Application of soybean C2H2 type zinc finger transcription factor gene GmRGR1
By overexpressing the soybean C2H2 type zinc finger transcription factor GmRGR1 in Arabidopsis thaliana, it was found that it has transcriptional repression activity in leaves and seeds, reducing chlorophyll content. This solved the technical problem of regulating soybean chlorophyll content and provided a theoretical basis for improving soybean photosynthetic efficiency and yield.
Patent Information
- Application Number
- CN202411799597.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-09
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-12-09
AI Technical Summary
The biological function of the soybean C2H2 type zinc finger transcription factor GmRGR1, especially its effect on chlorophyll content, has not been clearly defined in the existing technology, which makes it impossible to improve the photosynthetic efficiency and yield of soybeans by regulating this gene.
By overexpressing the soybean C2H2 type zinc finger transcription factor gene GmRGR1 in Arabidopsis thaliana through genetic engineering, it was found that it is mainly expressed in soybean leaves and seeds, and secondarily in flowers and pods. It is located in the cell nucleus and cytoplasm, has transcriptional repressive activity, and leads to a decrease in chlorophyll content in Arabidopsis thaliana.
This study demonstrated that regulating the expression of the GmRGR1 gene can reduce the chlorophyll content of Arabidopsis thaliana, providing a basis for increasing the chlorophyll content of soybean and laying a theoretical foundation for improving the photosynthetic efficiency and yield of soybean.
Smart Images

Figure CN119709830B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the application of soybean C2H2-type zinc finger transcription factor gene GmRGR1 and belongs to the field of genetic engineering. BACKGROUND
[0002] Soybean is an important economic and food crop that supplies humans with abundant oil and protein. Photosynthesis is the food source for almost all life on Earth. For plants themselves, the organic matter synthesized by photosynthesis, such as glucose and starch, is the material basis for their growth, development, and reproduction. Chlorophyll, as the key pigment for photosynthesis in plants, can absorb light energy and convert it into chemical energy to drive a series of reactions of photosynthesis. The chlorophyll content in soybean leaves directly affects the efficiency of light energy absorption, and high chlorophyll content can capture more light energy, providing a more abundant energy source for photosynthesis. When the chlorophyll content of soybean increases, the efficiency of the light reaction of photosynthesis usually increases, and more chlorophyll molecules can absorb more photons, promoting the electron transfer of photosystem I and photosystem II, thereby generating more ATP (adenosine triphosphate) and NADPH (reduced coenzyme II). High chlorophyll content is beneficial to the growth and development of soybean plants, and sufficient chlorophyll can provide more energy and nutrients to promote root growth and development and enhance the plant's ability to absorb water and nutrients. At the same time, leaves with high chlorophyll content can carry out more efficient photosynthesis, synthesizing more organic matter to provide a sufficient material basis for soybean growth, which helps to increase the biomass of soybean, including the growth of stems, leaves, flowers, and pods.
[0003] GmRGR1 encodes a soybean C2H2-type zinc finger transcription factor, and the core of the C2H2-type zinc finger transcription factor is the C2H2 zinc finger domain. The domain is composed of a specific amino acid sequence, in which two cysteines (Cys) and two histidines (His) are combined with a zinc ion to form a stable finger structure. Usually containing multiple such zinc finger domains can enhance the binding ability and specificity to DNA. In terms of function, C2H2-type zinc finger transcription factors play a key role in the regulation of gene expression. They can accurately recognize and bind to specific DNA sequences, regulate the transcriptional activity of target genes, and can activate or inhibit gene expression, thereby participating in numerous biological processes. For example, a part of C2H2-type zinc finger transcription factors regulate cell division, differentiation, and organ formation during plant growth and development. A part of C2H2-type zinc finger transcription factors can sense adverse environmental signals such as drought, high salt, and low temperature when responding to environmental stress, and increase the stress resistance of plants by regulating the expression of related genes. ZFP179 in rice contains two typical C2H2 zinc finger domains, and under salt stress, the gene can increase the salt tolerance of plants through three mechanisms: ABA-dependent pathway, ABA-independent pathway, and ROS scavenging system. In ZFP179 overexpression transgenic rice plants, some salt tolerance-related genes in the ABA-dependent pathway are up-regulated, and the proline content is increased; some specific genes in the ABA-independent pathway are up-regulated; and it can also increase the ROS scavenging activity of plant cells and reduce oxidative stress. However, it is unpredictable what function a C2H2-type zinc finger transcription factor with an unidentified biological function has. We found that overexpression of the gene can reduce the chlorophyll content of Arabidopsis thaliana. This discovery of the function lays a foundation for mutating the gene in soybeans to increase chlorophyll content and thus increase yield. SUMMARY
[0004] The purpose of the present application is to disclose the application of soybean C2H2-type zinc finger transcription factor gene GmRGR1 in genetically engineering chlorophyll content. GmRGR1 gene is mainly expressed in soybean leaves and seeds, secondly in flowers and pods, and has a low expression level in roots and stems. Subcellular localization analysis shows that GmRGR1 is mainly located in the nucleus and cytoplasm. Molecular experiments show that GmRGR1 has transcriptional inhibition activity. Overexpression of the gene reduces the chlorophyll content of Arabidopsis thaliana.
