid Taq Master Mix 12.5 μL, forward primer Transgene-F 1 μL, reverse primer Transgene-R 1 μL, the above bacterial liquid template 1 μL, ddH2O 9.5 μL;

[0094] PCR amplification program: 95℃ pre-denaturation 3min, 95℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 60s, cycle 34 x, 72℃ extension 5min, 12℃ preservation;

[0095] Knockout colony PCR amplification system (25 μL): 2 x Rapid Taq Master Mix 12.5 μL, forward primer SP-F 1 μL, reverse primer SP-R 1 μL, the above bacterial liquid template 1 μL, ddH2O 9.5 μL;

[0096] PCR amplification program: 95℃ pre-denaturation 3min, 95℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 40s, cycle 34 x, 72℃ extension 5min, 12℃ preservation;

[0097] S6 culture and expansion of the overexpression and knockout positive colonies screened in the previous step, 28℃ culture for 4h, 200r / min to OD 600 =0.6, aliquot into 10mL sterile centrifuge tube, 3000r / min centrifugation for 10min, discard the supernatant, add equal amount of AS (100mg / L) containing infection liquid and resuspend for standby, obtain pEGOEPubi-ZmSSIIIb-1 infection liquid and pEGOsCas9Pubi-ZmSSIIIb-1 infection liquid.

[0098] The above infection liquid formula is as follows: N6+2,4-D 1.5mg / L+inositol 120mg / L+L-proline 0.69g / L+hydrolyzed casein 100mg / L+sucrose 68.5g / L+glucose 30g / L+acetyl-syringone 100umol / L, pH 5.2;

[0099] N6 formula: Potassium nitrate 2800 mg / L + Ammonium sulfate 463 mg / L + Potassium dihydrogen phosphate 400 mg / L + Magnesium sulfate (MgSO4·7H2O) 185 mg / L + Calcium chloride (CaCl2·2H2O) 165 mg / L + Disodium ethylenediaminetetraacetate 37.3 mg / L + Ferrous sulfate (FeSO4·7H2O) 27.8 mg / L + Manganese sulfate (MnSO4·H2O) 4.4 mg / L + Zinc sulfate (ZnSO4·7H2O) 1.5 mg / L + Boric acid 1.6 mg / L + Potassium iodide 0.8 mg / L + Vitamin B1 (thiamine hydrochloride) 1.0 mg / L + Vitamin B6 (pyridoxal hydrochloride) 0.5 mg / L + Niacin 0.5 mg / L + Glycine 2.0 mg / L, pH 5.8.

[0100] (2) Agrobacterium infection transformation of maize young embryos and seedling transplantation

[0101] S1 Take the female ear of inbred wild type B104 about 13 days after pollination, pick up the young embryo of about 1.5 mm after detoxification treatment and place it on the prepared co-culture medium for use;

[0102] S2 Drop the above-mentioned prepared pEGOEPubi-ZmSSIIIb-1 infection liquid and pEGOsCas9Pubi-ZmSSIIIb-1 infection liquid on the young embryo respectively, slightly shake to make the infection liquid fully contact with the young embryo, absorb the remaining infection liquid with filter paper after dark culture for 15 min, and place it in the co-culture medium at 22°C for dark culture for 3 days;

[0103] S3 Pick up the young embryo without growing bacteria and growing normally and place it in the recovery medium at 28°C for dark culture for 7 days, and the recovery culture can be carried out 2-3 times according to the growth of the young embryo;

[0104] S4 Transfer the callus after recovery culture to the screening medium containing 2 mg / L glyphosate, dark culture at 28°C for 20 days, pick up the surviving resistant callus and retransfer it to the screening medium containing 3 mg / L and 5 mg / L glyphosate, dark culture at 28°C for 20 days.

[0105] S5 Transfer the well-grown resistant callus after screening to the differentiation medium, culture the callus in the dark at 28°C for 7 days, and then transfer it to the environment of 28°C, dark alternation (light for 16 h, dark culture for 8 h) for culture for 20 days.

