Use of PLT3 gene in regulating plant seedling stage internode and mesocotyl heat-responsive growth

By identifying the PLT3 gene as a negative regulator through omics analysis, and using CRISPR/Cas9 editing technology to regulate the thermal response growth of internodes and mesocotyls in rice seedlings, the problem of poor deep-sowing tolerance in rice varieties was solved, the seedling rate and speed of deep sowing were improved, and the application of dry direct seeding technology was promoted.

CN119709833BActive Publication Date: 2025-12-12INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411831789.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-12-12
Estimated Expiration
2044-12-12

AI Technical Summary

Technical Problem

Existing rice varieties have poor tolerance to deep sowing, which limits the promotion of direct seeding technology for rice. Furthermore, the molecular mechanisms of temperature response to growth in internodes and mesocotyls during the seedling stage have not been reported, affecting the seedling rate and speed of deep sowing.

Method used

By combining RNA-seq and ATAC-seq omics analysis, the PLT3 gene was identified as a negative regulator. CRISPR/Cas9 gene editing technology was used to weaken or knock out the PLT3 gene to regulate the heat response growth of internodes and mesocotyls in rice seedlings, thereby promoting deep sowing and seedling emergence under high ambient temperatures.

Benefits of technology

It improved the seedling rate and speed of deep sowing of rice under high temperature conditions. The mutants emerged quickly and with a high seedling rate under deep sowing conditions, making them suitable for direct sowing in dry conditions and high-temperature production in summer. It also provides genetic resources for breeding deep-sowing tolerant rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses application of a PLT3 gene in regulating plant seedling stage internode and mesodermal axis heat response growth. PLT3 is a negative regulation factor of rice deep sowing seedling. plts The seedling speed and seedling rate of the mutant under the shallow sowing condition have no obvious difference with those of the wild type, but the seedling speed and seedling rate of the mutant under the deep sowing condition are higher than those of the wild type; meanwhile, although the warm environment of 32 DEG C promotes the seedling time and seedling speed of the wild type and the mutant to be advanced, when the seedling rate of the wild type is greatly reduced at 32 DEG C, plts the mutant can still maintain a higher seedling rate. plts The deep sowing resistance characteristics and strong seedling performance of the mutant indicate that the mutant has important application value in dry direct sowing, especially in dry direct sowing production under high temperature in summer. PLTs Finding excellent haplotypes of the mutant in natural populations or cultivated varieties will be beneficial to breeding rice varieties suitable for deep sowing.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of plant genetic engineering technology, in particular to application of a PLT3 gene in regulating heat response growth of plant seedling internodes and mesocotyls. BACKGROUND

[0002] With the rapid development of industry and agriculture in China, labor transfer, reduction of agricultural irrigation water and climate change have made the production of rice face severe challenges. Dry direct seeding of rice can solve the problem of limited production to some extent, which is achieved by directly sowing dry seeds in soil at a certain depth to make the seeds germinate and grow using the water in the soil. However, the currently popular rice varieties are mainly bred for transplanting, and the poor deep sowing tolerance of most rice varieties also limits the popularization of dry direct seeding of rice. The elongation of seedling internodes and mesocotyls is the driving force for the emergence of dry direct seeding of rice, and the elongation of the two organs is affected by the external environment temperature, which helps deep-seeded rice to cope with climate change. However, the molecular mechanism of the response of rice seedling internodes and mesocotyls to temperature elongation has not been reported. Therefore, exploring the molecular mechanism of the temperature response growth of rice seedling internodes and mesocotyls, discovering key regulatory genes and their emergence potential under deep-seeding conditions are of great significance for the popularization of dry direct seeding cultivation technology. SUMMARY

[0003] The application aims to provide application of a PLT3 gene in regulating heat response growth of plant seedling internodes and mesocotyls.

[0004] The application conceives as follows: first, the changes in the tissue and cellular level of the response of rice seedling internodes and mesocotyls to temperature elongation are understood through physiological experiments, RNA-seq sequencing of seedling internodes and mesocotyls grown at different temperatures is performed, and tissue-specific temperature response differentially expressed genes are screened; further, epigenetic differences of the two tissues are compared by combining ATAC-seq data, potential regulatory genes at the two omics levels are obtained; at the same time, potential transcription factors and potential downstream regulatory genes are identified by combining the two omics data, and a gene expression regulation network is constructed. According to the analysis results, the selected potential regulatory genes and transcription factors of seedling internodes and mesocotyls are subjected to CRISPR / cas9 gene editing, and corresponding mutants are obtained to verify their functions in the heat response growth and deep seeding of rice. The application deepens the understanding of the heat response growth of rice seedling internodes and mesocotyls at the chromosomal and transcriptional levels, provides clues for further understanding of the regulation mechanism of the heat response growth of seedling internodes and mesocotyls, and multiple key regulatory genes discovered will help the application of seedling internodes and mesocotyls in direct seeding.

[0005] In order to achieve the object of the present application, in a first aspect, the present application provides any one of the following applications of a PLT3 gene of a plant AP2 / EREBP family transcription factor:

[0006] 1) regulating the heat response growth of the plant internode and mesocotyl in the seedling stage;

[0007] 2) regulating the emergence of the plant deep sowing in high environmental temperature.

[0008] The AP2 / EREBP transcription factor can integrate metabolic, hormone and environmental signals in adversity adaptation and reverse signal to regulate plant growth, and is an important part of the gene regulation network.

[0009] The PLT3 gene is numbered as LOC_Os02g40070 (AP2-like ethylene-responsive transcription factor PLETHORA 2, PLT3) .

[0010] Further, the regulation is negative regulation.

[0011] The plant includes a Gramineae plant, preferably rice, and more preferably dry direct seeding rice.

[0012] In a second aspect, the present application provides a method for promoting the growth of the internode and mesocotyl of rice in the seedling stage in high environmental temperature, the method comprising: weakening or knocking out the PLT1 gene in rice by using genetic engineering means.

[0013] In a third aspect, the present application provides a method for promoting the emergence of rice deep sowing in high environmental temperature, the method comprising: weakening or knocking out the PLT3 gene in rice by using genetic engineering means.

[0014] Further, the gene can be weakened or knocked out by using CRISPR, TALEN or ZFN gene editing technology.

[0015] In a specific embodiment of the present application, taking the PLT3 gene as a target, a sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the sgRNA sequence is connected to a vector carrying CRISPR / Cas9, and rice is transformed, so as to obtain a transgenic rice with a function loss of the gene.

[0016] Preferably, the nucleotide sequence of the sgRNA action site is 5'- AGAGAATCCGCAGCCTCACCAGG -3' (SEQ ID NO: 8).

[0017] The expression vector carrying the target gene can be introduced into plant cells by using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation and other conventional biotechnological methods (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology, 2 nd Edition).

[0018] In a fourth aspect, the present application provides the use of the transgenic rice obtained by the method in plant breeding.

[0019] The breeding method includes, but is not limited to, transgenesis, crossing, backcrossing, selfing or vegetative propagation.