[0005] The purpose of the present application can be achieved by the following technical solutions:
[0006] Application of soybean C2H2-type zinc finger transcription factor gene GmRGR1 in genetically engineering chlorophyll content of Arabidopsis thaliana.
[0007] In Arabidopsis thaliana, overexpression of the gene reduces the chlorophyll content of Arabidopsis thaliana.
[0008] Advantages:
[0009] We found that GmRGR1 gene was mainly expressed in leaves and seeds of soybean, followed by flowers and pods, while the expression in roots and stems was relatively low. Subcellular localization analysis showed that GmRGR1 was mainly located in the nucleus and cytoplasm. Molecular experiments showed that GmRGR1 had transcriptional repression activity. Overexpression of the gene reduced the chlorophyll content of Arabidopsis. BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1 Agarose gel electrophoresis map after PCR cloning of GmRGR1. The target fragment size is 1059 bp. Marker: DL2000.
[0011] Figure 2 Tissue expression pattern of GmRGR1. N=3.
[0012] Figure 3 Subcellular localization analysis of GmRGR1 protein. GFP, GFP fluorescence; Bright, bright field; Merge, fusion protein; 35S-GFP, empty control; 35S:GmRGR1-GFP, GmRGR1 protein with GFP tag. Scale bar: 20 μm. Figure 4 GmRGR1 has transcriptional repression activity. (A) Transcriptional self-activation activity assay of GmRGR1 in yeast cells. BD, pGBKT7; SD / -Trp, synthetic auxotrophic medium lacking tryptophan; SD / -Trp / -Ade / -His, synthetic auxotrophic medium lacking tryptophan, adenine and histidine. (B)-(D) Transcriptional regulation activity analysis of GmRGR1 using the dual luciferase (LUC) reporter system in N. benthamiana leaves. A schematic diagram of the reporter and effector is shown in (B). Representative images of a tobacco leaf are shown in (C). The measurement of relative LUC / REN in (C) is shown in (D). VP16 and GD1 were used as transcriptional activator and transcriptional repressor controls, respectively, while the GAL4BD vector is a negative control.
[0013] Figure 5 Overexpression of GmRGR1 reduces the chlorophyll content of Arabidopsis. (A) Representative morphology of Columbia wild type (Col-0) and three 35S:GmRGR1 transgenic lines. (B) Comparison of chlorophyll content of Col-0 and three 35S:GmRGR1 transgenic lines. Values for each plant are represented by a dot. Different letters indicate significant differences at the P<0.05 level determined by Duncan's multiple range test. Error bars represent ± standard error (SEM). DETAILED DESCRIPTION
[0014] The application will be further described in connection with the accompanying drawings and embodiments.
[0015] The methods used in the following examples are conventional unless otherwise specified.