[0106] S6 When the regenerated seedlings and roots are observed to be about 2-3 cm long, separate the callus, and transfer the seedlings to the rooting and seedling strengthening medium for culture and observation;

[0107] S7 After the seedlings grow at least 3 roots and the root length exceeds 15 cm, sterile water containing nystatin is added to the bottle to prevent bacterial contamination and water evaporation. The seedlings are transplanted to the prepared pots after 6 days of culture. When the seedlings grow to two true leaves and one heart leaf, they are transplanted to the greenhouse, covered with mulch, and managed in the field. The T0 generation of overexpression and knockout transgenic seeds are harvested by self-pollination.

[0108] The medium formula used in the above steps is as follows:

[0109] Basic culture: N6 + sucrose 30 g / L + agar 7 g / L;

[0110] Subculture medium: basic medium + 2,4-D 1.5 mg / L + inositol 120 mg / L + L-proline 0.69 g / L + hydrolyzed casein 100 mg / L + mannitol 20 g / L;

[0111] Co-culture medium: subculture medium + acetyl-syringone 100 umol / L + cysteine 400 mg / L + silver nitrate 0.85 mg / L;

[0112] Recovery medium: subculture medium + silver nitrate 0.85 mg / L + MES 0.5 g / L + cephalosporin 250 mg / L;

[0113] Screening medium: subculture medium + silver nitrate 0.85 mg / L + cephalosporin 250 mg / L + glyphosate (2, 3, 5 mg / L);

[0114] Differentiation medium: basic medium + KT 1 mg / L + hydrolyzed casein 250 mg / L + L-proline 0.69 g / L;

[0115] Rooting and seedling strengthening medium: 1 / 2MS basic medium + ABT rooting powder 0.5 mg / L + hydrolyzed casein 30 mg / L + sucrose 2% + agar 0.6%.

[0116] Example 5 Positive detection of T0 generation overexpression and knockout transgenic lines

[0117] (1) Genomic DNA extraction: After the above overexpression and knockout T0 generation transgenic seeds and wild type B104 are grown, a suitable amount of leaves are taken and the genomic DNA in the corn leaves is extracted using the SLS method. The specific steps are as follows:

[0118] S1 Take a suitable amount of young corn leaves of overexpression lines, knockout lines and wild type B104, respectively, cut them into 2 mL tubes, add steel balls, freeze in liquid nitrogen, and grind thoroughly with a tissue sampler for 2 times (45 hz / min, 1 min each time);

[0119] S2 Add 800 μL SLS extraction solution to the above ground 2 mL tube, invert mix 3 min;

[0120] S3 Add 800 μL phenol: chloroform: isopropyl alcohol (25:24:1) mixture (after sealing, take the lower layer) to the 2 mL tube, invert mix 3 min;

[0121] S4 Put into the centrifuge to balance centrifugation, 12000 r / min, 10 min;

[0122] S5 Take 600 μL supernatant into a 1.5 mL centrifuge tube, add an equal volume of pre-cooled isopropyl alcohol, invert mix 5 min, precipitate DNA;

[0123] S6 Put into the centrifuge to balance centrifugation, 12000 r / min, 5 min;

[0124] S7 Pour off the supernatant, wash the precipitate with 75% ethanol, pour off the washing liquid, wash the precipitate again with anhydrous ethanol, dry at room temperature;

[0125] S8 After complete drying, add 50 μL ddH2O, dissolve the DNA precipitate, take 1 μL genomic DNA for electrophoresis to detect its quality, reserve for future use.

[0126] (2) Positive identification of overexpression strain: The genomic DNA of the above extracted overexpression strain was positively detected, and after PCR amplification, the overexpression strain could amplify a fragment of 3678 bp in size (a). Figure 7 a).

[0127] To further verify the accuracy of the positive result, qRT-PCR quantitative analysis was performed on the overexpression strain and wild type B104, and the leaves of the overexpression strain and wild type B104 were taken for RNA extraction and reverse transcription of cDNA (the kit used in this process is the same as in Example 2), and RT-qPCR analysis was performed with cDNA as template, if the expression amount of ZmSSIIIb-1 gene in the overexpression strain is higher than that in the wild type B104 (b), it is determined that the strain is positive ZmSSIIIb-1-OE. Figure 7 b).