[0020] By means of the above technical solution, the present application has at least the following advantages and beneficial effects:

[0021] The present application first discovers that the PLT transcription factor of the AP2 / EREBP family has a very large application value in rice dry direct seeding. PLT3 is a negative regulatory factor of deep seeding and seedling emergence of rice. The seedling stage internode and mesocotyl of the mutant are both long plts The mutant has no obvious difference in seedling emergence speed and rate with the wild type under shallow seeding conditions, but has faster seedling emergence and higher seedling emergence rate compared with the wild type under deep seeding conditions. Meanwhile, although the warm environment of 32℃ promotes the seedling emergence time and speed of the wild type and the mutant, the mutant can still maintain a high seedling emergence rate when the seedling emergence rate of the wild type is greatly reduced at 32℃. plts The mutant still maintains a high seedling emergence rate. plts The deep seeding tolerance and strong seedling emergence performance of the mutant suggest that it has important application value in dry direct seeding, especially in dry direct seeding production under high temperature in summer. Finding the excellent haplotype of the mutant in natural population or cultivated varieties will be beneficial to the breeding of rice varieties suitable for deep seeding. PLTs The deep seeding tolerance and strong seedling emergence performance of the mutant suggest that it has important application value in dry direct seeding, especially in dry direct seeding production under high temperature in summer. Finding the excellent haplotype of the mutant in natural population or cultivated varieties will be beneficial to the breeding of rice varieties suitable for deep seeding. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 is a schematic diagram of the seedling stage internode and mesocotyl of deep seeding rice seedlings in the preferred embodiment of the present application.

[0023] Figure 2 is a schematic diagram of the seedling stage internode and mesocotyl of deep seeding rice seedlings in the preferred embodiment of the present application.

[0024] Figure 3The cell expansion mediates the heat-responsive growth of the seedling internode in the preferred embodiments of the present application. Note: The four phenotypes of the deep-seeded rice seedlings grown at four temperatures for 4-6 days are the seedling internode (Inter), mesocotyl (Meso), coleoptile (Cole), and full-length above seed (Flas). The values represent the mean ± standard error, n ≥ 25.

[0025] Figure 4 The cell expansion mediates the heat-responsive growth of the seedling internode in the preferred embodiments of the present application. Note: A-B are the cytological phenotypes of the seedling internodes of indica rice A and japonica rice B at two temperatures. The seedling internode cells of indica rice NJ6 grown at 30℃ and 32℃ for 4 days, and japonica rice NIP and DJ grown at 25℃ and 32℃ for 7 days were used for statistical analysis, with a sample size of ≥ 3 and a cell number of ≥ 100. Student's t-test was used for significance analysis; the observation method of the indica rice seedling internode cells in the figure is Calcofluor White staining, and that of the japonica rice is resin semi-thin section; the scale bar is 100 μm. t-test

[0026] Figure 5 The RNA-seq data is aligned to the reference genome in the preferred embodiments of the present application. Note: Inter (seedling internode), Meso (mesocotyl), Sdl (light-grown seedling), "Inter4-30" represents the transcriptome of the seedling internode grown at 30℃ for 4 days, and "DJ-25-Inter" represents the transcriptome of the seedling internode of DJ grown at 25℃. "_1 / _2" are two biological replicates, respectively.

[0027] Figure 6 The cell expansion-related pathways are significantly enriched in the heat-responsive transcriptome of the seedling internode in the preferred embodiments of the present application. Note: A is the number of temperature-responsive differentially expressed genes (TDEGs) in the seedling internode and light-grown seedling. Inter (seedling internode), Sdl (light-grown seedling), "Inter4_30" represents the transcriptome of the seedling internode grown at 30℃ for 4 days. The seedling internode material is from deep-seeded rice seedlings, and the seedling material is from the light-irradiated tissue of the aboveground part of shallow-seeded rice seedlings. B is the GO enrichment analysis of all seedling internode TDEGs.

[0028] Figure 7 ​The heat response process of the internode in the preferred embodiment of the present application progresses layer by layer with the growth days. Note: A is the difference analysis of TDEGs of the internode in different growth periods. B is the expression trend analysis of the common TDEGs of the internode in three growth days. The numerical value in the radar chart is the difference multiple of the expression amount of TDEGs at two temperatures, that is, Log2(Fold change); wherein the blue shadow is inhibited expression with the increase of temperature in the tissues of 4, 5 and 6 days, the red shadow is induced expression with the increase of temperature, and the gray shadow is inconsistent in the temperature response change in three growth days. C is the GO enrichment analysis of the common TDEGs of the internode in three growth periods. D-E are the expression heat map D and GO analysis E of the specific TDEGs of the internode in different development stages. Z-score represents the number of standard deviations between the gene expression amount of each sample and the average of the row gene expression amount.

[0029] Figure 8 The heat response growth of the mesocotyl in the preferred embodiment of the present application is jointly affected by cell proliferation and expansion. Note: A-B are the cytological phenotypes of the mesocotyl of indica rice A and japonica rice B at two temperatures. The internode cells of indica rice NJ6 grown at 25°C and 30°C for 5 days, and the internode cells of japonica rice NIP and DJ grown at 25°C and 32°C for 6 days are used for statistical analysis, the number of statistical samples is ≥3, the number of cells is ≥100, and the student's t-test is used for significance analysis; the observation method of mesocotyl cells in the figure is Calcofluor tissue staining method; the scale is 100 μm. t-test

[0030] Figure 9 The cell proliferation and expansion related pathways in the heat response transcriptome of the mesocotyl in the preferred embodiment of the present application are significantly enriched. Note: A is the number of TDEGs in the mesocotyl and the seedling grown under light. Meso (mesocotyl), the mesocotyl material is from the deep-seeded rice seedling. B is the GO enrichment analysis of all mesocotyl TDEGs.

[0031] Figure 10 The heat response process of the mesocotyl in the preferred embodiment of the present application progresses layer by layer with the growth days. Note: A is the difference analysis of TDEGs of the mesocotyl in different growth periods. B is the expression trend analysis of the common TDEGs of the mesocotyl in three growth days. C is the GO enrichment analysis of the common TDEGs of the mesocotyl in three growth periods. D-E are the expression heat map D and GO enrichment analysis E of the specific TDEGs of the mesocotyl in different development stages. Z-score represents the number of standard deviations between the gene expression amount of each sample and the average of the row gene expression amount.

[0032] Figure 11 ​The heat-responsive transcriptome of the internode and the mesocotyl in the preferred embodiments of the present application has high similarity. Note: A is RNA-seq principal component analysis. B is correlation analysis of gene expression of all transcriptome samples. C is the number of TDEGs in the internode, the mesocotyl and the light-grown seedlings. D is GO enrichment analysis of common TDEGs of the internode and the mesocotyl in the seedling stage. E is comparative analysis of TDEGs of the internode, the mesocotyl and the light-grown seedlings.

[0033] Figure 12 The internode and the mesocotyl in the preferred embodiments of the present application have their own specific heat-responsive genes. Note: A is GO enrichment analysis of specific TDEGs of the internode and the mesocotyl in the seedling stage. B-C are heat maps of the expression of TDEGs specifically expressed in the internode and the mesocotyl in the seedling stage and the TDEGs specifically expressed in the seedlings under light B and GO enrichment analysis C. The difference fold of the average gene expression (TPM) of the same organ at all temperatures compared with the rest of the organs is ≥ 5, and the difference gene regulated by temperature is the organ-specific temperature-responsive gene. D is verification of the relative expression of tissue-specific genes. The value of qRT-PCR is the average value ± standard deviation (n = 3), and RNA-seq shows the average value of two biological repeats. Z-score represents the number of standard deviations between the gene expression of each sample and the average gene expression.