[0016] Example 1
[0017] 1) Cloning of soybean C2H2-type zinc finger transcription factor gene GmRGR1
[0018] Soybean variety KeFeng No. 1 was selected as the material, and its leaves were ground in a mortar. The ground leaves were added to a 1.5 mL EP tube containing lysis buffer, shaken thoroughly, and then transferred to another 1.5 mL EP tube. Total RNA was extracted using a Total RNA Kit (Tiangen, Beijing, China). The quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and the content of the RNA was determined using a spectrophotometer. The obtained total RNA was used as a template, and reverse transcription was performed according to the instructions of the reverse transcription reagent kit (TaKaRa Primer Script RT reagent kit, Japan) provided by Japan TaKaRa Company. After obtaining the first strand of cDNA, PCR amplification was carried out. The PCR program was as follows: pre-denaturation at 95°C for 3 minutes, followed by denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 35 seconds, 35 cycles, final incubation at 72°C for 5 minutes, and then kept at 4°C. Thus, the cDNA of KeFeng No. 1 was obtained. TM
[0019] In the NCBI database and the Phytozome v13 soybean database, a gene corresponding to GmRGR1 (Glyma.12G237800, Gene ID: 100794446) was found. According to the nucleotide sequence given by the database, specific primers were designed, and the primer sequences were F1: atgacagatc ctcagtccaa ttt and R1: tcacattgaa ctctccccat catgt. The gene was amplified from the CDS sequence of soybean variety KeFeng No. 1, and after completing the PCR cloning, the gel purification of the PCR product, ligation and transformation operations were carried out. Positive single clones were selected for sequencing, and finally the CDS sequence of the soybean GmRGR1 gene with a complete coding region and a length of 1059 bp was obtained. The coding region sequence is SEQ ID NO. 1, and the size is 1059 bp (). Figure 1 The amino acid sequence encoded by the gene is shown in SEQ ID NO. 2.
[0020] 2) Tissue expression analysis of GmRGR1
[0021] In order to accurately identify the expression of GmRGR1 in different tissues, the different types of tissues of soybean variety KeFeng No. 1 at different development stages were collected. Specifically, the roots, stems and leaves at V4 stage, mature flowers at R2 stage, and seeds and pods collected 15 days after flowering. The samples after collection were quickly placed in liquid nitrogen for quick freezing treatment, and then stored in an environment of -80°C. The total RNA extraction process and step 1 were consistent. The total RNA obtained from the above different tissue sampling was used as a template to obtain cDNA by reverse transcription. The fluorescence quantitative primer sequence of GmRGR1 is F2: ctcagagaggcccttcctct and R2: cctctacaacatttgaggaggg, and the soybean internal reference gene Tubulin is selected as an internal reference for detecting the expression change of GmRGR1 gene in each tissue, and the primer sequence of Tubulin is F3: ggagttcacagaggcaga and R3: cacttacgcatcacatagca. On this basis, real-time fluorescence quantitative PCR reaction was carried out.
[0022] GmRGR1 gene is mainly expressed in soybean leaves and seeds, followed by flowers and pods, and the expression amount in roots and stems is low. Figure 2
[0023] Example 2
[0024] 1) Cloning of soybean C2H2 type zinc finger transcription factor gene GmRGR1
[0025] After synthesizing the first strand of cDNA from the total RNA of soybean variety KeFeng No. 1 leaf as a template by reverse transcription, PCR amplification was carried out, and the primer sequence was F4: acaaatctatctctctcgagatgacagatcctcagtccaat tt and R5: gctcaccatggatcccattgactctccccatcatgt. The PCR program is as follows: first pre-denaturation at 95°C for 3 minutes, then denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 35 seconds, 35 cycles, finally at 72°C for 5 minutes, then keep at 4°C. After sequencing, the CDS sequence of soybean GmRGR1 gene without stop codon was obtained.
[0026] 2) Construction of subcellular localization vector
[0027] In constructing the subcellular localization vector, the CDS sequence of the soybean GmRGR1 gene without a stop codon was inserted into the pFGC5941 expression vector with a GFP tag. This expression vector has a 35S promoter and can strongly induce the expression of the target gene in the recipient. Subsequently, the vector was transformed into Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method. At the same time, the empty pFGC5941 was also transformed into EHA105 as an empty control.
[0028] 3) Subcellular localization of GmRGR1
[0029] Bacterial liquid containing 35S:GmRGR1-GFP and 35S:GFP was injected into the leaves of 7-8 week old N. benthamiana plants, respectively. After 36-48 hours of culture, the localization of the reporter GFP was observed using a Leica TCS SP2 laser confocal microscope. According to the GFP signal display, the GmRGR1-GFP fusion protein was only localized in the nucleus, while the GFP in the empty state was localized in the whole tobacco cell. Figure 3 )..