[0128] PCR amplification system (25 μL): 2 × Rapid Taq Master Mix 12.5 μL, forward primer Transgene-F 1 μL, reverse primer Transgene-R 1 μL, above genomic DNA 1 μL, ddH2O 9.5 μL;

[0129] PCR amplification procedure: 95℃ pre-denaturation 3 min, 95℃ denaturation 15 s, 55℃ annealing 15 s, 72℃ extension 60 s, cycle 34 x, 72℃ extension 5 min, 12℃ preservation;

[0130] qRT-PCR experimental group system (20 μL): 2 x NovoStart SYBR qPCR SuperMix Plus (Low ROX Premixed) 10 μL, Transgene-qPCR-F 1.5 μL, Transgene-qPCR-R 1.5 μL, cDNA template 2 μL, RNase Free Water 5 μL;

[0131] qRT-PCR control group system (20 μL): 2 x NovoStart SYBR qPCR SuperMix Plus (Low ROX Premixed) 10 μL, Actin-F 1.5 μL, Actin-R 1.5 μL, cDNA template 2 μL, RNase Free Water 5 μL;

[0132] The reaction program is: 95℃ denaturation 1 min; 95℃ annealing 10 s, 60℃ reaction 30 s, cycle 40 times.

[0133] Table 1 Positive detection primer sequences of ZmSSIIIb-1-OE strain

[0134]

[0135]

[0136] (3) Knockout strain positive identification: The genomic DNA of the knockout strain extracted above is subjected to positive detection, and after PCR amplification, the target 1 PCR of the knockout strain can amplify a band with a size of 377 bp, and the target 2 and 3 PCR can amplify a band with a size of 791 bp. The PCR product of the target detection correct knockout strain is gel recovered and purified and sent to Beijing Qikong Biotechnology Co., Ltd. for sequencing. If there is an insertion or deletion of nucleotides at the editing target site, such as Figure 8 , it is determined that the strain is a knockout positive plant ZmSSIIIb-1-KO.

[0137] Target 1 detection PCR amplification system (25 μL): 2 x Rapid Taq Master Mix 12.5 μL, forward primer QC1-F 1 μL, reverse primer QC1-R 1 μL, genomic DNA 1 μL, ddH2O 9.5 μL;

[0138] PCR amplification procedure: 95℃ pre-denaturation 3 min, 95℃ denaturation 15 s, 55℃ annealing 15 s, 72℃ extension 15 s, cycle 34 x, 72℃ extension 5 min, 12℃ preservation.

[0139] Target 2, 3 detection PCR amplification system (25 μL): 2 x Rapid Taq Master Mix 12.5 μL, forward primer QC23-F 1 μL, reverse primer QC23-R 1 μL, genomic DNA 1 μL, ddH2O 9.5 μL;

[0140] PCR amplification procedure: 95℃ pre-denaturation 3 min, 95℃ denaturation 15 s, 55℃ annealing 15 s, 72℃ extension 20 s, cycle 34 x, 72℃ extension 5 min, 12℃ preservation.

[0141] Table 2 Positive detection primer sequences of ZmSSIIIb-1-KO strain

[0142] Primer name Sequence (5'-3') QC1-F CAGAGCAGGAACAATGAAGGTG (SEQ ID NO. 15) QC1-R TTGAACTGCCATGTTCCTCAGA (SEQ ID NO. 16) QC23-F TCTGAAGATGATCCAGAAGTGCT (SEQ ID NO. 17) QC23-R TCTACATACCACCAATCGCCTTC (SEQ ID NO. 18)

[0143] Example 6 Phenotype identification of transgenic maize strain

[0144] (1) Maize chloroplast starch content detection

[0145] The wild type B104, overexpression ZmSSIIIb-1-OE and knockout ZmSSIIIb-1-KO maize materials were respectively taken from self-pollination, and the lens electron microscope observation was carried out on 6DAP, 12DAP and 18DAP ear leaves, as shown in Figure 9 , the chloroplast cell structure and size of mesophyll cell chloroplast of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 did not change obviously at the three sampling periods; as shown in Figure 10 , the size and number of starch granules in the vascular sheath chloroplast of the above three materials had obvious differences, and the size and number of starch granules in ZmSSIIIb-1-OE were significantly higher than those in the other two materials.

[0146] In order to further verify the accuracy of the analysis results of transmission electron microscope, the ear leaves of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 at 15DAP 17:00 were taken, and starch content was measured by using the reagent kit Total Starch Assay Kit of Megazyme company, as shown in Figure 11 , the results showed that the starch content of ZmSSIIIb-1-OE ear leaf was significantly higher than that of the other two materials.