[0034] Figure 13 The quality feature analysis of the accessible chromatin regions of the internode and the mesocotyl in the seedling stage of rice in the preferred embodiments of the present application. Note: A is the fragment size distribution of the accessible chromatin regions (ACRs) of the internode and the mesocotyl in the seedling stage grown at two temperatures. The abscissa is the fragment size after Tn5 transposase cutting, and the ordinate represents the distribution percentage of different fragment sizes. B is the ATAC-seq signal profile and heat map of all samples of the internode and the mesocotyl in the seedling stage. The upper graph is the characteristic curve of the reads enrichment on the genome; the lower graph is the distribution characteristic heat map of the reads near the genes. C is the Spearman correlation analysis of ACRs of all samples of the internode and the mesocotyl in the seedling stage.

[0035] Figure 14Figure 9A and 9B show the correlation between the ACRs and the expression levels of the genes in the preferred embodiments of the present application. Note: A shows the distribution of ACRs in different regions of the genome. Transcription start site (TSS): ACRs located within the range of -1000 bp to +50 bp of the transcription start site of the gene; transcription termination site (TES): ACRs located within the range of -50 bp to +1000 bp of the transcription termination site of the gene; intron (Intron) and exon (Exon): ACRs located in the intron and exon of the gene; intergenic region (Intergenic): all ACRs in other regions. The number and proportion of ACRs are labeled in the figure. B shows the correlation between different ACR categories and gene expression levels.

[0036] Figure 15 Figure 10A and 10B show the negative regulatory factor of the heat-responsive elongation of the internode in the preferred embodiments of the present application. Note: A shows the comparative analysis of TDEGs and TAAGs specifically expressed in the internode of rice seedlings. The common differential genes of the two omics are marked in red. B-C show the phenotype analysis of the mutants of the heat-responsive elongation regulation genes of the internode. The figure shows the target position and mutant form of the edited gene in the CRISPR / cas9 gene editing system, and the IGV figure shows the changes in ATAC-seq peak value and gene expression of the corresponding gene when the internode of the rice seedling responds to temperature changes; the internode length of the related materials in the indica rice NJ6 background grown for 6 days under deep planting conditions and the japonica rice ZH11 background grown for 7 days was used for statistical analysis, the numerical value = mean ± standard deviation (n ≥ 20), and the Student's t-test was used for significance analysis; the scale is 10 mm. t-test

[0037] Figure 16 Figure 11A and 11B show the negative regulatory factor of the heat-responsive elongation of the mesocotyl in the preferred embodiments of the present application. Note: A shows the comparative analysis of TDEGs and TAAGs of the mesocotyl. The common differential genes of the two omics are marked in red. B-C show the phenotype analysis of the heat-responsive elongation regulation genes of the mesocotyl. The figure shows the target position and mutant form of the edited gene, as well as the changes in ATAC-seq peak value and gene expression of the corresponding gene during the temperature response process of the mesocotyl. The mesocotyl of the deep-planting rice seedling grown for 6 days was used for statistical analysis, the numerical value = mean ± standard deviation (n ≥ 20), and the Student's t-test was used for significance analysis; the scale is 10 mm. t-test

[0038] Figure 17 ​​In a preferred embodiment of the present invention, multiple transcription factor families were enriched in the TACRs of heat-responsive genes in internodes and mesocotyls during the seedling stage. Note: A represents transcription factors targeting TACRs in internodes and mesocotyls obtained by HOMER analysis. Values ​​in the heatmap are -log10 (p-value). Z-score represents the number of standard deviations between the mean of each sample data and the mean of the row data. B represents transcription factors involved in regulating the expression of temperature-responsive genes in internodes and mesocotyls during the seedling stage, enriched by FIMO method. Score 1-3 represent ACRs of all TDEGs in the three growth stages; Score 3 represents ACRs of all TDEGs in the three growth stages; when the ratio is >1.5, the transcription factor cluster is considered significantly enriched. C represents information on the significantly enriched transcription factor clusters. D is an interaction network diagram of AP2 / EREBP and SPL transcription factors with open chromatin regions of chromatin of genes specifically regulating internodes and mesocotyls during the seedling stage. The yellow and blue arrows target TACRs of temperature-responsive genes in seedling internodes and mesocotyls, respectively.

[0039] Figure 18 In a preferred embodiment of the present invention, the AP2 / EREBP transcription factor is a common negative regulator of internode and mesocotyl thermal response growth during the seedling stage. Note: A represents... PLTs The target sites and mutation types of gRNAs in gene mutants. BD has 3. PLTs Functional analysis of genes in the thermal response elongation of internodes and mesocotyls during seedling growth. Statistical analysis was performed on internodes during seedling growth at 7 days and mesocotyls during growth at 6 days in rice seedlings grown at 25℃ and 32℃. Values ​​are expressed as mean ± standard deviation (n ≥ 20). Student's score was used. t-test Perform a significance test; the scale bar is 10 mm.

[0040] Figure 19 In a preferred embodiment of the present invention, AP2 / EREBP is a negative regulatory factor for deep-seeded rice seedlings. Note: AB PLTs The dynamic emergence of the gene mutant under shallow sowing (A) and deep sowing (B) conditions was studied. The soil covering depth for shallow sowing was 2 cm, and the soil covering depth for deep sowing was 6 cm. Emergence was recorded daily for two consecutive weeks, with n = 24.

[0041] Detailed Implementation

[0042] The application analyzes the differences in tissue and cell behavior of the internode and the mesocotyl in the seedling stage in response to temperature growth through physiological experiments and cytological observation, mines potential key transcription factors and regulatory genes through joint analysis of transcriptome and chromatin accessibility sequencing, further analyzes the molecular mechanism of key genes participating in the heat response growth of the two organs by using genetic, biochemical and molecular biological methods, and verifies the emergence potential of the related genes under deep sowing conditions through emergence experiments, so as to provide gene resources for cultivating rice varieties suitable for dry direct seeding.

[0043] 1. Molecular mechanism of heat response growth of rice

[0044] 1.1 Heat response growth characteristics of rice internode and mesocotyl in the seedling stage

[0045] 1.1.1 The elongation characteristics of the internode and the mesocotyl in the seedling stage are the driving force for the topsoil emergence of deep-sown rice

[0046] In the process of dry direct seeding of rice, in order to enable dry seeds to absorb water in the soil for germination and growth, rice seeds are generally sown in a certain depth of soil layer. In order to successfully break through the soil and emerge, the top end of the seedling is required to have a relatively strong topsoil force to lift the top end meristem to the soil surface. According to related research, different grasses have different phenotypic plasticity in adapting to deep sowing. According to their strategies for breaking through the soil and emerging, they can be divided into three categories: when the seeds are buried in deep soil, the mesocotyl of corn and sorghum lifts the top end meristem to the soil surface; the mesocotyl of wheat seedling does not elongate under deep sowing conditions, but is elongated by the first internode to lift the top end to the soil surface; the mesocotyl and the first internode of oats and rice can elongate under deep sowing conditions, helping the seedling to quickly break through the soil and emerge (Hoshikawa, 1969).