[0030] Example 3
[0031] 1) Construction of GmRGR1 transcriptional activity vector
[0032] In the transcriptional activity assay of GmRGR1 in yeast, the CDS sequence of GmRGR1 was fused with the GAL4 DNA binding domain (BD) in the pGBKT7 vector. These constructs and the empty control BD were transformed into the yeast strain Y2HGold, and then screened according to the Matchmaker GAL4 Two-Hybrid System of the American Clontech company.
[0033] In the transcriptional activity assay of GmRGR1 in N. benthamiana, GmRGR1 was cloned into the pCAMBIA1307-3xFlag vector as an effector. Other effectors (VP16 and GD1) and reporter genes (UAS) were constructed according to previous methods (Deng et al., 2022, Proceedings of the National Academy of Sciences, 119(50): e2210338119). Empty plasmids GAL4BD, GAL4BD-VP16 and GAL4BD-GD1 were used as negative control, transcription activation control and transcription inhibition control, respectively. GV3101 strains containing reporter genes, effectors and control constructs were mixed and co-infiltrated into N. benthamiana leaves. Luciferase (LUC) imaging and LUC / REN activity detection were performed.
[0034] 1) GmRGR1 has transcriptional repression activity
[0035] When the transcriptional activity assay of GmRGR1 was performed in yeast, no transcriptional autoregulation activity of GmRGR1 was observed in yeast cells Figure 4 A), indicating that there might be a potential inhibitory domain in GmRGR1. Further bi- luciferase reporter gene assay in N. benthamiana leaves showed that the expression of GmRGR1 resulted in lower luciferase activity compared with empty vector GAL4BD ( Figure 4 B-D) and close to the enzyme activity of transcriptional repression vector GAL4BD-GD1. These results confirmed that GmRGR1 encodes a transcription factor with transcriptional repression activity.
[0036] Example 4 Genetic engineering application of gene GmRGR1
[0037] 1) Construction of plant expression vector
[0038] When constructing the overexpression vector for transforming Arabidopsis, the CDS sequence of GmRGR1 with enzyme cutting sites was obtained by amplification using primer F5: ctctctctcaagcttggatccatgacagatcctcagtccaattt R5: gatcaattcgagctcctgcagtcacattgaactctccccatcatgt. The pHB vector (Pishuang Biotechnology Co., Ltd., Shanghai, China) was double-enzyme cut, and the enzyme cutting sites were BamHI and PstI. The sequence was connected to the double-enzyme cut vector by homologous recombination to obtain the pHB-GmRGR1 plant overexpression vector. The plant transformation vector pHB contains a 35S strong promoter that can strongly induce the expression of the target gene GmRGR1 in the recipient. Then the vector was transformed into Agrobacterium tumefaciens strain EHA105 by freeze-thaw method.
[0039] 2) Obtaining of transgenic Arabidopsis plants
[0040] Using the dip method to transform Arabidopsis, Arabidopsis wild type Col-0 flower buds were immersed in the bacterial liquid of Agrobacterium tumefaciens strain EHA105 containing pHB-GmRGR1 in step 1) for 30 s to 1 min of infection. The plants were wrapped with plastic wrap or plastic bags to maintain humidity and dark incubated for 24 h. Then the plants were placed in normal conditions for further growth, and the seeds were harvested. Three homozygous 35S: GmRGR1 overexpression transgenic Arabidopsis lines were selected for investigation of chlorophyll phenotype, and the chlorophyll content of Arabidopsis was measured using chlorophyll meter SPAD-502. From Figure 5As can be seen, the growth of 35S:GmRGR1 overexpression transgenic Arabidopsis is weaker compared with Col-0. Chlorophyll content determination shows that the chlorophyll content of 35S:GmRGR1 overexpression transgenic Arabidopsis is significantly lower than that of Col-0 Figure 5 B), indicating that overexpression of GmRGR1 gene reduces the chlorophyll content of Arabidopsis.
Claims
1. Overexpression of a soybean C2H2 type zinc finger transcription factor gene represented by SEQ ID NO. 1 GmRGR1 In the application of genetically engineering to reduce chlorophyll content in Arabidopsis thaliana.