[0147] (2) Maize starch granule number detection

[0148] SEM observation of the self-pollinated 16DAP kernels of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and wild type B104 was performed, as shown in FIG. 2, it was found that the number of starch granules of ZmSSIIIb-1-OE was more than that of the other two materials, and the number of starch granules of ZmSSIIIb-1-KO was less than that of B104, but there was no significant difference in the size of the starch granules. Figure 12

[0149] (3) Size, 100-grain weight and starch content of mature corn kernels

[0150] The size, 100-grain weight and starch content of mature kernels of ZmSSIIIb-1-OE, ZmSSIIIb-1-KO and B104 corn lines were measured, and the kernel phenotype was also investigated, as shown in FIG. 3, it can be seen that the size, 100-grain weight and starch content, and kernel length of ZmSSIIIb-1-KO were higher than those of the other two materials, and the results showed that the overexpression and knockout of ZmSSIIIb-1 affected the starch content of corn kernels, and also caused different degrees of changes in the kernel type of corn kernels, and mainly affected the kernel length. Figure 13 14

[0151] Example 7 Development of dCAPS molecular marker for identifying high and low starch content of corn

[0152] (1) Development of dCAPS molecular marker:

[0153] Based on Example 1, a significant variation site on the coding region exon of ZmSSIIIb-1 gene was located by candidate gene association analysis, which was annotated as a missense variation of G(C) to A(T) on the exon, and the variation caused the 977th amino acid to change from serine (Ser: AGT) to glycine (Gly: GGT). The variation site was converted into a dCAPS molecular marker by using the principle of dCAPS molecular marker.

[0154] The dCAPS molecular marker sequence of the corn variety with high starch content in the natural population is shown below (SEQ ID NO. 19), and the nucleotide polymorphism is A:

[0155] ATCAGAGAATGTTCTTGAGGGCAAG A ​​​GTGCTGCAAAAAAGGCATTGCAGCAGATGCTTGGATTACAGCAAACTGATAGCCCTGTTGTTGGAATCATCACTCGTCTAACAGTGCAGAAGGGAATCCACCTTATCAAACATGCAATGCATCGAGCTCTTGAACGCAATGGGCAGGTCTTATCTTTTTCTTGCTCAGGAATTGCAAGTTTGTTATGTTTCATCCACACTATGTTCATATTTCTCAGAACTGATGTGTGTGTGTTTCTACATTAGGTGGTTTTAC; wherein the underlined is the significant variation site.

[0156] The sequence of the dCAPS molecular marker of the low starch content corn variety in the natural population is shown below (SEQ ID NO. 20), and the nucleotide polymorphism is G:

[0157] ATCAGAGAATGTTCTTGAGGGCAAG G GTGCTGCAAAAAAGGCATTGCAGCAGATGCTTGGATTACAGCAAACTGATAGCCCTGTTGTTGGAATCATCACTCGTCTAACAGTGCAGAAGGGAATCCACCTTATCAAACATGCAATGCATCGAGCTCTTGAACGCAATGGGCAGGTCTTATCTTTTTCTTGCTCAGGAATTGCAAGTTTGTTATGTTTCATCCACACTATGTTCATATTTCTCAGAACTGATGTGTGTGTGTTTCTACATTAGGTGGTTTTAC; wherein the underlined is the significant variation site.

[0158] (2) Design of specific primer pairs of dCAPS molecular markers

[0159] 1. The forward primer dCAPS-XbaI-F was designed by using the online enzyme cutting recognition system website dCAPS Finder 2.0 (https: / / helix.wustl.edu / dcaps / ), and the reverse primer dCAPS-XbaI-R was designed by using SnapGene software at the same time, and the specific primer sequences are as follows:

[0160] dCAPS-XbaI-F: 5'-ATCAGAGAATGTTCTTGAGG T C TAG-3' (SEQ ID NO. 21), wherein the underlined is the designed mismatched base;

[0161] dCAPS-Xba I-R: 5'-TAATACACAGGGCTATTAGCAGGAG-3' (SEQ ID NO. 22), reverse primer without mismatch.

[0162] 2. The suitable restriction enzyme Xba I was screened according to the dCAPS Finder 2.0 website, and the Xba I recognition enzyme cutting sequence was TCTAGA.