[0047] The mesocotyl refers to the part between the coleoptile node and the point where the radicle is attached ( Figure 1 ). The mesocotyl is an important channel connecting the seed and the ground, and the varieties with long mesocotyl have good emergence performance under deep sowing conditions. As for rice, the rice varieties with long mesocotyl are positively correlated with the deep sowing emergence rate, and the emergence rate of the rice varieties with long mesocotyl is significantly higher than that of the varieties with medium or short mesocotyl. For example, Turner et al. (1982) compared the elongation of the mesocotyl of different rice varieties and their emergence rates under different sowing depths, and found that the varieties with long mesocotyl had higher emergence rate and faster emergence speed. Chung (2010) compared the emergence potential of 128 different genotypes of rice varieties under deep sowing conditions, and found that the mesocotyl of the japonica type weed rice WD-3 was the longest, and the emergence rate was the highest. Alibu et al. (2012) compared different genotypes of rice varieties, and found that only the genotypes with significantly elongated mesocotyl could stretch out from deep soil. It can be seen that the elongation of the mesocotyl provides a driving force for deep sowing emergence.

[0048] The first intemode refers to the intemode tissue between the coleoptile node and the next higher node, which is referred to as the seedling intemode in the present application. Figure 1 The elongation of the seedling intemode helps the seedling emergence from deep sowing. In rice, the seedling intemode elongation length is significantly positively correlated with the emergence rate when the soil depth is deep, indicating that the elongation growth of the seedling intemode can provide the force for the emergence of deep-sown rice seedlings (Yang, 2016). It can be seen that the elongation of the seedling intemode is a key driving force for the emergence of deep-sown rice seedlings in dry direct sowing. In summary, the elongation characteristics of the seedling intemode and the mesocotyl help to improve the topsoil force of deep-sown rice seedlings in dry direct sowing, and improve the problems of low emergence rate and uneven emergence in dry direct sowing.

[0049] Deep-sown rice has the characteristics of specific elongation of the seedling intemode and the mesocotyl. In order to explore the morphological differences between shallow-sown and deep-sown rice seedlings, we sowed the seeds of indica rice Nanjing 6 (NJ6) on the surface of water-saturated vermiculite and at a depth of 10 cm respectively and grew them in a 32°C incubator. Through morphological observation of the seedlings, we found that the deep-sown seedlings elongated between the scutellum node and the coleoptile node to form a mesocotyl, and the coleoptile node and the first node elongated to form a first intemode, usually with a greater elongation range than the mesocotyl. The seedlings of shallow-sown rice mainly showed leaf elongation, while the stem intemode tissue accumulated at the seed base showed no obvious elongation. Moreover, the seedlings of deep-sown rice elongated more rapidly than those of shallow-sown rice (Fig. 1, A-B). Then we compared the growth of the first intemode and the mesocotyl of different rice varieties under deep-sowing conditions. The results showed that the mesocotyl of different rice varieties elongated under deep-sowing conditions, and the first intemode of some rice varieties did not elongate but the second intemode elongated (such as ZH11 and NIP), and the first and second intemodes of some varieties both elongated (such as NJ6 and DJ). Therefore, we collectively referred to the first or second intemode of different rice varieties that elongated under deep-sowing conditions as the seedling intemode (Fig. 1, C). In summary, the rapid elongation of the seedling intemode and the mesocotyl under deep-sowing conditions significantly increases the overall seedling height, suggesting that these two organs may provide the driving force for the emergence of deep-sown seedlings. Figure 2 Figure 2 1.1.2 Elongation growth of seedling intemode and mesocotyl is affected by environmental temperature

[0050] 1.1.2 Elongation growth of seedling intemode and mesocotyl is affected by environmental temperature

[0051] ​The internode and mesocotyl of seedling stage have thermal responsive growth characteristics. Temperature is one of the key factors affecting seed germination and seedling emergence. To verify whether the elongation of internode and mesocotyl of rice seedling stage is affected by environmental temperature, we sowed the germinated indica rice NJ6 seeds in 10 cm deep water-saturated vermiculite, and placed them in dark incubators at 25℃, 28℃, 30℃ and 32℃, respectively, for 4-6 days, and then statistically analyzed the height of seedling stage internode, mesocotyl, coleoptile and seedling above the seed. Figure 3 The results showed that the height of seedling, internode and mesocotyl of seedling stage rapidly elongated with the increase of temperature in 4-6 days, while the elongation of coleoptile was less affected by temperature, indicating that the thermal responsive elongation of internode and mesocotyl of seedling stage might be the main reason for the increase of seedling height. In addition, we found that the elongation of internode of seedling stage was affected by both temperature and growth time; for example, the elongation of internode of seedling stage was less affected by temperature in 4 days, while the elongation of internode of seedling stage was more rapidly affected by temperature in 5 or 6 days, indicating that the elongation of internode of seedling stage was affected by both growth time and temperature. The mesocotyl slightly elongated with the increase of growth time, but the elongation was small, indicating that the change of environmental temperature was one of the main factors affecting the growth of mesocotyl. In contrast, the coleoptile only elongated in response to the increase of environmental temperature in 4 days. The above results showed that the elongation of internode and mesocotyl of seedling stage was temperature sensitive, and gradually elongated with the increase of temperature.

[0052] 1.2 Thermal responsive growth of internode of seedling stage is mainly achieved through cell expansion

[0053] To further understand the cellular basis of the thermal responsive growth of internode of seedling stage, we compared the cortical cells of internode of seedling stage grown at lower and higher environmental temperatures. First, we analyzed the cells of internode of seedling stage of indica rice NJ6 grown at 30℃ and 32℃, which rapidly elongated in 4 days. The results showed that the cell length and width of internode of seedling stage grown at 32℃ significantly expanded compared with those grown at 30℃, which led to a significant increase in cell length-width ratio and theoretical cell area, although the number of cells per unit length significantly decreased, but the total number of cells did not change. Figure 4A), indicating that the internode of NJ6 promotes the rapid elongation of its internode tissue at high environmental temperature by causing rapid cell expansion. At the same time, in order to understand whether there are differences in the cell behavior of the internode of different rice varieties at the seedling stage, we observed the cells of the internode of two japonica rice varieties, NIP and DJ, at the seedling stage. The results showed that, compared with 25℃, the cells of the internode of NIP and DJ at the seedling stage became longer and wider at 32℃, the cell length-width ratio and the theoretical cell area increased significantly, the number of cells per unit length decreased significantly, and the total number of cells in NIP did not change significantly at the two temperatures, but the number of cells in DJ showed a trend of increase Figure 4 B), indicating that japonica rice mainly promotes the elongation of the internode at the seedling stage by cell expansion, while in DJ, cell division may further promote the heat-responsive growth of the internode at the seedling stage. The above results show that cell expansion is the main reason for the heat-responsive elongation of the internode at the seedling stage.

[0054] 1.3 Cell expansion-related genes significantly change in the heat-responsive growth of the internode at the seedling stage

[0055] In order to understand the changes in gene expression during the heat-responsive growth of the internode at the seedling stage, we performed transcriptome analysis on the internodes at the seedling stage that were grown at 25℃ and 32℃ for 4 days, 5 days and 6 days. Among them, the internodes at the seedling stage grown at 25℃ for 4 days did not show obvious growth, so we chose the 30℃ internodes that significantly elongated relative to the 32℃ internodes to construct the transcriptome library. At the same time, in order to distinguish the heat response differences between the internodes grown in light and dark conditions, we introduced the transcriptome data of rice seedlings grown at 25℃, 30℃ and 35℃ in a light incubator for 2 weeks for comparative analysis. First, we performed quality control on the transcriptome raw data, and aligned the reads obtained by sequencing to the rice genome Oryza sativa MSU v7.0 (Ouyang et al., 2006). According to the statistics, the alignment rate of reads generated by sequencing each sample ranged from 86.41% to 90.72% ( Figure 5 ), indicating that the RNA-seq sequencing quality is good. Then, based on the following screening strategy: the difference in gene expression between samples is ≥ 2 and q-value < 0.05, the gene expression of the same organ at two temperatures is compared and analyzed, and the obtained temperature difference expressed genes are called thermoresponsive differentially expressed genes (TDEGs).

[0056] First, we compared and analyzed the TDEGs of internodes at the same growth stage. 5,156, 7,052, and 10,352 TDEGs were obtained in heat-responsive elongation internodes at 4, 5, and 6 days of growth, respectively. The number of TDEGs gradually increased with the extension of growth time, indicating that the changes in gene expression in internodes at the seedling stage became increasingly sensitive to temperature increases with growth time. Figure 6 A). We also compared the thermal responses of internodes in seedlings grown in the dark with those grown in the light. The results showed that in seedlings grown in the light, the number of genes upregulated and downregulated at increasing temperature were similar, while in internodes during the seedling stage, the number of upregulated genes was higher than the number of downregulated genes across the three growth days. This suggests that the elongation of the thermal response in internodes during the seedling stage may be a process of gene expression activation. Figure 6 A). Next, we performed GO functional enrichment analysis on TDEGs from internodes during the seedling stage. The results showed that genes involved in cell wall and microtubule skeleton composition and auxin signaling response were significantly enriched ( Figure 6 (B) indicates that differential expression of heat-responsive genes involved in cell wall and microtubule skeleton remodeling may promote heat-responsive growth in seedling internodes by mediating cell expansion during the seedling stage.

[0057] 1.4 The thermal response transcriptome of internodes during the seedling stage exhibits developmental time dependence.

[0058] Furthermore, we considered the influence of growth time on the thermal response elongation trend of internodes during the seedling stage. Figure 3 Furthermore, the number of TDEGs gradually increases with the extension of growth time. Figure 6 A), and then explored its thermal response regulation mechanism at the time level. First, the TDEGs of seedling internodes at three growth days were compared and analyzed. The results showed that 1,298, 969 and 4,142 TDEGs specifically responded to the temperature in the seedling internodes at 4, 5 and 6 days of growth, respectively. Most TDEGs were shared between adjacent days, while 2,021 TDEGs were shared across the three growth days (A). Figure 7 A). Gene expression trend analysis of TDEGs shared across three growth days revealed that the expression patterns of TDEGs shared across the three growth days were largely consistent during the seedling internodes. 47.5% of TDEGs were upregulated during heat-responsive growth, 40.7% were downregulated, and only a small number (11.8%) showed different expression trends across different growth days. Figure 7 B). GO enrichment analysis showed that microtubule cytoskeleton and cell wall biogenesis-related processes were significantly enriched in TDEGs common to the three growth days of the seedling internodes (B). Figure 7(C) indicates that these pathways are crucial in the growth and development of internodes and their thermal elongation during the seedling stage. Furthermore, by enriching TDEGs specific to different growth stages using GO, we found an interesting developmental progression in the temperature response of seedling internodes over time. Specifically, biological processes related to nucleic acid metabolism and gene expression were enriched on day 4, functional pathways such as membrane lipid metabolism, proteasomes, and organelles were enriched on day 5, and microtubule skeleton and cell wall formation processes were significantly enriched on day 6. Figure 7 These results indicate that rice seedlings at the 4-6 day stage mobilize relevant genes at the molecular, cellular, and subcellular levels, and then at the tissue level, to participate in their heat-responsive growth and development.

[0059] 1.5 Thermoresponsive growth of the mesocotyl is determined by both cell proliferation and expansion.

[0060] Meanwhile, to further understand the cellular basis of mesocotyls during heat-responsive growth, we compared and analyzed the cortical cells of mesocotyls in indica rice NJ6 grown at lower and higher ambient temperatures. The results showed that the cell length, width, length-to-width ratio, theoretical cell area, and number of cells per unit length of mesocotyls did not change significantly after 5 days of growth at 25℃ and 30℃, but the total cell number at 30℃ was significantly higher than that at 25℃. Figure 8 A) indicates that cell proliferation mediates the thermoresponsive growth of mesocotyls in indica rice NJ6. To verify this result, we simultaneously observed changes in mesocotyl cells during thermoresponsive growth in japonica rice NIP and DJ. Figure 8 (B) Among them, in Japonica rice NIP, the elongation and narrowing of mesocotyl cells at 32℃ led to a decrease in the theoretical cell area, but the total cell number increased significantly. In Japonica rice DJ, the length and width of mesocotyl cells both increased significantly at high ambient temperatures, and the cell length-to-width ratio and theoretical cell area both increased significantly, along with a significant increase in the total cell number. This result indicates that the mesocotyl of Japonica rice undergoes rapid elongation at high ambient temperatures through cell proliferation, and this cell elongation further promotes its thermal response elongation. These results suggest that the thermal response elongation of the mesocotyl is mainly achieved through cell proliferation, and due to the diversity of rice varieties, cell expansion further promotes the thermal response growth of the Japonica rice mesocotyl.

[0061] 1.6 Transcriptome changes related to cell proliferation and expansion promote mesocotyl thermal elongation.

[0062] Next, we explored the heat-responsive growth mechanism of hypocotyls by transcriptome sequencing of hypocotyls grown for different days at two temperatures. First, we compared the TDEGs of hypocotyls grown for the same time. We obtained 7,774, 2,072, and 2,950 TDEGs in heat-responsive hypocotyls grown for 4, 5, and 6 days, respectively. The number of TDEGs tended to decrease with the extension of growth time, indicating that the changes in gene expression in hypocotyls were more sensitive to temperature increases at the early growth stage. Figure 9 A). Meanwhile, compared with seedlings grown under light, we found that, unlike the activation of more internode gene expression at high environmental temperature, high environmental temperature tended to inhibit more hypocotyl gene expression, suggesting that heat-responsive growth of hypocotyls might be a process of gene expression de-repression. Figure 9 A). Next, we performed GO functional enrichment analysis of all hypocotyl TDEGs. The results showed that genes involved in cell cycle, DNA replication, microtubule skeleton, and cell wall composition were significantly enriched. Figure 9 B), indicating that the expression changes of related TDEGs might promote the rapid proliferation and expansion of hypocotyl cells during heat-responsive growth, thereby promoting the heat-responsive elongation growth of hypocotyls.