[0163] Example 8 Verification of screening of dCAPS molecular marker for corn starch content

[0164] 1. Natural population material genome preparation

[0165] The applicant used the SLS method to extract the genomic DNA in the leaves of the excellent haplotype corn variety with high starch content and the non-excellent haplotype corn variety with low starch content in the natural population, and the corn materials used in the above test were preserved in the Corn Institute of Sichuan Agricultural University, and the specific extraction steps were the same as the genomic DNA extraction method in the corn leaves in Example 5.

[0166] 2. The specific primers dCAPS-Xba I-F and dCAPS-Xba I-R designed in Example 7 were used to perform PCR amplification on the above extracted genomic DNA, and the PCR products were obtained, and the amplification system and procedure were as follows:

[0167] PCR amplification system (25 μL): 2 x Rapid Taq Master Mix 12.5 μL, forward primer dCAPS-Xba I-F 1 μL, reverse primer dCAPS-Xba I-R 1 μL, above genomic DNA template 1 μL, ddH2O 9.5 μL;

[0168] PCR amplification procedure: 95°C pre-denaturation 3 min, 95°C denaturation 15 s, 55°C annealing 15 s, 72°C extension 45 s, cycle 34 x, 72°C extension 5 min, 4°C cooling preservation.

[0169] 3. 2 μL of the PCR product was subjected to 2% polyacrylamide gel electrophoresis for 45 min, as shown in Figure 15 , the amplification band was single and the size was 281 bp, proving that the primer pair has good specificity.

[0170] 4. The above PCR product was subjected to enzyme cutting using the restriction enzyme Xba I screened in Example 7, and the enzyme cutting product was obtained;

[0171] The enzyme cutting system is (10 μL): 10x QuickCut Green buffer 1 μL, PCR amplification product 2.5 μL, Xba I enzyme 0.3 μL, ddH2O 6.2 μL; the enzyme cutting procedure is: 37 DEG C enzyme cutting 15 min, 4 DEG C storage.

[0172] 5. 4 μL PCR product is taken and subjected to 2% polyacrylamide gel electrophoresis for 45 min.

[0173] The results show that: Figure 16 It can be seen that lanes 1-6 are excellent haploid corn varieties (AA type) with high starch content, which can be cut by Xba I enzyme, and by controlling the enzyme cutting time, the PCR product is ensured to be incompletely cut, so there are two bands, one is 281 bp, and the other is 256 bp, which can more directly identify the results; lanes 7-12 are non-excellent haploid corn varieties (GG type) with low starch content, which cannot be cut by Xba I enzyme, and there is only one band with a size of 281 bp; the obtained enzyme cutting electrophoresis result is consistent with the phenotype screening result, which confirms the reliable identification of the dCAPS molecular marker.

[0174] In conclusion, the application provides the gene ZmSSIIIb-1 for regulating the total starch content of corn and the dCAPS molecular marker thereof, the screening of the ZmSSIIIb-1 gene provides a new direction and gene resource for the germplasm improvement of corn, the dCAPS molecular marker can effectively identify the high and low starch content of corn, can be used for the assisted marker selection breeding of corn, and promotes the breeding process of corn.

Claims

1. A method for identifying corn starch content using a dCAPS molecular marker, characterized in that, The method comprises the following specific steps: 1) extracting corn genomic DNA; 2) using the genomic DNA extracted in step 1) as a template, performing PCR amplification with primers dCAPS-XbaI-F and dCAPS-XbaI-R; the dCAPS-XbaI-F is 5'-ATCAGAGAATGTTCTTGAGGTCTAG-3' (SEQ ID NO. 21); the dCAPS-XbaI-R is 5'-TAATACACAGGGCTATTAGCAGGAG-3' (SEQ ID NO. 22); 3) performing enzyme cutting on the PCR amplification product obtained in step 2) with a restriction enzyme XbaI, and performing gel electrophoresis on the enzyme cutting product; 4) identifying the electrophoresis result of step 3): the PCR product of a corn variety with high starch content can be cut open by XbaI, and presents two bands with sizes of 281 bp and 256 bp; the PCR product of a corn variety with low starch content cannot be cut open by XbaI, and only one band with a size of 281 bp is present.

2. The method of claim 1, wherein, The enzyme cutting temperature in step 3) is 37°C, and the time is 14-16 min.