[0063] 1.7 Heat-responsive transcriptome of hypocotyls also has developmental time dependence

[0064] Further explore the regulatory mechanism of hypocotyl heat-responsive growth at the time level. First, we compared the TDEGs of hypocotyls grown for three days. The results showed that 5,391, 695, and 690 TDEGs specifically responded to temperature changes in hypocotyls grown for 4, 5, and 6 days, respectively; similar to internodes in seedlings, most TDEGs were shared by adjacent days of hypocotyls, with 544 TDEGs shared by the three growth days. Figure 10 A). Further gene expression trend analysis of TDEGs shared by the three growth days showed that the expression patterns of TDEGs shared by the three growth days were basically consistent, with 23.7% TDEGs up-regulated, 56.1% TDEGs down-regulated, and 20.2% TDEGs with different expression trends in different growth days. Figure 10 B). Similar to internodes in seedlings, cell wall biogenesis-related processes were significantly enriched in TDEGs shared by the three growth days of hypocotyls. Figure 10(C) indicates that this pathway is crucial in the growth and development of both organs and in their heat-responsive elongation. Furthermore, GO enrichment analysis of TDEGs specific to different growth stages revealed a heat-responsive developmental process in the mesocotyl that differed from that in the seedling internodes. Translational and protein metabolism processes were enriched on day 4, while secondary metabolic processes were enriched in temperature-responsive genes specific to days 5 and 6. Figure 10 (DE). The above results indicate that the heat-response transcriptome of the rice mesocotyl also exhibits developmental time dependence, and its heat response during growth days 4–6 encompasses related biological processes from primary to secondary metabolism.

[0065] 1.8 The temperature response transcriptomes of internodes and mesocotyls during the seedling stage showed high similarity.

[0066] Meanwhile, we compared and analyzed the thermal response transcriptomes of internodes and mesocotyls during the seedling stage to explore the similarities and differences between the two organs in thermal response growth. First, the results of principal component analysis (PCA) and correlation heatmaps showed that samples from internodes and mesocotyls during the seedling stage had higher correlations, and samples from both organs clustered together, unlike those from seedlings grown under light which were dispersed. Figure 11 The results suggest that the differentially expressed genes in internodes and mesocotyls of seedlings grown under dark conditions are more similar compared to those grown under light. Secondly, TDEGs in internodes, mesocotyls, and seedlings grown under light were compared and analyzed. The results showed that a total of 13,473, 9,519, and 7,942 TDEGs were obtained in internodes, mesocotyls, and shared by both at the three growth days, respectively. Fewer TDEGs were detected in seedlings grown under light (s3,649), and only 1,748 TDEGs were shared by all three. Figure 11 (C) This result further illustrates that TDEGs in seedling internodes and mesocotyls have certain similarities. Next, we performed GO functional annotation on TDEGs shared by the two dark-growing organs and by tissues growing under both light and dark conditions. We found that processes such as ribosomes, translation, polypeptide synthesis and metabolism, and microtubule scaffold remodeling were significantly enriched in the TDEGs shared by the two dark-growing organs. Cell wall biogenesis and metabolic processes were enriched in the TDEGs shared by all three organs. Figure 11 The expression changes of genes involved in the basic rate-limiting steps of cell growth and development, such as ribosome biogenesis and polypeptide synthesis, indicate that changes in the expression of genes in seedling internodes and mesocotyls induce rapid elongation in response to increased temperature. Changes in the expression of genes involved in cell expansion promote the thermal response growth of the two dark-growing organs and light-growing seedlings.

[0067] 1.9 Heat-responsive genes specific to internodes and mesocotyls during seedling stage

[0068] GO enrichment analysis of 4,894 shoot internode-specific and 1,390 mesocotyl-specific TDEGs obtained by comparing TDEGs of shoot internodes, mesocotyls and seedlings grown in the dark showed that shoot internode-specific TDEGs were enriched in biological pathways related to various RNA metabolism and modification, while cell wall reorganization-related genes were significantly enriched in mesocotyl-specific TDEGs (Fig. 2A), indicating that the two organs have different heat-responsive growth mechanisms. Meanwhile, we obtained 237 shoot internode-specific, 429 mesocotyl-specific and 728 seedling-specific TDEGs by screening genes with a fold change ≥ 5 and temperature-dependent expression in the same organ compared with the rest of the organs (Fig. 2B). GO enrichment analysis showed that cell wall biogenesis and auxin response-related pathways were enriched in shoot internode-specific TDEGs, mesocotyl-specific TDEGs were mainly involved in cell wall biogenesis-related processes, and photosynthesis, enzyme activity and redox reaction-related processes were enriched in seedling-specific TDEGs (Fig. 2C), indicating that the two organs grown in the dark and seedlings grown in the light have their own specific heat-responsive growth mechanisms. Figure 12 Figure 12 Figure 12 C). To verify the reliability of the two organ-specific TDEGs screened, we reprocessed a new batch of biological samples and selected three shoot internode-specific TDEGs LOC_Os10g27280 , LOC_Os12g44270 and LOC_Os09g24840 , and three mesocotyl-specific TDEGs LOC_Os10g31620 , LOC_Os10g01930 and LOC_Os10g31540 for qRT-PCR gene expression detection. The results showed that the gene expression trends of the six selected genes in RNA-seq and qRT-PCR were basically consistent (Fig. 2D), indicating that our RNA-seq data and the screened tissue-specific genes are reliable. The above results show that shoot internodes and mesocotyls have their own heat-responsive genes, and the heat-responsive differential expression of these genes mediates their heat-responsive elongation growth. Figure 12

[0069] 1.10 Transcriptional regulatory network related to heat-responsive growth of shoot internodes and mesocotyls

[0070] ​​​To further investigate the heat-responsive growth mechanism of internodes and mesocotyls during the seedling stage, we used Assay for Transposase Accessible Chromatin with high-throughput sequencing (ATAC-seq) to map the whole genome of accessible chromatin regions (ACRs) in the internodes and mesocotyls of 6-day-old indica rice NJ6 seedlings. First, we assessed the quality of all ACRs obtained from all samples. The results showed that the size of ACR fragments was mainly distributed between 30 and 900 bp; simultaneously, due to the periodicity of nucleosome arrangement, most fragments were concentrated between 100 and 250 bp. Figure 13 A). Secondly, analysis of the distribution density of ACRs in genes and neighboring genes across all samples revealed a similar distribution pattern for ACRs in all samples, with these ACRs primarily enriched at transcription start sites (TSS). Figure 13 B) indicates that the upstream regulatory regions of these genes are open, allowing some transcription factors to dock with these regions and thus regulate the expression of neighboring genes. Next, we calculated the correlation between different samples. The correlation between the two biological replicates was high, with a correlation coefficient exceeding 95%. Figure 13 C). Statistically, over 32,000 high-resolution ACRs were obtained in each sample. The majority of ACRs (~70%) were located in the proximal region, including approximately 35% upstream of the transcription start site (TSS), approximately 15% in introns and exons, and approximately 10% downstream of the transcription termination site (TES); a minority (~28%) were located in the distal region or intergenic region. Figure 13 A). Meanwhile, we found that the proportion of ACRs in the proximal regions of genes in internodes and mesocotyl samples grown at 32℃ was significantly higher than that at 25℃, especially the number of ACRs located in exon regions was significantly increased. Figure 14A). ACRs located in different regions of the genome are often associated with gene expression levels, such as distal ACRs that are widely used to predict putative enhancers in plants, while proximal ACRs are closely related to gene expression (Tian et al., 2021). Therefore, we integrated the gene expression data obtained from the transcriptome and chromatin accessibility, and the results showed that the number of related genes containing only a single category of ACRs was the largest, and the expression abundance of related genes containing ACRs only in the TSS, Exon and Intron regions was significantly higher than that of TES and Intergenic; fewer genes were detected to contain multiple categories of ACRs, but the related genes containing multiple categories of ACRs had higher expression levels, and the few related genes containing 5 categories of ACRs had the highest expression abundance; Overall, ACRs in the proximal TSS region of the gene contributed the most to gene expression (Fig. 2A). Figure 14 B). The above results show that the chromatin accessible regions of the rice seedling internode and mesocotyl affect the expression abundance of their adjacent genes.

[0071] At the same time, we compared the organ-specific expressed TDEGs in the transcriptome and TAAGs in ATAC-seq, and the overlapping genes of the two were considered as the key regulatory genes of the heat-responsive elongation of the seedling internode or mesocotyl. Through comparative analysis, we obtained 154 key regulatory genes of the heat-responsive elongation of the seedling internode and 41 key regulatory genes of the heat-responsive elongation of the mesocotyl (Fig. 2B). Figure 15 A and Figure 16 A). Further selection of some genes by CRISPR / Cas9 gene editing technology to obtain loss-of-function mutants for observation of the heat-responsive elongation phenotype of the two organs. First, the mutant of LOC_Os12g10670 encoding the AAA-type ATPase family protein im1 and the mutant of LOC_Os03g31430 encoding the terpene synthase im2 The length of the seedling internode of Figure 15 was not significantly different from that of the wild type at 25°C, but was significantly longer than that of the wild type at 32°C, and the heat-responsive elongation trend of the seedling internode of the two was significantly increased compared with the wild type (Fig. 3A, B-C), indicating that LOC_Os12g10670 and LOC_Os03g31430 negatively regulate the heat-responsive elongation growth of the seedling internode. Second, the mutant of LOC_Os10g01930 encoding the transferase family protein mm1The mesocotyl was significantly longer than the wild-type at 25°C, encoding a glycine-rich cellwall structural protein 2 precursor. LOC_Os10g31540 mutant mm2 The mesocotyls of the mutants were significantly shorter than those of the wild type at 25℃, while the mesocotyls of both mutants were significantly longer than those of the wild type at 32℃, and the thermal response growth trend of the mesocotyls was slightly increased compared to the wild type. Figure 16 (BC) indicates LOC_Os10g01930 and LOC_Os10g31540 Negative regulation of mesocotyl thermal response elongation. These results collectively confirm the reliability of the key regulatory genes screened through combined RNA-seq and ATAC-seq analysis in regulating the thermal response growth of both organs.

[0072] Because ACRs contain specific cis-acting elements, they allow trans-acting factors to dock and thus regulate gene expression (Tian et al., 2021). Therefore, we sought to identify key transcription factors regulating the expression of heat-responsive genes in internodes and mesocotyls during the seedling stage. First, we used the HOMER (Hypergeometric Optimization of Motif Enrichment) tool to enrich transcription factors in TACRs of internodes and mesocotyls during the rice seedling stage. The results showed that transcription factor families such as SPL, MYB, bHLH, C2H2, Zf, and Homeobox were significantly enriched in rTACRs of both internodes and mesocotyls during the seedling stage; among them, rTACRs of internodes recruited MADS-box transcription factors, while rTACRs of mesocotyls recruited transcription factor families such as TCP, bZIP, NAC, and WRKY; at the same time, we found that the AP2 / EREBP transcription factor family was recruited in iTACRs of both internodes and mesocotyls during the seedling stage (iTACRs). Figure 17A), which indicates that TACRs in the heat-responsive growth of the two organs recruited very abundant transcription factors to regulate the expression of TDEGs. Then, we further scanned the ACRs of TDEGs in the two organs using the FIMO (Find Individual Motif Occurrences) tool to enrich transcription factors involved in the regulation of the expression of TDEGs. According to the similarity of the target motif binding of the transcription factors, all the enriched transcription factor families were divided into 44 clusters, each of which contained one or more transcription factor families. The results showed that the 2nd, 8th, 10th, 23rd, 26th, 35th, 40th and 41st transcription factor clusters were significantly enriched in the heat-induced and up-regulated genes (up-regulated TDEGs) in the internode of seedling stage, and the 21st and 30th clusters were enriched in the heat-repressed and down-regulated TDEGs (s down-regulated TDEGs) in the internode of seedling stage; compared with the internode of seedling stage, the 40th transcription factor cluster was recruited only by the up-regulated TDEGs in the mesocotyl, and the 21st transcription factor cluster was recruited only by the down-regulated TDEGs in the mesocotyl Figure 17 B). Since the 2nd, 8th and 10th transcription factor clusters significantly enriched in the up-regulated TDEGs in the internode of seedling stage all contained AP2 / EREBP transcription factors, and the two organs both recruited the 21st transcription factor cluster containing SPL (SQUAMOSA promoter-binding protein-like) transcription factors Figure 17 C), and moreover, both of the two gene families were significantly enriched in the two transcription factor enrichment modes, we considered that the two transcription factor families were crucial for the heat-responsive growth of the internode of seedling stage and the mesocotyl. Further mining of the interaction network of the AP2 / EREBP and SPL transcription factor families with the key regulatory genes of the internode of seedling stage or the mesocotyl, the proportion of the connection of the key regulatory genes of the internode of seedling stage to the two transcription factor families through different types of TACRs was higher than that of the mesocotyl, in which the AP2 / EREBP transcription factor family was connected to the TACRs of 14 internodes of seedling stage and 7 mesocotyls, and the SPL transcription factor family was connected to the TACRs of 26 internodes of seedling stage and 2 mesocotyls Figure 17 D), indicating that the AP2 / EREBP and SPL transcription factor families were crucial for the regulatory network of the heat-responsive growth of the internode of seedling stage and the mesocotyl.

[0073] The following examples are intended to illustrate the present application but not to limit the scope of the present application. If not specifically mentioned, the technical means used in the examples are the conventional means well known to those skilled in the art, and the raw materials used are commercially available.

[0074] Example 1 AP2 / EREBP family negatively regulates the heat-responsive growth of the seedling internode and mesocotyl

[0075] PLETHORA (PLT) transcription factors of the AP2 / EREBP family play an important role in the growth and development of plants (Aida et al., 2004; Scheres & Krizek, 2018; Hao et al., 2023). In the present invention, we found that the AP2 / EREBP transcription factor family may regulate gene expression by binding to the ACRs of the TDEGs of the seedling internode, and thus further explored the role of the AP2 / EREBP transcription factor family genes in the heat-responsive growth of the seedling internode.

[0076] Selection LOC_Os01g67410 ( AP2 / EREBP transcription factor BABY BOOM, PLT5 ), LOC_Os02g40070 ( AP2-like ethylene-responsive transcription factor PLETHORA 2, PLT3 ), LOC_Os04g55970 ( AP2-like ethylene-responsive transcription factor AINTEGUMENTA, PLT1 ) gene construction gene editing mutants to verify the heat-responsive growth phenotype of rice seedling internode and mesocotyl.

[0077] In the present invention, LOC_Os04g55970 ( PLT1 ) the genomic nucleotide sequence, CDS sequence and the amino acid sequence of the encoded protein are shown in SEQ ID NO: 1-3, respectively; LOC_Os02g40070 ( PLT3 ) the genomic nucleotide sequence, CDS sequence and the amino acid sequence of the encoded protein are shown in SEQ ID NO: 5-7, respectively; LOC_Os01g67410 (PLT5) the genomic nucleotide sequence, CDS sequence and the amino acid sequence of the encoded protein are shown in SEQ ID NO: 9-11, respectively.

[0078] First, we edited the genes of PLT1 , PLT3 and PLT5 by CRISPR / Cas9 technology, and obtained functional deletion mutants of the three genes, i.e. plt1 , plt3 and plt5 mutant ( Figure 18 A) with 2 base deletions and 1 base deletion, 1 base deletion and 1 base insertion, respectively. These editing forms all lead to premature termination of protein translation.

[0079] The target sites of the CRISPR / cas9 genes are as follows:

[0080] LOC_Os04g55970 (PLT1 ): 5′-TGAGATCGGCCGGTATAACGTGG-3′ (SEQ ID NO: 4)

[0081] LOC_Os02g40070 ( PLT3 ): 5′-AGAGAATCCGCAGCCTCACCAGG-3′ (SEQ ID NO: 8)

[0082] LOC_Os01g67410 ( PLT5 ): 5′-CATGAGGGGATCGGAGCTCTCGG-3′ (SEQ ID NO: 12)

[0083] The primers for identifying the relevant mutants are as follows (SEQ ID NO:13-18):

[0084] plt1 -F:5′-AGCAGCCCGTGTTTGGAATA-3′

[0085] plt1 -R: 5′-GAAGAGCTGTGAACGCAAGC-3′

[0086] plt3 -F:5′-TACCTCCCCCGTATCAGCTT-3′

[0087] plt3 -R: 5′-GCATGCATACCTTGTGCCTC-3′

[0088] plt5 -F:5′-GTCTGCTTCAACATCCCCCA-3′

[0089] plt5 -R: 5′-AATCTCCTTGCGACCACCAG-3′

[0090] Next, we observed the growth phenotype of the relevant mutants during the seedling stage internode heat response. The results showed that three... plts The internode length of the mutant seedlings was not significantly different from that of the wild type at 25℃, but was significantly longer than that of the wild type at 32℃, and also became more sensitive to increases in ambient temperature. Figure 18 (BD), indicating PLT1 , PLT3 and PLT5 Negative regulation of internode thermal response growth during the seedling stage. Simultaneously, three... plts The results of the mesocotyl thermoresponsive growth phenotype of the mutants showed that the mesocotyls were significantly longer than those of the wild type at 32℃, and the thermoresponsive trend was also correspondingly increased. Figure 18(BD), indicating that these 3 PLTs The gene inhibits the heat-responsive growth of the mesocotyl. These results indicate that the AP2 / EREBP transcription factor is involved in the heat-responsive growth process of internodes and mesocotyls during the seedling stage. PLT1 , PLT3 and PLT5 All of them are negative regulators of the thermal response growth of internodes and mesocotyls during the seedling stage.

[0091] To determine the impact of internode and mesocotyl elongation during the seedling stage on rice emergence potential, we studied deep-sown and shallow-sown rice seedlings. plts Statistical analysis was performed on the emergence rate of the mutants at two temperatures. First, under a shallow sowing condition of 2 cm, three... plts The germination rate was similar to that of the wild type at 25℃; however, at 32℃, the germination rate of all three species... plts The germination rate of both types was significantly higher than that of the wild type. Figure 19 A). Secondly, under the condition of a seeding depth of 6 cm, plt1-1 The germination rate of the mutant was similar to that of the wild type at 25℃. plt3-1 and plt5-1 The germination rate of the mutant was slightly higher than that of the wild type; at 32℃, the germination rates of both the wild type and the mutant decreased significantly, while the germination rates of the three mutants were... plts The mutant still maintains a higher germination rate compared to the wild type. Figure 19 B), indicating PLT1 , PLT3 and PLT5 All of these were negative regulatory factors for deep-sown rice seedling emergence. Simultaneously, we found that under both deep and shallow sowing conditions, the emergence rate of all materials grown at 32℃ was significantly accelerated, and... plt3-1 and plt5-1 The germination rate of both types is faster than that of the wild type. Figure 19 The results (AB) indicate that high ambient temperatures accelerate seedling emergence, and plants with significantly elongated internodes and mesocotyls during the seedling stage emerge even faster. These results suggest that having both longer internodes and mesocotyls during the seedling stage can accelerate the emergence of deep-sown seedlings and increase the seedling emergence rate, indicating that the driving force for rice seedling emergence is the combined elongation of internodes and mesocotyls during the seedling stage.

[0092] The characteristics of internode and mesocotyl elongation during the seedling stage are of great significance for the promotion of direct seeding technology in rice. This invention discovers that transcription factors involved in the heat-responsive growth of internodes and mesocotyls during the seedling stage show considerable application potential in improving the seedling emergence rate of deep-seeded rice. These genetic resources may help to breed more rice varieties suitable for direct seeding in dry conditions.

[0093] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. A method for promoting the growth of the internodes and mesocotyl of rice seedlings at high environmental temperatures, characterized by, The method comprises weakening or knocking out the PLT3 gene in rice by genetic engineering means. The genomic nucleotide sequence, CDS sequence and amino acid sequence of the protein encoded by the PLT3 gene are shown as SEQ ID NO: 5-7, respectively.

2. A method for promoting emergence of deep-sown rice at high environmental temperatures, the method comprising, The method comprises weakening or knocking out the PLT3 gene in rice by genetic engineering means. The genomic nucleotide sequence, CDS sequence and amino acid sequence of the protein encoded by the PLT3 gene are shown as SEQ ID NO: 5-7, respectively.

3. The method according to claim 1 or 2, characterized in that, The gene is weakened or knocked out by CRISPR, TALEN or ZFN gene editing technology.

4. The method of claim 3, wherein, Taking the PLT3 gene as a target, a sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the sgRNA sequence is connected to a vector carrying CRISPR / Cas9, and rice is transformed to obtain transgenic rice with the function of the gene being lost.

5. The method of claim 4, wherein, The nucleotide sequence of the sgRNA action site is 5'-AGAGAATCCGCAGCCTCACCAGG-3'.

6. Application of the transgenic rice obtained by the method of any one of claims 1-5 in rice breeding for deep sowing and germination of rice at high environmental temperature.

7. Use according to claim 6, characterized in that, The breeding method comprises transgenesis, crossing, backcrossing, selfing or vegetative reproduction.

Citation Information

Patent Citations

  • Applications of rice OsGY1376T mutation material in cultivation of direct-seeded varieties with high seedling emergence rate

    CN108588253A

  • Use of morphogenic factors for the improvement of gene editing

    CN111886337A